最近接收的50条短信

Apple

5 小时前
Your Apple ID Verification Code is: 581858

audio

5 小时前
data:audio/x-wav;base64,UklGRiR0BABXQVZFZm10IBAAAAABAAEAQB8AAIA+AAACABAAZGF0YQB0BAAGAAAAAADy//X/AgAKAAYA+f/1/wMACgAAAAAADAAGAPn/AAAAAAAAAAANAAMA/P/8//n/8v8AAAYAAAD5//n/+f/8/woABgAAAPn/AAAAAAAABgAAAPn/AAAGAAAABgD5//L/BgAGAPn/AAAGAAAABgAGAPz/+f/y/wAAAAD5/wAAAAAAAPn/9f8JAAIA/P8CAAMAAwAGAAAA+f8AAA0A+f8AAAAABgAAAPj/AAAGAPn/AAAGAPn/+f8AAAAAAAAAAAAAAAAAAPn/BgAGAAAADQAAAAAAAwADAAMAAwD8//X//P/1/wAAAAAAAAAA8v/5/wAAAAAAAPn/BgANAPL/AAAGAAAABgANAPz/+f8GAAAA+f/5/wAABgAGAAAAAAD5//n/AAAAAAAAAAAAAPn/AAD5/wMA/P/8/wMACgADAAAABgAAAAAABgAAAPn/BgAGAAAA8f/5/wwAAAD4/wAAAAAAAPn/+f8GAAYAAAAAAAAABgAAAAYAAgD1//n/BgD5//n/AAD5//n/AAAGAAAA8v8DAAMA/P8KAAYAAAAGAPn/8v8NAAAA+f8AAAYABgD5//n/AAAAAAYA8v/5/wYAAAAAAAYAAAAAAAAA+f/5/wYA+f/1/wMAAgAGAAAAAAAAAAAABgAAAPn/+P8AAAwABgAAAPj/8f/5/wAAAAAAAPn/+f/8/wIA+P8AAPj/+P/4/wgACAAAAP7/+f/x//7/+f8AAAYAAAAAAPn/AAAAAAAAAAD5/wAA9f8CAAwA+P/4//j/+f/y/wAABgD4//j/8f/+/wAA8v/0//v/AgACAAAA/P/6/wUAAQAAAP7/8f/4/wAAAAAGAA0AAwD8//z//P/8//z//P/5//H/+f/4//r//v/4/wAA8f/4/xQACADq//H/AwD+/wAAAQANAP7/BgADAO3/+f8AAA0ACQD1//X/8//t/wgAAQDx//n/+f/t/wMACgD8//T/9f8DAAkA/P/8/xAACQAAAPj/BgAAAAYAAAAAAPj/8f/4/wAACAD+//3/9f/y//7/8f/y/wAA/v/4//n/AAD1//z/9P/7/wMA/P8DAAMACQD9/wYABgD5/wAAAADw/wAAAAAMAPz/8f/4/wAABgADAPX/+f/w//7/AADr//D/8P8AAAEAAAAGAAYA+P8GAAAA+P/4/wAAAADx//n/AAD4//H/9P/+/wYA+f8AAAYADQDq//H//v/4/wAAAAD4//H/8f8AAAgABgD4//H/AAAAAPj/AADx//H/BgAGAPH/+f8GAP7/AAD5//j/+P/4/wUA+P8AAAYA+v/1/wMA/P/0//3/9f/5/wAA+f/5//n/AAD0//r//v8AAAEABgD+//H/BgAGAAYAAgD7//z/9f/7/wEA/f/9//v//P/8/+z//P8AAPj/+v/5//7/+P/5//n/9P/z/wkABgD5//n/AgD7//v/AAAGAAYABQD7//L/8f8FAAIA+f/q//n/BgAAAAAADgAAAPH/8f/5/wYABgDx//j/AAAAAAwA+f/w//7/DAD5/+v/AAD+//7/+f8GAPn/BgAGAOr/AAANAAkA8v/s//z/BADt//H/8v/w//j/AQAAAAYA8v/0/wkAAwAAAPj//v8GAAAA+P8FAAMA9f8AAAMA/P/s/+z/AAD5//H/+P/+/wYA+f8GAPn/AAAGAPn/8f/x/wAA8f/7//v/AAAGAAYAAAD5//j/6f/4/wAAAAAMAAYAAADp//b/CAD5//j/8f8AAP7/4/8DAAMA7f/7/wIAAgAAAAAA/P/+/wAAAAAGAP7/BgDx/wAACADx//j/AAAAAPD/+P8AAAAAAAAAAPj//v/4//H/BgAOAPn/+P/4//H/8f8AAA4A+f/x//X/CQD+//7/BgD5//j/BgD4//j/BgAIAPn//v/x//j/AAD4//7/+f/x//j/8f/+//7/8f8AAAwAAADy/wYAAAAAAAAA8v8AAPn/7v8DAAkA/P8CAAkA/P8CAAkABgD5/wYAAAD5/w0AAAD5/wAAAAAAAPn/AAAGAAAAAAAAAA0A/P/5/wAAAAAGAAAAAwD8//L/+f/y//z/CQD8//z/AwD8/wMAEQAGAAAAAAAAAAAAAAAGAAAABgAJAPz/9f/5/wYAAgD8//n/8v8AAPn/+P8AAPv//P/9/wkAAgADAAoA+f/9/wMACQAGAPn/BgAGAAAAAAAGAAoA/P/8//X/+f8AAPn/AAAGAAYA+f8AAAAAAAD5//L/BgAGAAAAAAAGAAAA8v/5/wYABgAGAAAAAAAAAPn/BgAGAPL/AAANAPn/AAAAAAAABgAAAPn/AAD5//n/AAD5//X/AwAQAPX/AwAKAAAA/P8NAA0A+f8AAAAABgAAAAoA/f/1/wIA9f/y/wAAAAD4/wAAAAAGAPn/8v/8/wIACQAAAAAAAAAGAAAAAAAAAAAAAAAAAAYAAAD5//L/AAAGAPn/AAD5/wYABgD5/wAAAAAGAAYA+f8AAAYA+f/5/wYAAAAAAAAA+f8AAPL/AwAAAPz/AwACAAYAAAAAAAAAAAANAAAA8v8GAAAABgAGAPn/BgADAAMA9v/9//3/AADy//j/8v8CAAYAAAAAAPn//f/2//z/EAAKAPz/AwAGAAAAAAAGAAYABgADAPz/AwADAPz/7v8AAAAABgD8//z/AAD5/wYAAAD5/wAABgAAAPL/+f8GAPL/AwAUAAAA+f8AAAYAAAAAABQAAgD1//z//P/5//n/BgAAAPn/AAAGAAAA+f8AAAYAAAAAAAAA+f8AAAAA+f/5/wIAAwD9//z/AwAJAAIABgAGAAAAFAACAP3/9v/8//n/+f8GAAAABgAAAAAA+f/5/wYAAAD5/wAAAAAAAPn/AAAGAAYAAAAAAPn/8v/1/wMACgD8/wMACgD1/wMAEAAAAAAAAAAGAA0AAAAAAAAAAAD5/wAABgAAAPn/+f8AAPL/9f8DAAMACgADAAAAAAD8/wYAAAD5/wAADQAGAAYA+f/5/wAABgAFAAMA8f/5/wYAAAD5/wAABgAGAAAAAAAGAPn/6//5/wYA+f8DAPz/AgADAPz/AwACAAMAAwAGAAYADQD5//n/BgAGAPn/+f8GAAYAAAAAAAAA+f8AAAAAAAD5//L/AgADAPz//P/8/wIAAgAKAAMAAwAAAAYADQAAAPn/AAAGAAAABgD5//n/AAD5//n/+f8GAAAA+f8AAAAA+f/9/wIAAgD8/wMAAgD9/wkADAAAAPn/BgAAAPn/BgAAAPL/AAD5/wAABgDy//z/AwAKAAYA+f/5/wYABgAAAPn/BgANAAIA/P/y//n/+f/5/wYAAAAAAAYA8v/5/wYABgD5//n/BgAAAPn/BgANAAAA+f8GAAYA/P/8/wAAAgD1//n/AAAAAPn/8v/8/woABgAAAPn/AAAAAAAAAAAAAAAA+P8NAAUA+f/4/wYABgAGAPn/+f8GAAAAAAD5//L//P8DAAMA/P8KAPz/AwAGAAYAAAAAAAYAAAAAAAAA+f8AAPn/+f/8//z/9f8JAAkA9f/8/wkAEQAAAAYAAAD5/wAABgAGAAAAAAAJAPz/9f8DAPz/+f8GAPz/+f8GAPL/AAAGAAAA+f/5/wAA+f8AAAYAAAAAAAAAAAAGAPn/AAAAAPj/+f8FAAYAAAAAAPn/AAAMAAAA+f8AAAYA8v/5/w0A+f/5/wAA+f8DAAYA+f8GAPn/+f8NAAYA8v/5/w0A+f8AAAYABgAAAAAABgD5/wAA+f8AAAYAAAAAAPn/AAAAAPn/BgAGAPn/AAD5//n/AAD5//z/AwACAAMAAwANAA0A+f8AAAYA+f8GAPn/BgAGAPz/+f/5/wYAAAAAAAYA+f8AAAAAAAAAAPj/AAAAAAwAAAD5/wAA+P8AAAAA+f/5/wMAFAAAAAAAAAD5/wAAAAAAAAAABgAGAPL/+f8AAAYADQD5//L/BgAAAOv/AgAKAPn/AwAGAAYAAAAAAAYAAAANAPX/+f8AAPn/AAAGAAAABgAKAPX/AAD5//L/+f/8//z/AwADAAoABgAAAAYAAAAGAAAAAAANAPz/8v8AAAYA+P/5/wUA+f/x//3/AgAJAAYA+P/5/wwAAAD5/wAAAAAAAA0AAAAAAAAA+f8AAAYAAAAAAPL/AAAAAPn/BgD5/wAA+f8DABQAAADy/wYAAAAGAAYA+f8AAAYA+f8AAPn/+f/5/wAABgAGAAAABgAGAAAAAAAAAAAAAAAAAAAAAAAAAPn/AAAAAPn/+f/8/wIAAwADAAMABgAGAAAAAAANAAoACQACAPz//f/1//3//f/1//H/+f/4//z/AgADAPz//P8KAAMAAwADAPz/CQAGAA0AAAAGAAAACgD8/+7/AAAAAAAAAAAAAPn/AAAAAAAAAAD5/wYABgDy//n/DQD5//n/AAAAAAYAAAAAAAAAAADy/wAA/P8KAAYA+f8NAAYA+f/5/wYABgAAAAoA/P/1/wAAAAAAAAAA+f/5/wYABgDy//n/+f/8/wMAAgD9/wMACgACAAAABgAAAAYABgD5/wAAAADr//z/AgADAAMA/P8DAAMA/P8DAPz/EAANAPn/AAAGAA0A+f/y/wAABgAGAPn/+f8GAAAA8v/y//z/CgD1//z/CgAQAAYAAAAGAAYAAAADAAMA9f8DAPX/AAACAPX/8v/5/wAA8v/8//z/AwAJAPz/9f8DAAoAAwD8/wIACgACAAUAAAD4/wAAAAAAAAYAAADy/wYAAAAAAAAABgAUAAkA9f/8/woA9f/1//X/CQD8/+7/+f8AAPn/6//8/wMA/P/1/wMACgAJAAkA9f/8/xEADQAGAAAADQD8/wMA/P/1/wMA/P8CAPX/8v8GAAAA8v/5//n/9f/8/wIA/P8CAAkAAwADAAoABgAGAAAAAAANAAkA/P/8/wMA/P/u/wAAAAD5//n/AAAAAAAAAAD5/wAAAAAGAAAABgAGAPL/AADy//z/CQD8//X//P8DAAMA/P8JAAoA/P8CAA0ABgAAAAYA+f/5//n/AAD5/wYABgD5/wAA+f/5/wAAAAAAAAAABgD5/wAADQAAAPn/AAAGAA0AAwD8//X/+f/5/wAAAAD5/wAABgAGAPL/AAAAAA0ABgD5//n/BgAAAAAABgD4/wAAAAD5/wAA+f8AAPj/AAD8//3//f/8/wIAAwAJAAkABgAAAAYABgAAAAYAAwADAPz/9f/8//z/+f/5//L/+f8CAAMA/P/8/wkAAwD8/wMAAwACAPz/AwAJAAAAAAAGAAYAAAAAAAYACQD8//X//P8AAAAAAwD8//n/AAAAAAAAAAD5//n/+f8AAAYA+f/5/wYADQAAAAAA+f/5/wAAAAAAAAAADAAGAPn/AAAGAAAABQACAAMA9v/1//n/BgAAAPL/+f/5/wMA/P/8/wMACgAGAPX/CgAUAAAA+f8AAAAABgAGAPn/+f8AAPn/AAAGAAAA+f/5/wAADQAAAPn/AAAAAAAAAAAUAAIA9f8AAAAAAAAAAPL/AAAAAAAA+f8AAAAAAAANAAYA+f/5/wAADQAGAPn/AAAGAAAAAAAAAAAAAAAAAAAAAAD5//n/+P/8/wUAAAD4//z/AgADAAIABgAAAAYAAAAAAAAAAAD5//n/BgAAAPn/BgAGAPn/AAANAAAAAAAAAAYAAwACAPz/9f/5//n/+f8AAAAAAAAAAAYAAAD5/wYAAAD5/wAA+f8AAAYA8v8CAAAAAAAGAAAABgANAAMA/P/1/wAABgD8//L/+f8AAAAAAAAAAPn/9v/9//3/AgAQAPX/AgAJAAMA/P8MAA0AAAAGAAMA/P/8/wMAAwD1//X/AADy//n/AAAAAAYAAAD5/w0AAAAAAPH/BgAGAPj/+f8AAAAA8v/5/wMABgAAAAYABgAAAPn/+f8GAAYABgAGAPz//P/8/wAAAAAAAAAAAAAAAPn/8v/5/wMAAwAGAAAA+f8AAAYABgD5/wAAAAAAAAYABgD5//n/AAAAAPj/BgAGAPn/+f8GAPn/+f8AAAAADQAGAPn/AAAGAAAABgADAAIA9f/5/wAA+f/5//n/+f8DAPz//P8DAAoAAwAGAAAA8v8CAA0A+f8AAA0ABgAGAPz/AwD8//z//P/8//z/+f/5/wAA+f/5//n/9f/8/woAAwD8/wkAAwADAPz/CQANAAYAAAD5/wAA+f8NAAAA+f8GAAAAAAAAAAwA/f/2//n/BgAGAPn/AAAAAAAA+f/4//n/AAAAAAAAAAD5/wIA/P8CAAkA+f8DAAYAAAAGAAYABgAJAPX//P8KAPX/9f8DAPz//P/8//z/+f/5//n/+f8AAAAAAAAAAAAABgAAAPn/BgAGAAYAAAAAAAAAAAAGAPn/BgAJAPz/AwD1//X/AAD5//n/AAAAAAAA+f/5/wMABgDy//z/CQAGAPn/AgADAAAAAAD9/wMADAD5//n/AAAAAAYABgAAAPn/AAAAAAAAAAD5/wAAAAAAAPn/BgAGAAAAAAAAAAYAAAD5//n/BgAAAPn/8v8DAA0AAAAAAPn/+f8AAAYAAAAAAAYAAAD5/wAABgAAAAAAAAD5//n/AAANAAYA+f8NAPn/AAAGAPL/BgAAAPL/8v8DAAIA/P/8/wkACQAAAAYA+P8AAAUAAAAMAAIA/f/9//z/DwACAPX/9v/y/wAA+f8AAPn/AAANAAAA+f/5//n/AAAAAPz//P8CAAoABgAGAAAA+f8AAAAAAAAGAAAABgAAAPn/BgDy/wAABgAAAPn/+f8AAAAAAAAAAAAAAAAGAAAABgDy//n/AADu//z/AgADAPz//P8KABgA+f8GABQACgADAPz/AwD8//z/7v/q//L//f/8//z/AwACAP3/AwAKAAIADQAGAPH/AAAGAAAA+f/5/wAAAAAGAAAABgAAAAAABgD5/wAADQACAPz//P/1/wAAAADy/wAA+f/5/wYA+f8AAAYAAAAAAPn/DQAUAO7/+f8NAAAAAwD1/wAABgADAPX/+f8GAPL/+f8AAAAABgAAAA0ACgD8//z//P/8//n/AAD5//L/AAAAAAYA+f/1/wIADwDy//z/CQAGAAAABgAGAPn/BgAAAPn/AAAGAAAAAADx//j/+//7/wEA+/8JAPz/9v8DAAsABAALABkA+v/5/w0A///4//D/9///////+P8CAAYABwAOAAQABAASAAcA+f/y//X/9P/0//f////x/+7/9f8DAAMACgAEAAQAFQAHAAAABgAGAAkAAgDt/wEAAgDu//j/AAAAAAAA+f8AAAYABwAAAAcAAwD8//b/AAD4/wAA//////f/9//7//v/AgACAAMACwD+//7/EgAOAPr/BwD5//j/////////9/8FAP//+P8NAAYAAAAAAPr/BwAHAAAA+f8AAPj////x//v/+//0//v/+////wYACgAKABIABwAHAA4AEgADAPX/9f8BAAEA9P/s//f/+P/q/wIA/f/2/wsA/v8EAAsAAwANAAwABQABAPv/AgD7/+3/AAAAAAAA+f/y//n/AgAGAAAAAAD5/wAABgD5/wAABgAGAAYAAAD5/wAAAAAGAAYA/P/5/wAAAADy/wAABgAAAPn/+f8AAAYAAAD5/wYAAAAGAAYAAAAAAPn/AAAAAAAAAAAGAPL/+f8GAAAAAAAAAAYA+f8AAAAAAAAGAAAA+f8AAPn/+f/8/wMAAwACAPX/AgAKAP3/CQAAAAYABgAGAAcAAwADAPz//P/1//z/AgACAO7/6v/4/wYABgDy//z/CgAAAAAAAAAAAAYABgAAAAAADQAKAPz//P8CAPz/9f/8//H/8f8GAAAA8v/8/woAAAD8/woABgDy/w0ADQAGAAMAAwD8//z/9f/8//H/AAAGAOr//P8JAAAABgD5/wAADQD5/wYABgD5/wAABgAGAPH/AAAGAPH/+f8AAAYA+P8AAAAA9v8DAAoAAAAAAAAADQAAAPn/+f/y/wIACQAGAAAA+f8GAAYAAAAAAAYAAAD5/wYABgD5/wAABgAAAPn/AAAAAPn/BgAAAPn/8v/8/wIACQAAAPn//P/8/wkAAgADAAMA/P8DAAMABgD5/wYABgAGAPn/BgANAPz//P/8//z/+f8GAPn/+f8AAPL/9f/8//z/CQACAP3/AwAXAAUAAAAAAAAABgD5//n/+f8AAAAA8v8DAAkABgAAAPL/AAAAAAAAAAANAAYA+f8AAA0A/P/5/wAA8v/r//z/AwADAAMA/P/8/wIACQAJAAYADQAKAPX/AAACAAMA/P/1//n/8v8GAAYA+f/5/wYA+f8AAAAA+f8AAAAABgAAAPn/AAAAAAAA+f8AAAYAAAD4/wAABQAGAAAABgAGAP3/+f/x/wAADAAAAPn/DQD5//L/BgAGAPL/8v8NAAYA8v/5/wIA/P8CAPz//P/8//z//P8DAAMA/P8KABAAAAANAA0AAgADAPz//P/1//n/+f8GAPn/+f8AAAYA+f/r/wMADQDy//z/CQD8//z/CQANAAAAAAD5/wYAAAD5/wYABgAAAPn/+f8GAAAAAAAAAPn/BgANAAIA9f8DAAIA9f/4/wAA+f8AAPj/+f/1//z/CQADAAMADQDy/wIABgD5/wAAAAANAAYAAAAAAAYA+f8GAAIA9f8AAAYA/P/y//n/AAAGAPn/8v/8/wkABgAAAAAABgAAAAAA+f/5//n//P8KAAAAAAAAAAAABgAAAAAABgAGAAAAAAD5/wAAAAAAAAYA+f/5/wYAAADy/wAAAAAAAAAABgD4//n/DAAMAPn/+P8AAAAAAAAGAAYA+f/5//n/AAD5/wAABgD5//n/BgANAAYAAAAJAAMA/P/8//z//P8CAAIA/P/1//X/+f/5/wAA+f/1/wMADQAAAPn/BgAAAAYABgAGAAAAAAAGAAkA/P/n/wAABgDy/wAABgDy//n/AwACAAAAAAAAAAAAAAAAAAAAAAAAAPL/AwD8/wMACQAAAAYABQD5//j/BgAAAAAABgAAAPn/BgAAAPn/BgAAAPn/AADy//z//P/8/wkACgAGAAAAAAAAAAAA+f/5/wYABgAAAAYAAAAGAAAAAwD1/wAABgD8//z/+f8AAAAAAAD5/wAAAAAAAPn/8v8JABQAAADy//n/AAD5/wYADQD5//L/9f/8/woAAgD8/wIACgADAAAABgANAAYA+f8AAAYAAwD9/wIA/P/1/wIA9f/4/wAA8f/y//3/9v8CAAMA/P/8/wMAAwADABEABgAGAAYAAAAGAAMA/P8DAPz/9f/8//n/+f8AAAAA8v8AAAAABgAGAPn/8v8DAAAA/P/8//z/AwADAAMA/P/8/wkACgAAAPz/DQAGAPL/AAANAA0ACQD8//z/9f/1/wAA8v/r//z/AwAJAPz/9f8DAPz//P8JAAMA/f8CAAoA/f8JAAYADAAGAPn/+f8AAAAAAAAAAPn/AAAAAAYADQD5//n/+f/5//n/BgAAAPL/AwACAPz/AwAKAAAA+f8GAAAA+f8GAA0A+f/5/wAAAAAAAAAABgAAAAAA+f/5//n/AAAAAA0A+f8AAAYA8v8AAAYA+f/5/wYAAAAGAAYA+f8AAPn/+f/5/wMABgAAAP7/8f/x/wUA/v/+//j/+P/4//j/+P/4/+n/+P/4/+r/9f/6/wIA+P/x//v//v/x//7//v/4//j/6v/4//H//v8AAAAA+f8GAA0A+f/5/wAAAAD5/wAA+f/8/wkADQAAAAAADQADAPz/AwD8//X/AgD8//X/+f8AAPn/8v/8/wMA9f8DAAkACQAGAAYAAAAAAAYABgADAAMA/P/1//L/BgAAAPn/BgAGAAIAAwD8//v//P/9//3/+f/4//n/+P/9/wMABgD5/wIAAwAGAAYAAAD5/wAABgAAAAAA+f8AAAYAAAAGAAYAAAAAAPn/+f/5/xQABgDr//L/AwAGAPL/9f8CAAMA/P8DABAABgAAAPn//P8NAAYA+f/5/wYAAAAAAAAAAAAUAAIA/P8CAPz/9f/1/wAAAAD5//n/+f8AAAAAAAAGAAAA+f/x/wIACQAAAAAA+P8GAAAABgAMAAAAAgADAPz//P/8//L/AAAGAPn/8v8AAPn//P8DAAoABgAAAAAAAAAAAAYABgAAAAAA+f/5/wAAAAD5//n//P/8/wIAAwD1//z/CQADAAkADQD5//n/BgAGAAYADQAKAPz//P/8/+7/8v8GAPn/8v/1//z/CgADAPX//P8KAAoAAgACAA0AAAAAAAYA+f/4/wAADAAAAPH/8v8CAAYAAAAFAAYA+P8AAAYABgD5/w0A/P/5/wYA+f8AAPn/+f8AAPL/AgADAPz/9f8DABAA/P8DAAIABgANAAYAAAAGAPz/AwD8//z/9f8AAAAA8v/5//X//P8RAAAA9f/8//z//P8DAAkACgAGAAYADQAAAAAAAAAAAAAA+f8GAPn/8v/5//z/AwANAAAA+f8GAAAAFAACAPz//P/1/wAA+f/4/wAA+f/5/wAA/P/1//z/EAD8//z//P8DAAoAAwD8/wkADQANAAkAAwACAPz//P/1//X/+f8AAAAA+f/5//L//P8DAAoAAAAAAAAABgANAAAA+f8AAAAA+f8AAAAA+f8AAPn/BgAGAAAADQAAAPn/AAAGAAYA/P/8/wMAAwD8/wMA7v8AAAAA8v8AAPL/9f8JAAMAAgAFAAAABgAGAAAAAAAGAAUA8v/4/wAA+f8AAAAA+f8GAA0AAAAAAAAADQD5//n/AAD5/wAABgAAAPn/+f8GAAAA8v8GAAAA+f8AAAAA+f8GAAAA+f8GAAYABgAGAAIA/P8DAAMA9f8CAAoA9f/1//z/8v/r//z//P/8//z//P8KAAoA9f8KAAkA/P8KAAYABgAGAAYAAwADAPz//P/9//3/9v8AAPH/BgAGAPj/+f/4/wAA+P/8/woAAAD5/w0AAAD5/wYABgD5//n/+f8AAAAA/P8GAAAAAAAGAPn/AAAAAAYADQAAAAAAAAAAAAAAAAAJAPX/+f8GAAAAAAD5/wAAAAD5/wAABgAAAPL/+f8GAAYABgD5//n/AAAAAAAA+f8AAAAABgD5//X/CQAAAAAADQAAAAAABgAAAAYAAAAAAPj/AAAAAPn/AADx/wYA8f/8/wMA/P8JAAIABgAGABQA+f/5/wYABgD5/wYAAwD8//X/AAAGAOv/+f8GAPn/+f8CAAAAAAD8//X/CgAJAAYA+f/8/w0AAAAAAAAAAAAAAPn/BgAGAAYA+f/5/wYADQACAPX/+f8AAAYA+f8AAAAA+f8AAPn/+f/1//z/AwADAPz//P8DABAA/P8JAAwAAAAFAAAABgACAP3/AwD8//b/+f8AAAYAAAAAAPn/+f8NAAAA8v/y/wYADQAAAAYAAAAGAPz/+f8GAAkA/P/r/wAABgD5/wYAAADy/wAADQD5//n/BgAAAAAABgAGAAYA+f8AAAYAAAAAAOv/AAAGAAAAAAD5//L//P/8/wkACQD1/wMAAwD8/wIAAgADABAADQANAPz//P8DAPX//P/y//L/BQAAAPj/+f8AAAYAAAAAAAAAAAAGAAYABgD5/wAADQD8//z//P/5//L/+f8AAAAA+f/8/wkA/P/8/woABgAGAAAABgAGAAYAAwADAPz//P/8//z//P/8//z/8v/y/wAAAAAAAPn/9f/8/wMAAwAKAA0ABgDy/wAABgAAAPL/AwAUAPn/+f8GAAAAAAAAAAAABgAAAAAAAAAAAAYA+P/5/wUA+f/y//X//f8DAPz/+//9/wMAAgACAAoAAwAJAAYADQANAAIAAgD8//z/AgD8//z/9f/1//z/+f/y//n/9f/8/wIA/P8DAAkAAgACAAMABgAGAA0ACgD1//j/AAAAAAYAAAAAAAAAAAD5//j/+f8AAAAA+P8AAAYAAAAAAPn/AAAAAPn/AAAAAAAAAAAGAPn/AAAAAPj//P8DAAYAAAAFAAYABgAAAAAABgD8//z/+f/4/wAA+f/5/wAABgD5//n//P8CAAMAAwAGAAYAAAAGAA0AAwD8/woAAwD8/wIA/P8DAPX/7v/5//n/AAAGAAAA6//8/wMAAwADAA0AAAD5/wYAAAAAAAAAAADy//z//P8KAPz/9f8QAAkABgAAAAYA+f8AAAAAAAAGAAYABgD8/wIA9f8AAPn/BgD4//n/BQDy//j/9f/9/w8AAwAFAAAABgAGAPn/BgAAAPL/+f8AAPn//P8DAPz//P8CAAkAAwD8//z/EAANAAAABgAKAPz//P8KAAMA9f/1//z/9f/y//L/AAAGAPn//P8DAAYAAAAGAPn/AAAAAA0ABgAAAAYA/P/8//z/AwACAPz/AwD8//X/8v/5/wAA+f/5//z/CgAGAAYAAAAAAAYABgAAAPH/+f/4//3/AgADAPz/AgACAP3/AgAKAAMABgAGAA0ACQAKAAMA/P/1/+7/+f8GAPn/8v/5//z//P8DAPX//P8DAAMACQADAAMA/P8QABQA+f/5/xQAAgDu//n/AAAAAAAAAAD5//L//P8JAAYABgAAAAAAAAAAAPn/AAAGAAAA8v8AAAAA+f/8//X//P8DAAMAAwARAAYA+f8AAAYADQAAAAAAAAAAAAAABgD8//n/AAAAAPH/+f8GAPn/+f8GAAYAAAAAAAYABgAAAAYA/P/5/wAAAAAGAPn/+f8AAPn/AADy//z/CgADAPz/9f8CAAoADQAGAAYADQDy/wAABgAAAAAAAAAAAAAA8v/r/wMAAgD8//z//P8KAAIAAgAQAAYABgAAAPn/AAAAAAYABgAAAAAA+f8AAAAABgADAPL/AAD5/wAAAAD5/wAABgD5//n/DAAGAPn/+f/5/wAABgD5/wAABgD5/wAABgAGAAYAAAD5/wAADQADAPz/9f8AAAAA+f/5//n/+f/1//z//P/8/wIA/P/8/wMAAwADAAIACgAUABQACQD8/wMAAwD8//z/9f8DAAkA/P/u//X/+f8AAAAA+f/5/wYA+f/5/wAAAAAGAPn/AAAGAAAAAAAGAPj/BgAGAPL/+f/4/wMAAAAGAAYA+f8GAAAABgAGAAIA9f/5/w0A/P/8/wAA+f8AAPn/AAAGAPL/+f/8/wMACQAGAAAA8v8NAAYA8v8GAA0A+f/y/wYADQD5/wAA8v8AAAYA8v/8/wMAAgADAAYADQANAAMA/P/8//X/+f8GAAMA/P/8//z/AAD5//n/+f/5//z/CgAGAPL/AgANAAAA+f8FAAYA+f8AAAAA+P8GAAAAAAAGAAAAAAAAAAAA+f/y//z//P8KAAYA+f8DAAYAAAAAAAAA+f8GAAAA+f8GAAYAAAAAAAYAAADy/wYABgAAAPn/BgAGAPn/+f8GAAYAAAAAAPn/+f/5//n//P8CAPX/AwACAPz//P/8/xEACgD1//z/AwAJAAIA/P8JAAYABgAGAAYACgD8//z/9v/9/wIA9v/5//j/8v/u//3//P8CAAkA/f8JAAMA/P8JAAMADQD5/wAADQAAAAAAAAD5/w0ACQD8//X/AwD8//z//P/1/wAA8v8GAAAA8v8GAPn/AAD5//z/CQD8//z/AwAKAAAAAAAAAAYABgAAAAAABgAGAPz/AwD8/wIAAgADAPz/9f/8/+7/+f/5//L/AgADAAIA/P8DAAIA/P8CAAkAAwANAAwAAAADAP3/+f/4/wAAAAD5//j/+f8CAAAAAAD8//z/AgD8/wMAAgAJAA0AAAAAAAYAAAAAAAAA+f8AAPL/+f8DAAMAAAAAAAYAAAD5/wYAAAD5/wYAAAAAAPn/BgAAAAYAAAD5/wYA+f8GAAYAAAAAAPn/BgAAAAAABgD5//n/AAANAAAA8v8AAPn/AAD5//z/AwD8//z/AgADAAoABgD5/wYABgAAAAYAAAAGAAAAAgD1/wAABgADAPz//P/1//L/+f/5//z/7v/1/wYAAwADAAkACgAJAA0ABgAAAAAABgACAAMAAwD8/+7/+f8AAPn/AAAGAPn/AAAGAAAA+f8AAAYABgAAAAYA/P/5//L/+f8GAAYAAAAAAAAA+f/5/wAA+f8DAAYAAAANAAYAAAAGAPz/+f8AAAYA+f/y/wAAAADy//3/CQD9//3/AwD8//3/AwADAPz//P8KAAMAAwAQAAAAAAANAAYA8v8AAAYAAAD5/wAA+f/y//z/AwADAPz/AwADAAkABgAAAPn/AAAGAAYAAADy/wYABgD5/wAA+f/5/wAAAAAAAAAAAAAAAPn/+f8GAA0ADQD8//z/AgD1/wAAAADy//n/AAD5//z//P/1//z/CgAKAAMACgAAAAwABgAGAAkA/f8DAPX//P/9//L/+f8GAPn/+f/5/wYABgD5/wAAAAAGAPn/AAAAAPn/AAAGAAAA+f8AAPn/AAD8/woAAAAAAAAABgAGAAYA+f8AAA0A/P/8//z//P8AAAMA/P/8//n/+f8NAAMA8v/5/wYA+f8AAPn/+f8AAPz/AwADAPz//P8JAPz/AwAJAAMAAAAAAAAAAAAAAAwA+f8AAAwAAwD1/wAAAAD5/wAAAADy//n/AAD8/wMA9f/u/wYACgD1/wAACQADAAoACQAGAAYABgAGAAAAAAAAAAAAAAAAAAAA+f8AAAAAAAAAAAAA8v/5/wYAAAAGAAYAAAD5//n/BgAGAAAA+f/5//n/9f8DAPz/AwD8/wMAAgAJAAMA/P8DAAoABgAGAAAAAAANAAMAAgD1//z//P/y//n/AAD5/wAA8v/1/wMA/P/8//z/AwAJAAMAAgAKAA0ABgAAAAYAAAAAAAIA/P/5/wAAAAAAAAAA+f/5//L/AwANAAAAAAAAAAAABgAGAAAAAAAAAPn/AAAAAPn/+f/5//z//P8DAAMA/P8CABEADQAAAAAABgAJAPz/AwAJAPz//P/8/wMA9f/n//L/8v/8/wMA/P/8/wMACQAJAAMAAAAGAAUAEwADAP3/AgD9/wMA/P8CAO7//P8DAO7/6//5/wYAAAD5/wMABgAAAPn/AAAAAAYABgAGAPn/+f8AAAYA+f/5/wAABgD5//X/AwAKAAYAAAAGAAAABgAJAPX/AAAKAAMA9f/1//n/AAD5//n/AADy//X//P8CAAkAAwD8/wMACgD8/wkABgAGAAAAAAANAAoA/P/1//z//P/8//3/8v/x/wYAAAAAAPn/AAAAAAAAAAAAAAAA+f8AAAYAAAAAAAAABgAAAPL/AAAGAAAAAAD5/wAA8v8JAAYA+f8AAAYADQAAAPn/BgAGAAMA/P/1//n/8v/5//z//P8DAAkABgDy//z/AgD8/wIACgAGAAYABgANAPz//P8DAAIA9f/y/wAA+f8AAPn/+f8AAAYABgAGAPn/AAAGAAAABgD4/wAABQAAAAAA8v8AAAAA+f/5//z//f/8/wIAAgD8/wMAEQAAAPz/BgANAAYACQAKAPz//P8DAPz/9f/8//X//P8DAPL/8v/y//z/AgACAAMAAgD8/wkABgAAAAYA+f8GAAYAEQADAPX/AgD8//X//P/8//z/AAD5//n/AAAGAPn/BgAAAAAAAAD5/wYA+f/5/wAADQAAAAAABgAGAPn/AAAGAAAA+f8AAAAAAAAAAAAABQD5/wAADQAAAAIAAwD1//n/AAAAAPn/+f/5//z/AwADAPz//P8KAPz/CgAGAPn/AwAGAAYABgAGAPn/AAAGAAAAAAD5//n/BgAAAAAAAADy//n/AAAAAPX//P8KAPz/AwACAAMA/P8CAAkAAwANAAYA+f8GAA0A/P/1//n/+f8GAAAA+f8AAPn/AAAAAAAAAAAAAAYAAAAAAPn/BgAMAPz/AAD4/wAA8v/y/wMA/P8DAAkAAAD8/wMADQAGAAYABgD8/wMAAwD8//X//P/8//n/AAAAAAAAAAD5//n/+f8AAAAAAAAAAAAADQD5//n/DQAGAAAAAAD5/wAABgD5/wAA+f8AAAYAAAD5//n/AAAAAAAAAAAGAAAABgD5//n/DQAGAPn/AAAGAAYA+f/y//L/AgADAAAAAAAAAAAAAAAAAAAA+P8GAA0AAAD5/wAABgAAAAAAAAAGAAAA+f8AAPn/+f8AAAYA+f/5/wAABgAAAPn/BgAGAPn/8v8DAAAAAAAAAPX//P8JAPz//P8DAAkABgAAAAAAAAANAA0AAwD8//X//P/8//n/+f8AAPn/+f8AAPn/9f/8//z/AwD8/wMACQD8//z/CgAJAAYABgANAAAAAwAJAAIA7v/9/woA9v/u//j/+f/5//n//P/8//z//P8DAAMACgAQAAAA+f8AAAYAAAAAAAYA+f8NAAMA+f/5//n/AAAAAPn/AAAAAAAABgANAAAAAwD8//n/BgADAPz/8v8GAAAA8v8AAAAAAAD5//X/AwADAPz/AwAKAA0AAAAAAAYA+f8GAAAA+f/5/wYAAAAAAAAA+f8AAAAABgAAAAAABgDy//n/AAAAAAUAAAAAAAYA+f/y/wYAAAAGAAAA+f8AAAAA+f8AAAYA+f/y/wMADQAGAAAADQADAPL/AAAAAAAAAAAAAAAA+f8AAAYAAADy/wAA+f8GAAAA+f/1//z/CgAJAAYAAAD5/wAABgAAAPn/AAAGAAYAAAAGAAAA+f8AAPn/+f8AAAAAAAAAAAAA+f/5/wYABgD4/wAADAAAAPH/AAAGAAAA+f8FAAYA8v/x/wMABgAAAAYAAAD5/wYABgAGAAIA/P8DAPz/9f8CAPz/9f8AAPL/AAAAAOv//P8CAAkAAwADAA0ADQAKAPz/9f8AAAIA9f8AAAYA+f/y//n/BgAGAPn/AAD5//X/AwANAPn//P8KAPn/AwADAAAAAAAGAAYA+f8AAAAABgD5//n/AAAGAAYAAAAAAAUAAADx//n/AAD4/wAAAAAAAPj/AgAGAPL/AgADAAYABgAAAPn/AAANAAAA8v8AAAYAAAAGAAYA+f8AAAAAAAD5//n/AAANAAAAAAD5//n/DQANAPz//P/8//n/AAAAAAAAAAAAAAAABgAAAAAAAAD5/wAADQAAAPn/AAAAAPn/8v8DAPz//P8KAAMAAwAGAPn/DQANAPn/8v8AABQAAgD2//n/AAAAAAAAAAD5/wAAAAD4//n/AAD8/wMAAgACAAMA/P/8/wkABgAGAA0AAAAAAPn/BgAGAPz//P/5/wAA8v/5/wAA+f8DAAYA+f/8/wIABgD5//z/AwD8/wMAAgADAAIABgAGAAAABgAAAAAA+f8AAAAAAAD5/+v//P8QAAAAAAANAAYA+f8AAA0A/P/8/wMA/P/y/wYAAAD4//n/AAAAAPj/BgAAAPj/BgAFAAAA+P8GAAYA+f/5/wAABgAAAPn/BgAGAPn/AAAAAA0AAwD1//n/+f8AAAAABgAGAPn/+f8AAAAA+f8AAAAAAAANAPn/8v8NAPn/8v8KAAAABgAGAAAABgAAAPn/8v/1//z/AwD8//z/EQAJAAAADQD5/wAABgD5//n/+f/8//z//P8JAAIA/P8KAPz//f8QAAwA+f8AAAAABgD4//n/BQD5/wAAAADy//z/DQAAAPn/+f8DAAAAAAAGAAAA+f8NAA0A/P8CAPz//P/y/wYAAAD5/wYA+f8AAAYABgACAPX/AAADAPn/BgD8//n/8v/5/wAA/P/8//z/AgAQAA0AAAAAAA0AAwD8/wMA/P/u/wAA+f/5/wAA+f/5/wMABgAGAA0ACgD8//X/AAAAAAAAAAAAAPn/8f8AAAAABgAGAAAA8v/4/wYAAAAAAPn/AAAAAAAABgAGAAYA+f8AAAAAAAANAPn/AAANAPX/AAAAAAAABgADAPX/+f/5//L/9f/1//X/AAAGAAYABgAJAAkACgAGAA0AAAAGAAIA/P/8/wMA/P/8//z//P/8//z//P/8/wMAAwD1/wMA7v/y/wAA+f/8/wMAAgD8/wkABgD4/wAABQAGAPn/BgAHAPn/BwANAP3//f8DAPz//P/1//H///////j////5/wYA+f/9/wsAAAAAAAcAAAD5//j/+//7//r/+/8BAPv//P8RAAsACAAWAAEAAQARABEA+P/0//P/8//w//D/8f/8/wMA/f8LAAQACwAOAAAABgD4////9//+////9////wAABgAAAPr/BwAOAAoA9v/y/wAAAAAGAP//8f/4/wAABgAFAP//+f////j/9f8DAAMABAAEAAQA/f8DAAoAAAD4//v/+v8BAPr/CAAIAAAAAAAAAA8ACAABAAEACwAKAPz/9P/s/+//9v/v//r/+//1//3/BAAFAAUADAATAAcAAAAAAPf/9//+//3//v/+/wUABgAAAPr/CAABAAEACAAAAAoA/P/0//f/9//w//T/CAD7/+7//P8JAAoAAwADAAMAFQAPAPv/BgAEAP3/9v8AAP//8P/3//b/8//z/wgAAgAKAA4AAQAIAAkADAAEAAoAAwD0/wEA+v/s/+j/7//+//T/9f/9/wQADAAFABMACAD6/wYABQD///7/9v8EAPf//v8FAPn/AAAHAA8ABQD+//7/BAD9//z/AgD7/+3/9//3//f////4//z/9v8DAAQA/f8EAAMABAADABEAAAD6/wYABQAMAAEA9P/2//7//v/4//j/BwAAAAEAAgACAAgACAD6/wAA8P/w/wAAAAD5//r/CAACAP3/CwACAAkAEAACAAEAAAAGAP7//f/2//X/9v/2//v//P8LAAgACQACAAIACQAIAPn/AAAFAPb//f/9/+//8P/7/wIAAwAEAAwACAAIAAEAAAAHAPn///8FAPf/BAD+//f/8f8AAAAABgAAAPP/BgAAAPn//P8NAAYA8v8GAAAA+f/5/wAAAAD5//z/AwAKAAAA+f8GAA0ADQACAPz//P8CAPz//P/8//X/AAD5//n/+f/5/wAABgAAAPn/AAAAAPn/AwAAAAAAAAD8/wYAAAD5/wAAAAAGAAAABgAGAAYA/P8AAAoA/P/8//z/9f8AAAMA9f/5/wAAAAD5//j/+f8CAAYA+P/9/wIA/f8DAAIACQAAAPn/AwADAA0A+f8GAAAAAAANAAIA9f8CAAkA9f/8/woA9f/u/wAA+f/r/wYA+f8DAAMA9f/8/wkAAwD8/woAAwADAAYAAAAAAAAABgANAAAAAAADAAIA/P/8/wMAAgD8//X/9f8AAAAA8v8AAPn/+f8GAPn//P8KAAYA+f8AAPn//P8JAAAAAAAMAAYAAADy//H/BgAMAPn/AAAMAAAA8v8GAA0A/P/8/wAAAAD5/wAADQD5/+v/AAAAAPn//P8DAPz//P8DABAADQAGAAYAAAAAAAAAAwD8//z//P8AAAAA+f8AAA0A/P/8//n/AAD5//n/BgAAAAAA+f8GAAAA+f8GAAAA8v8AAA0AAAD5/wAABgANAAIACgD8//z/AwD8//X/8v/5/wAA+P8AAAUAAAD4/wAAAADy/wMADAAAAPj/AAAAAPn/BgAGAPn/+f8AAAYAAAD5//n/AwAGAAYADQAAAAAAAgD5/wYAAwD8//X/AAADAPL/AAAGAPn/+f8AAAAA+f8AAAAA+f/1/wMACgADAPz//P8DAAMACgAAAAAABgAGAPn/BgAGAAYACgD8//X/9f8CAAMA/P/u/wYA+f/y//n/AAAGAAYABgAAAPL/AAAGAPn/+P8HAAUA+f8NAAAA//8AAPP//////wcABgD//wAAAAD4/wAABwAAAPj/AAAAAAAAAAD5//n/9v8JAAIAAwAAAPv/CgAHAP//+f8OAPj/+P8AAPn/BQAGAAAA+P8AAAYAAAAAAPn/AAAAAPn/+P8GAPn/+//8/wMAAgACAAcAAAD4/wYAFQACAPX/AwD8//z//P/z/wYA+f/y/wYAAAAGAAAAAAAFAPn/AAAAAAAA+f8AAAAA+f8GAAAAAAAAAAAA+f/y/wIAAwADAAYABgAAAAAAAAAGAPn/8v8GAAYAAAD5/wAABgANAAoA/P/8//z/9f/5//n/+f/5//n//P/8//z/CgAKAPz//P/8/wMAAgADAAMACQAAAAYADQAGAAMA9f/5/wAABgADAPz/9f/5/wYA+P/y/wAA9f8DAAIA9f/1/woADwACAAYA+f/8/wYAAAAGAAAAAAANAAAA8v8AAAAABgAGAAAAAAAAAAAABgD8//z//P8AAAkA/P/1//z/+f/5//n/+f8AAPX/9f8JAAIA/P8DAAoACgANAAYADQD8/wIAAwD1/wIAAwD1//X//P8AAAAA6/8AAAAA+f/8/wkAAAAAAA0AAAAAAAAAAAAAAAYABgDx//L/BgAGAAAAAAAAAAAABgAGAAAAAAAGAAMA/P/y/wAABgAAAAAA+f8GAAAA+f8AAPn/+f/8//z/AgACAAIADQANAPn/+f8NAAYAAAD5/wAAAAD5/wYABgAAAAAA8v/y/wMAAwANAAYABgAGAPz//P8DAPz//P/5//n/BgAAAPL/+f8AAAAA+f/8/wMAAgAKAAAAAAAAAAYABgAGAAAAAAAGAPj/+f/5/wYA+f/x/wIAAwAGAPL//P8RAA0AAAD5/wYAAAD5/wYA+f/y//X/9f/8/wIA/P8DAAoAAwACABEADQD5/w0ACQADAPz/CgADAO7/9f/1//L/+f8AAPn/+f/1//z/CgADAPz/CQAKAAYABgANAPz/+f8GAAAA+f8AAAAA+f/5/wAAAAAAAAYAAAAAAA0AAgACAPz//f8CAPz/9f/5//n/8v/1//z/AgACAP3/9v8DABAACgADAAYADQAAAA0AAgDu/wYAAwD8//z//P/1/wAA+f8AAAAA8v8AAAYAAAAAAAAA+f8GAAYABgAAAPL/8v8GAPn/AAAAAPz/AwD8//z/CgAJAAYABgAGAAkAAgD8/wkAAwADAAAA7v/u//n/+f8AAPn/6//8/wMAAwAKAAkADQAAAPj/AAD5/xMACQD1/wAAAAD4/wAAAAAAAPH/+f/8//X/CgAKAPz/CgANAAAAAAAGAAYAAwADAAIA/P/8/+7/+P/4//H/9f/1/wIAAgD8/wMACgADAAoADQANAAAABgAKAPz//P/8/wIA/P/u//j/8f/x//z//P/8/wIAEAADAPz/CgAAAAAAAAAAAAAA+f8AAAYABgD5//j/AAAGAAAAAAAAAPn/BQAGAPj/8v8GAAUA//8FAPj/8f/1/wkA///8/wIA9f8DABEAAAAAAAcADgAHAPr/+v/5/wYAAAD4///////w//r/CwD+//D/DAAGAPn/+f/6/wAACAAIAAgA+v8BAAcABwAAAAIACQD7//T/8P/+//7/9//+//f////x/wMADgD6/wAACAAIAA8A/v8AAAAAAwD8//j/////////9///////9//x//v/AgD8/wMAAwADAAMA/f8KAA0ABgAGAAYA/P8CAAIA9P/7//j///8FAPj/8f/5/wAAAAAHAAAABwAHAAAABwADAPz/9f/4/wAA///4//j/+P8CAPT/9f8CAAIAAwAKAAMAAwAOAA4ABwADAAMA/f8KAAIA9f/1//T/+//x//H/9P/0//z/AgD8//z/CgADAAoAAwADAAsADgAGAAAAAAD/////8f/3/wQAAADx//X/AwAKAAMABwAAAAcAAAAHAAYAAAAAAPn/BgD//+r/8f8CAAIA9f/8//z//P8DAAoAAwD9/xEABwAHAAcABwAAAAMA/P/8/wIA/P/0/+r///////j/+P/8/wkAAAAAAAAAAAAAAAcAAAD5/wcABgAAAAYAAAD4/wAA//////j///8AAPj/+P8AAAYADQAAAAAABwACAAMA/P8CAAIA9f/t/wAABQDx//j/8f/8/wkAAgD8/wMAAwAKAA4AAAD5/wcABwAAAAAAAAANAPz/AgD8//z//P/1////AAD4//H/AAD5/wMAAwD9/wMACgAAAAYABgD5/wAADQAGAPz/8f/4/wUA+P/4/wYAAAAGAAAAAAAAAAAABgD5/wAAAAAAAPn/DQAGAPn/8v/5/wAA+f8DAP3/CQD8//X/AgAJAAoABgAUAAMA9f8AAAAACQD8/wIAAwD1//z//P/1//L/8v/8/wIABgD5//z//P8DAAMAAwAJAAYAAAAAAAAAAAAAAPn/+f/8//z/AwD8/wkACgAAAAYABgAAAAAADQADAPz/AgACAPX/9f/8//z/+f/5/wAA+f/y//z//P8DAAMACgANAAYABgAGAP3/AgACAPz/9f/9//3/+P8AAAAA8v8AAAAA+f8AAAAAAAAGAAYAAAAGAAAABgD5/wAAAAAAAAAA8v8AAAAA+f8GAAAAAAD5//X/AwAJAPz/AwANAAAAAAAAAAAABgAAAPn/BgAAAPn/BgAGAAAAAAD5//L/AAAAAPL/9f/1/wMAAwD8/xAACgD8/wIAAwAGAAYABgAGAAAABgACAPz//P/8//3/8f/5/wAAAAAAAAAAAAD5//n/BgAGAPL/AAAAAAYAAAAAAAYAAAD5//n/AAAAAAYABgAGAAAAAAAGAPn/AAAGAAAAAgADAPz//P/1/wAA+f/y//n//P/8/wMAAwD8//z//P8DAAMAEAAGAAYAFAD8/wIAAwD8/wMA/P/1//X/8v/5//n//P8DAAMAAwD8/wMAAwADAAYA+f8GAAAAAAANAAAAAAAAAAAA+f8GAAYAAAAAAAAAAAAAAAAAAAAGAAAA+f8AAAAA+f/5//n/BgAAAPn/AAAAAPz/AgACAPz//P8DAAIACQAGAAAABgAGAAYAAgD8//z/AgD8//X/AAAAAPL/+f8GAPn/+f/8//z/CgAGAPn//P8CAAIABgAGAAAAAAANAAkA9f/5/wYA/P/5/wYA+f/5//n/BgAFAPf/AAAKAAMABAACAP7/AAAGAAAA/v/8//L/+v/7//z////6////AQACAAAA+P/9/wMAAwAAAAgAAQD6/wwAAQD1//7/AgD7//r/BgAAAP7////9/wAA/f/8//z/AAAAAAEABgAEAAUABgABAAIACQAHAPz/8v/3/wIA/f/1//3/AAABAAAA/P8JAAYA///6////+f/w/wMAAwD///j/9v8EAAEAAAAFAAYA//8AAAIA+f/8//7//f8AAAUAAQAAAAQABAD9//f/AAAKAAMA+P/5//7/AAAEAP3/+/8CAAEA/v8AAAIABQAIAAQA9//7/wQA+//x//n/AgD5//b/AQAEAAYAAgD//wUABwD5//r/AQAAAPz/+f8HAP//+P/+//7/AgAAAAQAAQD9/wMA/f///xAACgABAAEAAQACAP7//f/9//z//f8CAAUAAAD9//j//f/8//f/+f8AAPf/+f8IAAMA/f///wEA/P8GAAoA/v/+//r/+f8BAAQAAAD6//f/AQAAAPz//v/+/wUAAQACAPr/9/8GAAMAAwD///z/BQD9//b/BAAFAAAA/P///wYABQAEAPv/AAD///z/AgD4//v/AAD7//z/AAAAAAQAAwD+/wgAAAAFAAcA+v///wMA/P/7/wEA9//6//3//f/5//r/BQAAAPz//v///wAABAAEAAIADAAKAP///P8EAAEA+/8CAP3/9P///////P8AAPT/+f8IAAUAAwACAAEABgAFAPv///8CAAAA+v/4/wIA9P8DAAkA+/8GAP3/+//+//r/+f/5//z//v8DAP7/AQAEAP7/AAD9//7/BwAAAP3/CAAAAPr///8CAAEABAADAPr//v/9//7//f8EAAMA+P8KAAQA9P/6/wAAAAD9//v/AwAIAAQABwAGAAMABgACAAAABAABAP3/+v///wIA+v/3//7/CwAAAPj/AAD2//v//f8DAP7//v8LAP//AAACAAMAAgD8/wAAAgAAAP3//v/2//r/AAADAAQA///+/wEAAgD2//v/BAAAAAEA/P/3/wAABwACAAEAAAAMAAEA+v8LAP3/+v8DAP3//P/8////BQD8////BQD6//v/BAAAAPz//v8BAP7/AAAAAPv/AAAFAAoA/f/+/wIA+v///wAAAQACAAQAAAD7//z////+//j///////j//P8CAAEA+//7/wIAAAD9/wcAAAD+/wEAAAAGAAQACAACAAAAAwD6//z/AQD8//n/+f/4//j/BgAHAPD//f8IAAIABgALAAQA/f8JAAgA/f/5////BwD8//7//v/4//n///8GAAEA+P///wMA/P/8//z/AAADAAQAAAAAAAcAAAD8/wAABwAAAAAAAwD2//n//f8BAP3/+f/9//f///8CAAAABgAGAAEABQACAPj/BAAGAAEA///6/wEA///+/wQA/P/4/wAAAAD7//r/+f/+/wAABQAAAPn/CAACAP//BAADAAAA+P8CAAEA///+//v/AQACAAQABAADAAUA9/8EAAgA/v8EAP3/+f////j/9//8//f//v/z//j/BQACAAwABgAJAAMA/v8AAP//AwD6/wIAAgD8//X/+v8BAPf/+f/8////+/8FAAYA+f8CAAcAAwD8//3/BQAGAPz//v8AAP3/AAD8////AAAEAAAA+/8JAAAA//8DAAAABAAFAAMA/f////r/+//+//L/9P///wEA+f8BAAgAAwACAP//BAD9//3//v/1/wAA/v/3////+f/8/wIA/P/+//3//f/8//z/AgD6//z/BQADAAUAAQAEAP7//v8MAAAA/f/6//v/AQD8//3/AAAEAP//AwABAPz/AAD5/wAAAQD8////AgAFAPn/8//8/wMAAAD7/////f/+/////v8KAAUAAAAAAPb/BAD+//f//P/v/wAAAgD2//7/AgD//wIABQAAAAUAAQD//wAAAAAEAPr/+f8BAAcAAAD7/wQAAQABAAYABQAAAP//AwD8//L//P8DAPr/AAACAP7/AAAEAAIA/P8HAP//+/8AAPX/AgAAAPz/BgAAAPv/AAAIAAMA+v/8/wYAAAD/////+//8//r/AAAAAPr/AAAAAAMACAD6//j/AQABAAAAAAAMAAoAAAD8////AgD4/wMA///9/wIA/P8BAP7/AAD9//f/AQD1//z/AAD9/wMABwAGAAIACQD//wAAAAD4//3/AQAGAPT/+f8EAP//9//7/wAAAAAGAPv//f//////+//0////AQADAPT/AwASAPz/+v8BAAQA+v/7/wMAAgAAAPv///8CAPf/9/8GAPn/9v///wEABgD9/wMACwADAAMAAQD7/wIAAQD+/wEAAgABAP3/BQABAPz//v8AAAAA+f8BAAEAAAD4//r/CgD+//3/AgAAAAAAAwD8//r/BQAAAPz/AAAMAAMA+v8EAAAA/f8BAAEAAAD///7/+//2//3/AgD//wEABAABAAAAAAD8//3//P/8/wAA/f8EAAYABwD//wEADQACAAAA+//3//X/AAD9//f////2//7/AAAAAAEAAAAHAAYAAAD5///////5//P/+v/+//j/AwD5//f/BwAHAAcACAANAAcA//8DAAkA/P/7//v/9v8DAPr/+f////n/+f/7//z//f8DAAAAAAD8/wEABgD//wMAAAAAAAAABAACAPj//v8CAAEA/P/0//r/BQD4//b/BQAGAAIABAAFAPv/AQAJAP//+v8DAAQA+P/6////BAACAPz/AgD///f/AwAEAPv/AQABAP3//v8FAAMABAABAAIA///5//z/+v8CAP3/+//+/wIACgD+/wsACAD0/////f/9/wAA+f/6//7/AAAFAAkAAgD+/wIAAwD7//3////4/wMA/f/5/wIAAgAFAPn/+f8FAAIA/f8AAAUAAgAIAAMABAAGAPv//f/9/wIAAQD3//7/BAD2//L/AgD8//v/BQD6//r/BQAEAAUAAQAGAP3/9//+//b/9//7//n/BAAHAAIABwACAAIACQAHAPv//f8BAP3////8//v/AAD8//3/AQAAAP//AQAKAPz/9/8GAAIAAAD7//b/+//6//b///8AAP3/AwD5//7/AAACAAgA+v8JAAIA+f8FAAMAAAD///7/9f/5//3/9//8//7//f8AAAcAAgAAAAAA/v8FAAIABAABAPr/BgAAAPr//f/5/wUA/P8BAAYA+v8CAAYAAgD8/wAA//8AAAYA+v/4////BwAAAPz/AQD//wUABAD+//z//P8BAAAA/v8DAP7//v8AAPr////+//f///8BAP////8CAAEA+f/4/wYACAAAAAAA/v/7//7//P8AAAYA+v/0/wAA+P/0/wQAAAD+/wgABwADAAEAAwAEAP7/9P/3/wEA+P/4/wMABAAAAAMAAQABAAMA//8EAPr/+P8AAPb////9//7/AQAAAAYADAANAAMABwAIAAIA/f/1//v/+P/6//X/8v/9//7/+f/+/wEA/f8IAAQA/v8JAAQABgAMAAgA/f/0/wIA/f/s//3/AwD6//z/AAADAAEA/P///wQAAgAAAP7/AAAAAPz//P/6/wMA///3/wkAAgD8/wQAAAABAAYA+v///wUA+v8CAAUAAQD+//f///8AAPn/9f/y//v////3//j/BwAMAAIAAgAKAAkABAACAP3/AgD7//b/AAD3//v////9//r/AAAMAAIABAD//wAAAwD7/wQAAQD4////CQD7//X/AAAFAAAA+P////z////+//n/BQADAP//AQAGAPn/+P8FAAAAAwAFAP3//f8AAPz/+/8HAAAA+P8BAAAA/f//////DgD///P///8DAAAA9v/7/w8ABQD//wwAAQD7//z/+f////X/9v8BAPv/+P/8/wYACAACAAoACgALAAoA/P8IAAQA+f8CAPf/+P/8//f/9v/8//7/+P/+/wIACgD///7/BwD7/wAA/////wUA/f8EAP7/+f8AAAEAAgAAAPv//f8AAPn///8BAAIADAACAPv/AwACAPr/AgACAPf/AQAHAAAA/P/+/////v/7/wEABwD//wAA/v8DAAMA9P/4//r/9v/4//j/+/8AAAIAAAADAAMABAADAAYADQAAAP///P/9//v/7//5//r//P/9//v//P8EAAYA+v8EAAQA//8JAAUAAAACAAEABAD///7/AAD3//3/AAD9/wEAAAD+/wAABQD4//7/CAD6//v//v/8//z//v8CAAQAAAACAAQA/v8AAAQA///5/wAAAAD8/wIA/P/4/wAAAwDz//f/AQAAAAAA9/8GAAkAAwADAAQACwD//wAABQADAPj/+/8FAPv//P/7/wAAAQD7/wAA+v/6/wIABAAEAAMAAQAAAAAABwD+//v/CgD/////AAD1//z/+P/x//7/AAAAAAAABAAHAP3/BwAIAAUACgAGAP3/+v8DAPr/9v/3//T//P8BAAIA9f8DAP7//P8BAP7/BQABAAIAAAD7//v/BQADAAAABgAAAAQABAABAP///v8BAPv/9//+/wMA/v8AAAEA+/8AAAUAAQD8/wQACQD5//v/AwD///v//P8DAP7/AAAIAAQA/v/3//7//f/z//P//f/6//r/CQD6/wAABgD+/wIABAAHAAAAAAAKAAgAAAACAAEA//8CAPf/9P/0//P/+P/8/wAAAgABAP7/BQADAPz/AgD+/wMABgD9/wIA///+/wQA//8AAAQAAgD6//3/AwD8//v/AAAAAPv/AQAEAPr/BQAFAAIABAD//wAACQACAPX//f8BAPz//f8HAP3/8P8AAAYAAwD//wAABAAAAPf/9f8AAAQA/v8BAAgAAAD3/wMA9//u/+//9//4//X/+P8AAPj/+/8AAPH/9v/7//b/9v/g/+f/6v/t//3/9f/7//n/FAAVAAAA/v/4/wkAAgD3//7/AADy/wgADgAEAPz/+v8QAA8A4v/7/xUADgAAAPr/BwAKAEEAYAAnAOL/zf/U//D/1v/D/87/x//h//j//v/1//D/+f8FAAwALwAeAPb/5//M/6n/yv/N/xQA9f/U/+v/GAA5APH/yv/X/wAAKgAhACUAAgD2//v/DwDv/+7/9v8AAAIA4v/0/woALgBSACoAAgDv/wsASgAtAAYAx/+n/8f/+P8cANj/2f/w/wUAKgAUAOz/5//s/+z/AwAnABoA0//Y/w4AAAAXAAQA8//s/+r/AwAUACAACAD1/wEA/f/y/yMA4//A/8j/7/8KAA4AFwABAAEA+v8YACAAKADg/9P/4//7/w8ACgDm/+L/+P8CAAYACAD+////+v/s//P/EwAoADIA6f/0/+n/2//z////+v/o//v/5//y/woACAD0//T/9P/6/wcALgAcAN//4P/j//H/DwAMABIA+P/l//T/EQAnABIA+f/L/7f/AAApAPT/v//S/+D/CABCADUACQDs//r/GgAzABwA0v+5/+H/IAAfAAAA4f/u/wMA/v/7/wIA+P8KAPv/3P8DACgA/f/p/+//CgAHAAIA/f/Z/+7/DAANAAIA///y//j/AgAMAAgA7P/d//j/EwAYAAMA/P/e//X/GQATAPb/4P/m/+v/8f8BAPX//v8DAPX/9P/0//H/BwD9/wEA8v/r/+n//v8JAPz/7v/5/woAEAAVAOr/1f/o/wUAJgALAPL/6P/z/woAHAAcABQA9f/o/wEAGwAQAPb/vf/Q/wkAAQBBACUA6v/R/+r/IgAhAA8A/P/W/9j///8kABMA8v/Y/9z/AgABAAkA+P/j/+n/8v/4/wcAKAAcAP3//P/q//r//v/5/wcA6f/e/8X/x//4////2f/j//j/MAA8ACwAHgDu/9j/BwArAAkA1P/P/9r/8f85ADUAIADt/8v/6P8YACAA8//i/8//vf/c/yoALgAYAOb/wP/6/xUAOAAUAO3/2P/X/wgAPQApABYA2v/L/97/BwASAPv/zP/F//7/HQAsAA8A8v/j//X/EwAOAAgA1f+t/8z/5f8RAB0ADQDl/+T/CAA6ADgAJAABAOT/6v/9//X/8v/M/9D/1P/7/z0AJQD//+j/+P8QABAADgAKAAUA9P/t//j/+/8BAPf//f/z//D/+P8EAPr/8P/i/+//BgACAOH/8//1/wsAHQA1ABYA+P/0//r/AAAYAAwA8f/a/wcADwAAAPr/5P/W//H//v/9//T/8P/x/wAABwAFAPn/CQDh/+X/4P/+/wgA4f/t//D/IAAbAAwANQApAAsA8P/7/+X/6v+7/87/8P/v/83/2f/7/w0AOAA6ABoA+P/1/wIABQALAAkA6f/e/w4AFAALAOv/3f/a/+f/FAAbAAMA6//Z//L/EQAHAAQA+//0/xYAFgARAO//4//m//3/AADz/+r/9f/9//X/8//z////EQAIAP//6f/g//r/7v/2/wEA+//5//3///8FAAcA4P/6/x4AMwAYAPr/3f/o/+7////4/+f/9v/+/wkAKwAEAPz/7//x/woACQD6/+T/5f/9//7/9v/N/8n/5v///9f/3v/i/wIAGAAWABgABAD//woACQAaACkAEwASABAALgBVAFIAKgBWAF4AWQA1APr/zv/H/9D/v/+y/4P/wf+A/yH/6v7V/in/Iv9G/2v/Vf+c/8f/BwBLAGcAqADJAD4BxAHlATAC5QFWAXoBKAHTAHUAIwC//6X/kf8g/8X+bP5Y/jj+GP4e/hD+9v0Q/jH+Sf6q/hD/ef/4/7AAhQFHAgQDUANzA5cDfgM4A54C4AENAZEAIQCQ/+3+X/4V/u798/2//YD9bv18/Yf9n/2N/Yn9pf3+/Xz+G//0/8kAtAGoAiwDkQPYA9sDwQNEA58C7gE2AZMA1f9K/7X+hv52/nb+QP40/lL+bf6Q/of+Y/47/hf+7v2+/bL92f0z/uD+zf+OAF4BEQKoAjUDmAOjA3MDCgOEAvUBegHPACYAmP8+/yP/Cf/e/sn+7P4Y/yz/Qf8Q/87+ef4x/uf9sP2X/br9Tf75/rz/lgBJASwCvQIfA3ADaQNmAwsDbgLFAR8BbACf/wD/jP5c/nT+cP5q/u/+lP+k/5P/Zv8b/2P+lv3g/Jz8XPwX/Df8gP0K/2AA8gFlA6IEhAXYBdYFSwVRBEgDGgLNAHX/a/7D/Wj9If0K/TT97f2g/sf+Af9J/z7/gf6g/Tj9/PyZ/Nf7B/zE/YL/sAA2AvADzQWGBpkGmgbmBcwEVgPTAVMA8v71/UT96Pzd/An9gv05/s3+Nf+P/6n/gv+Z/s79YP2R/Ij7m/o++/b8OP7M/38B5wMEBrwGYwefBwwH1gVSBJgCywA4/8z96vx7/ED8dfwP/ar9k/5J/9f/JgD2/0H/cf68/ZT88frT+eP59fsX/bb+7wDJA30GcAd5CAMJdwgdBzsFPAMEAUL/uv1U/Kn7W/ui+yH8zfz9/eH+n/8nACAApP/y/lT++Px6+3H6xPpg/PH8uv4lAZ8D2AXmBmgIwQj2ByIHWgWTA30Bb//9/Wj8nftM+3n7Cfyp/MD9jv4y/5v/h/8y/27+rP2a/Fv7Vfqw+ij8yPyw/isBQQM6BaMGFwhBCLEHRweHBfwDMwI9AOn+Tv14/Cf8IPx7/Pv8C/6v/lH/vP+c/53/7f4y/kL9Cfz0+uD6gfzh/D/+yQBxAkkEkQULB3gHJwcqB94FWATgAucAcf/R/af8IvzR+/37Z/xf/TT+1P6Q/6T/wP9d/6b+3v2a/IL7sfot/EP8QP3M/18BeAPwBJwGawdjB6YHowZBBfkDDwKPANb+aP2u/NT7z/vx+2L8IP2j/Vv+sf7r/tP+if77/Sf9Mfx/+8L86Pyf/eD/NAHqAkoEtQV8BnQG0Ab+BfsEHgRBAiMBqP83/oj9fvxq/Er8lfwj/XL9Iv53/qv+tP6T/hn+bf2Q/Bb8C/0u/ZP9rP/QABEC6AP9BKMFQgaoBhcGbQXiBDwDFgK1AAn/Ov73/Jb8Q/w5/LD8xfxw/e/9E/5T/m3+Hv7H/Sv9U/w9/Vn9YP1X/1UAXQFcA10ELgUmBmEGQgbOBXkF0QPYAsABu/8W/7D99PyF/Cb8d/xQ/OT8Y/1O/dv99f26/an9Qf0m/JP8qf3l/Mb+fACMAOoCCATPBAAGGQZoBvoFvgWzBFMDsQKmAKj/nf5g/Qv9Rvx8/GT8cPwc/fr8gP3G/Z39z/2W/b/8jvzf/Xv9Cf5YAFIAywF1A80DLQWRBQUG8wV1BTkFwQMEA7YBLgBG/+39RP19/Cz8Rvz9+8r8tfz//MD9g/3A/bz9WP3z/N39Uf79/WcAagBeAaUDLAPTBF4FUAXWBRQF2gTKA+kC+gFwAI3/Uf6U/c78Rvyg/Nb7nfy//Hj8kf02/V39tP0w/ej8Qv1h/qf9fv9tAIAARwNYA3IEDgZ1BZgGJQaVBf4EwgPIAlQBJQC6/tX96PwB/Gv8k/vR+2/84fvg/OH85fxr/Q79tfzg/Bv+x/3g/lkAGQCHAk0DogPjBWMFqQZaBssFfQUDBEwDwgGCAEH/MP62/UT82fxv/Kj78Pwe/H/8If2o/B79GP0j/JL8jP0p/U/+7/+//1kC8QJmA3gFewWABpMGNAbbBcAEgAMkAhgBX/+9/rj9Qfy4/Pj7mPt5/A78hPw8/f/8i/2u/c/89PxJ/mj9B/8mAAQAaQL2Al8DUQUMBc4F7AWWBUMFRQQrA+4BDgFb/9P+4/13/Oj8F/zP+5r8/PuQ/BL9svxi/Xb9WPze/D7+ZP17/xYAIwDAAqUCkAN7BeME+QW7BTIF+QSpA3gCgQHy/5v+H/6c/CT8CPxo+wz84vs9/OD84fxm/Zf9GP0s/ZP+av6C/+UAiACVAkEDqwM5BUsFuAXFBf4EKwXoA74CBwJmACL/a/78/Fv8H/xT+4L7QPx4+6v8+Py6/Lj9Uv3B/FT+iv7x/r4AlQATAr8DcgMNBYUFewXhBWcFxwR8BBUDFQIOAXj/z/6X/YT8dvyy+8H7fPy9+778Kf1k/Hn9z/yh/Er+Jv4K/38AbAAdAlcDAwPxBAAF/ATCBfEErARABMEC5AGcABv/hP4b/VD8CfxS+8r7yPuZ+7r8fPyM/Ej9Tvyb/Yf+YP6JALEAXQGLAx4DHQR+Bb4EjwV2BXUEqARZA/0BsgHd/93+Pf6t/GD84PuN+9f7vvsW/JP8WPzK/IX80fxq/iX+wv+7AMoABwMcA88DGAUFBV8FdQX3BJ0E0wOFAugBWAAL/1j+Dv09/OD7kPue+9v7Cvx+/KD8/vzC/In9uP6L/jcA3gBOATkDKwP+A+0E2gQbBSgFhwQqBFADGAJrAeT/pv7c/bD80Pt7+0j7Mfuo+/77N/yd/B39e/wf/qD+zf75AOMAUQK0A4QD/ARPBVsF8QVUBRUFIATyAhcCvwCu/yz+Xv1T/Gj7ffv/+ib7pPuQ+yf8q/wE/Fn9gf5P/ocAPgF4AbMDrgNvBL8FQwXaBY8FwwQTBM0CxwGZAGz/Hf42/V38bft2+yX76fqp+3b74fua/P/7S/2q/jz+kACCAZwB+gPRA7oEyAVQBfYFWwXIBAEEXgKaAS4AH/8G/gv9YvyO+6f7ZPvw+tT7uPv2++T8KPzj/UH/t/5vARACawKaBGYEMgXSBXoFjwXGBEcEqwJ5AZkA7P5Z/tP8Z/wW/DD7E/yp+5770/xF/EX9Hf1w/e//Ef+eAKMCCAIHBM8EvASfBZYFbwXdBHAEBwO3AQABU/9j/kH9MPzx+w77QPtc+y77FPwg/Mr88/y2/NP+6P54/9EBvAH9AqIEhQRYBY0FXAUcBVwEkwMMAjYB/v+D/ob9dPzC+8z6APvo+r/6xPvQ+2T8zfy1/Ln+H//Z/xQCTgKdAyMFKwX8BTsGLAaGBeQEFARAAm4BCwBx/pf9a/zR+xL7y/rj+rn6Y/uH+wD8g/yU/Gb+5/7F/9gBQgL3A+METQUbBuwFKgZWBaQE1QMHAksB1P9I/mj9UPyl+wb75/rb+vL6mPu9+138uPxh/Qf/fP/OAFcC6QIfBPwEcAWaBaIFiQWNBPAD6wJYAWcAIv8N/un8RvyU+/X6SfsX+3T7I/xm/CP9Rf1P/rj/BQCdAX0CIwMcBIYE9gTYBN4EugScA+gCGQK4ALP/mf7d/aj8I/zx+0r7kPu2+0b8yfwq/Qb+9f3l/kgAeACjAZECFgOYAxgEmARTBFYEHwRrA58CxwHHAMD/0f4U/h/9lvxb/O77Nfws/Lf8S/2E/Vz+Y/7c/hMANwADAcYBIALDAtYCYQNeAzADMQOvAlECiQHTACcAVP/P/v/9fv0y/fH8Ff3g/H79A/4S/tP+DP9q/6v/TAAIAQkBhQHjARMCRgI+AmgCIQLrAecBeQEJAZkANQC9/zP/8P6G/ib+Cv4W/vv95P1d/qX+wf5F/4j/qf/w/10AmgCQAAUBOwEwATsBQAFdAS0BEAH2ALQAdAAHACwABgCO/2T/UP8a//X+Lv8b/wr/cP+K/5j/tv/S/wYA9/8aACYAEQAjACUALAAdABoANwBaABMAIwA/AAAABgD///T/GADV/9v/FgDQ/4r/pv/j/8L/uv8LAOP/sv/f//D/2f/J/+3/+P+o/97/HgDW//H/KQAYAAsAHQBcAFgAEQBXAHcAMQBAAEgARABaAAMAQwAYAOn/AwDf/87/xP/i/7//uf/Q/7T/yf/O/9T/zv/A/9j/1f/4////5P8OAA8AEwAQACMAWQAqABgASwAIAAQABwABANL/2P/+/9D/1f/o/9f/z//W/xQA0//t/wgA+v8KAAgARAAnAPX/KwAcAC4AEQBBABUACgAiAAEAAgD7/9z/6P/Z/9f/yv/R/+z/8f/d//j/BQD3/w4AFgAuABsA/f8pABQADQD9/wYA+f+2/+L/4P/M/97/z//o/9v/4f/u/+z/7v8CABMAGAATAPT/QQAVABAANwAWAAYAIAARABAAAAAgAOf/1f/o//L/zf++/+r/1//D//D/2f/h/+v/+f8FAAMA5v8WAAEA+/8uABkA+f8IACoABwAGACgA5f8CAAIA5P/8/8v/6f/m/9f/3f/j/9j/7//x/9n/FADR/wEACgD+/xAAGgAGADsAEQA8AEcALgAMABwAIQD8/+z/7//3/+H/2P/j/+P/5v/k/+T/8f/5//j///8DAPT/DwAtACgAGwADABsAIADz/+f/DAD//9P/3f/w/+X/2P/I/+j/1/+5/woA1f/p/9L/CAABAPT///8RADEAKwA2AFMAMQA5ADkALgAoABgA8P8IAPL/4f/a/8L/vP/H/8r/uv+n/8D/0v+5//b/6f/x/wYAIQAlADgATAAoAFEAOgBDADAAKAAhAAUA4P/g/+7/1f+x/83/vf+n/67/0P/H/7v/2v/v/wYADwAPABkAQwAmAEkARgA/ADQAQgA1AB4A+/8FABUA4//y/+D/5v+4/8b/6/++/63/0f/i/8r/yf/2/wcA8v8JABIAJQASAB4AMAAkABsAMAD2/wMADwAlAO3/8v/p/+z/4f/b/+7/1P/U/9b/6v/M/9L/+f/s/wUAAQANAAMACgAaACkAKQAiACAALQAWABsAJQANAAgA6P/4/+j//f/a/+r/wP/j/9j/4f/d/+H/9v/W//L/9P8BABAAJgAfABgACQAaAP//MAAQAAsA9f/+/woAFAD9//D/7/8FANz/5//m/+//yv/9//P/6v/s//v/8v/q/+r/EwD7/w4A/f8TAAoABwAbADIAFwAHAAoA+P/7/+7/+//7/+H/2P/6/+z/6P/n//X/4//g/wQA9/8NAAcA/v8CAAEAAAD9/woA+P/6/yMAFAAQAP//BwAHAPH/DADg//3/1v/9/+3/4v/f/+b/7P/Z//T//P/n/wgA/f/z/+7/+/8KACQABwALAAEABwAPAAMAHAANAAcAAQATAAEA8P/5/+j/5f/U//r/4//0/93/8v/s/9T/CgACAAgA9f8uABcA+v8iAC4ALQDs/x0AFQDy/+j/+v/2/73/6v/i/9j/0//X/+r/zv/9//X//P/0//H/KwAUABIAQwBQAHgAQAB8AHMAHQAuAPb/3f+g/4f/W/81/wD/Gf8v/zj/d/+n/xMAEgBiAKYA8wDvABcBKAEfAc0AyACqABQAxP+U/0v/zf7K/un+1P74/nH/wv/0/0cAwADuAPAAIQHoAMwAXgDp/6H/Hv/3/sP+zf7Q/jT/g/8JAHQAtwAZAVgBZwFFASYBwAA0ANP/Uf/F/l7+Rv52/ov+/v6Y/xgAtwBDAZcBtQHwAb4BYgEAAYUA6f9Q/+7+i/5S/jz+b/6y/hL/bf8RAIAAuADnAAoB+ADCAKEAVQAKAL//kP+N/zn/eP9V/47/rv/q/y4ANAB9AHsAigCBAHIAQQAOAAAAzf+u/53/lf+J/6D/vP/M/+P/BQA1AEcAUQBsAG8AWwA2AB4ACwDg/7//vf+g/6D/rf+3/43/j/+n/2z/kP+W/8P/wP8QAFIASgCUAOQAEgEKAT8BTgEWAdMAjgAQAFD/7P6F/vf9W/2e/aX9Cf63/pv/kAAJAf0BaAKUArkCWwIwAj0ByQDu/x//v/5M/k/+/v2K/gv/X/8TAI8A7wDvABsB+QBoACAAzv9j/yX/Jv87/zr/zP8SAF0AfQCxAPgAagA/AAQASP/5/o/+n/4h/on+Af84/woAjACPAb4BXwJzAvsB9AEdAZIA1f8v/7/+SP6G/oL+8/5d/xkAbACoABkBKAFCAdcANABq/27+//1c/U/9UP3I/Rr/0v8dAeQB6wIwA18DlAOGArABxQCT/4f+6P2X/U79sf2M/gf/4P+1AC0BdwGoAZkB0ACZAAwAE/+1/nb+df5I/r3+PP8Z/4b/0P+3/x8AVgCJAKAA8QD6ANwAFgEsARABJQHXAL0AiAAYAAEAp/92/2D/Xv9s/4X/YACPADABOgGnAMMA6P95/+L+Jf6J/Rj9X/0B/ar9Cv4a/7IAhAHEAkQDcQNIA/YCTgLmAFMALP9h/oH+Mf6S/sz+Wv+l/9T/TQBDAEYAZwBtADEAwP/Q/4n/Uf/H/6P/DwC1AKcApACwAKAAIAB4/3v/7f50/qr+nv6q/hr/NP+e/7P/NAC2AOgA+wCRAZMBFAFgAQABCQFXAfkApwDyADQBZQCiAN3/yv71/vP9j/2O/Tv9Bv19/dL9mP25/Xz+cgBlAgMCrgPPBIMDJgP6AlACHwAqAN3/CP48/mP+yf20/TH/+f4w/2MAXAA/AIQA5gCR/wH/ZQBE/73+0//p/0n/dP8iAHv/wf7j/5D/kP7//hAAZ/+n//AAEgGiAVICVwKiAmcDxQLQAUMCIQEgAEQAD/+C/Qn+k/2Y/Cz9RP3H/Gn9V/4L/tT92f28ADAEdwLGBKIGewOsAhEDXAOw/zoBnwFZ/xP/cP9x/uL7Rv1Y/ZL7ov3P/lX/2v+gAY0Bmv/dAAABpP/H/yIA1P/W/lj/0v6w/ez9a/7a/X39fP95ANsAsAKPA6gD0gPyAzgDIANAA+oBRwGtAFv/pv4O/sP86/wP/Sv9OP0V/mb+QP7T/tH+M/5f/jD+Ef51/RH+tACMAm0DEQVtBUwDjQJTAikCDgEeArwCuQFYAfUAl/8c/eP8PPxS+z/8Ov3i/Ur+nv9HANwAowGIAY0BPwH+ANT/Qf8e/hz91vvz+ob7vPo6/CIArQLdA+kFtwb5BFsENwXEBHoDvgPNA/gBgADq/7T9ePsd+2L7FPv4+4D9LP5N/4cANwGPAMgAKQE/AHb/lf9F/un8/PuM+xL7kvrj/LD/+QG7A08FNAboBJQFXgUDBV0EtwNZA3QBoQBY/3j9FPyB+8T7qfvO/Ef+AP+CAH8BuwGRATQBvwDx/3f///5Q/jf9pfzH++f62PrG+hD8if2RACcDWAUZBn8GRQaxBT8FcQSUA6ICxwGrAHL/N/4G/Sj83fsT/Kj8mv2y/oD/YwBeAZkBsQGMAS8BnADs/yb/Yv5Q/ZD8qfsD+7D64/rQ+zj9of8+AskEIAbSBgoHpQYXBlcFqARpAzQCAgGQ//79pfwC/I/7ovtE/DT9K/79/sH/dgA5AWMBVQEkAacAIwBd/6T+Af4o/Yf80vth+zP7d/tc/Mf99P87AscEywU7BlsG+gVFBY8EHAT+Au4B8QCz/0j+Sf25/En8XPyY/Dr98f35/tj/oABKAYMBTgH9AHMAtP9I/3z+oP0e/YL88/t++7H79Pud/NX9i/+GAVQDzQWaBo4GiwYLBhAFGQSaA3sCKAFHADb/3P3n/JD8aPxS/Kb8Wv0I/vj+uP+JACcBOAEiAQMBowDk/5L/y/70/Xb9+vxo/Pj7JvyD/A39Av5z/w4BrgLgBPcFJAZvBm0GxwXGBCME/wKIAWsAUf///ez8Z/wS/Ov7EvyJ/Dv9Kf4Y/8b/mADyAPAA4QDEACMAh/8M/0/+vv1Q/fD8gvxR/Jz89/yL/Yz+6P89ARAD/ATnBWgG1QbLBhUGNwVbBAoDfgGEAHf/MP4t/bv8Ovzy+xn80/ya/Sj+EP+h/8P/+f8nALz/Sv/J/hT+jf0g/av8N/wi/Fr8yPx0/XL+sP8GAdwCvgTGBWoG7gYnB8MGIQZ7BYUEVwMfAtwA0P/F/tP9HP2Y/D78Q/xN/MT8W/3X/WX+1f4c/2H/g/9p/zj/5v50/gb+qf1a/d78sfzQ/Av9nP1m/mX/gADdAVsDUgToBKAFKQYdBsYFfAXrBAUE9wIOAgsB1//K/gT+PP2b/DH8G/wx/Dr8hPzv/DD9mP3//VL+sP7u/gP/EP8g/w//0v6q/pj+lf64/g7/q/9sAE0BPwJgA0AE1ARPBaQFowVuBewEPgRjA1gCTgFHABP/E/4//Yj89vuW+4v7q/vh+1P81vxT/ej9ev7u/lD/j/+z/5z/j/9e/xT/9v7Y/gT/Mf+i/z4A/ADUAboCaQP+A3wE2wTlBK8EPwS0A+8CEAIvASkAFv9Q/oL98Pxs/Dz8PfxK/If86Pxh/cX9Vv7X/kH/ov/S/+z/5v/Q/5v/ef9b/03/aP+o/wQAiwAbAcMBkQIjA6AD+AMoBDAE9AOLA+wCPwJsAaUA1v/n/iX+kP0M/bj8f/yL/Lz8Ev1w/eD9WP7D/jH/iP/X//r/+P/l/8//xv+o/5z/of+//+r/GwBnAJIA/wBoAdoBNwKKAtYC+gLaArsCZwIHAosBCwF9AMz/Pv+U/hL+nv1h/UP9UP14/cr9Iv5v/tb+Jf93/8P/BAAGAPr/2v+x/4f/Yv9M/0L/ZP+Z/+D/IQBjAMAAHgF9AdABEQJYAn8CdwJYAjQC5wGDAS8BvQBAANP/cf8U/7T+a/5C/i7+MP45/l7+h/7D/vz+J/9g/4X/sf/Y/9T/0v+4/7b/r/+m/5b/oP/T//D/GAA2AF4AmwDIAAMBFAE4AVMBWAFFAToBEAHfAL4AjwBgACYA/f/q/8D/rf+b/5j/kv+c/4//q/+g/5n/of+P/4X/b/9Z/0b/L/83/zf/J/9C/zf/Ov9O/3X/if+x/8v/8/8gAEMAZQCQALgA4ADgAPUA+QDuALcAmgCFAGAAWABTAEkAXgBJAEwAVABBAEoAXgBSAEgAOAAUABsA///c/7X/hf9o/1D/Nv8S///+Bf/6/hj/Tv9Y/3j/lv+z/9P/GgAyAGgAhACFAI8AvwCqAKUApQCEAI0AbAA0AC8AFAD8/8H/pf+2/5j/mv/Y/3P/2P/h/9z/CQAWABkAYAB3AFEAbQDCAFcAGAAmANT/t/+D/3P/6/6F/5n+AwC5/v3+u/44/97/r/8/ADQAigCoAHABEwE3ASgBAQHGAJMAcgA0ABYA8f/C/8H/nP+F/5f/hP+T/0gA2f8NAAUA/v8MAAsAAgDo/2cAWP9xAEUAxf7J/iD/af4b/1r/hv/U//j/OwDMAOgAFwEOAS4B+ADnAOMAoABXABsAhgBE/2n/sP4U/6T+Kv/a/r3+xf4v/2r/sP/5/z0ApQDHADkAIwFAAcQAyQCkAIcAKABMAe//bwB6/0gAz//4/nv/JP8z/6EAlf8CAM/+hAGa/70A5f7OAeYAOQB4/0gACwCN/+D/qP/Z/x//p/9T/8sAT/5FAGv/QAAb/nkB//5sAJr/TQB3AKT/1AC1/9cASv/GAPb/WP9sAHn/eQAWAGEBov+PACr/0ADk/5X/ygDb/0L/hAD6/wkAW/+HANf/4f+O/2AAjADc/pwA0v1gAt/9JAJQ/hsBZ/8+AOUAiP5EAdL+LgCy/0AAzf94/v4BaP4oAkD+ogFQ/6oA7f/I/78Anf4UAbX/MgDr/2gAJACk/wsAzv85AIj/3P8wAOkAy/7hAKv/VAB3/0AArv41/y0Adv/A/wD+HwGY/hkB+v4PAZP+xQMQ/tgC7/6oAQQARAFo/qUAOgD7/vH/Xf9YACL/PwB1/zAAIP+IABMBUv5GAvv+qAB5AGIA0f79AL//Df+XAFb/LACZAJb+swB1/3L+UAHj/wL/NAFl/yAAAAFO/63+cQBt/qsABv8qALz/OgGr/kkCCP64AdT/IwCg/yoBlv9dAEMAjP+zAI7/QgDH/2QAeP9RAD7/DQDQ/6D/qACS/3MA+P9uAN3/kQAFABwAsf8MANf/qf/5/6r////K/2P/sAB+/xAAWwAYAPT/YgAlAOj/egCI/xQB3v9vAJkAfAAfAH4AJADA/0gAfP/0/1b/l/91/p//0f0l/rT+Lv6V/nX+z/+T/m8BqgBvAeYCyANwAroDyAOGAY8CNAEoAGAAoP/G/qf/8P6//oz/Sv84/0b/cP+4/gj/af77/Sj+//z5/C39jPxX/Az9sfxz/fH+1v9oAaQD4wS4BdEGSAakBbQEQwOBAXcAHP86/j3+OP61/i//FABlALoApQAJABUAQP9O/g7+z/1L/V79af2T/XX9b/3J/Xv9NP01/UT9ZP1p/i0A0QGIA9oEagZsBksGTAVTBMcCKgEMAPj+Y/4I/m/+4P5X/xoAogD4AMAANgDi/1z/Rv60/Yz9Yv01/Uz9j/2G/Vb9dv1u/Rj98fwR/XT9af5aAHcCIQSHBQcHewfZBrwFdwS7Ah4BVP9I/qT9Kv1z/Rr+tP6X/4wASAGVAdQBWAGEAPz/6f4T/n395Pz9/On8Jv2P/cH96v0N/u/9eP1R/VH9bf0O/yABAANwBDsGYQdJB8oG8gW+BNcCEwGN/3b+bf3o/HX90f2O/rD/2QBoAcgBkgHoAPL/HP/r/Tf9kPwr/ID8kvz9/H/9Cf4C/gH+0P1h/RX90fx0/UL/PAH5AiME4gX9BtgGSwaPBXcErQI3Aef/5P7p/YL9zf32/Yz+X/8qAK0AtQCHAPL/Yv+y/t/9e/04/WH96P1O/tn+Lf+F/3//Q//H/lT+Av5n/T/9Rf2w/bb+zQDOAowDBgWpBu8GSAbPBeoEKgNyAQIA+f71/WP9cv3W/VP+zv5D/7n/0P97/yH/y/52/vf9xv3P/f79T/6s/iT/cv+t/9r/fv9D/8j+OP7O/d39Sf4u/zMBkAKmAy8FUQb/Ba4FLgX3A2AC9gDW/9X++v26/d/9Gv5//r/+GP9Q/yf/4f6c/mX+Dv7a/eL9DP6R/vz+av+n/93/x/9l//f+mf4A/n/9b/2w/YH+x/+fARQDaATWBXIGPQbLBf0EnQP8AaYAgf9x/qv9i/20/db9Jv59/tX++P7f/rf+kv52/lD+YP58/uD+UP+Y/8//2//e/3z/6f6L/vj9Y/0u/Uf92f3m/rcAsQK1AzcFsAbiBkQGzwXjBBoDfwFKAAb/8f2G/Wz9YP2n/Sj+U/6S/rT+m/6c/pT+SP5T/pb+qP7p/l//of+W/7T/of9P/+r+kv4f/tD9u/3c/X/+pP9aAaUCfgPwBBsGCgaQBVMFawTwAqsBkABl/4L+Bf6Z/XD9qP3o/fX9Nf5c/oL+rf6F/o3+zP7J/t7+Gf8q/y7/Jf8s/xj/qf52/j3+4v3N/eD9T/4q/7IAAwLjAh8EfgXABXgFZwXQBKADeAJoAToAP/+A/vb9kP1t/Y79wv3j/RT+Tf6U/rj+uv4O/zL/SP99/53/hv9w/1v/Nv/V/nX+QP7e/ZD9if2l/TL+jP8PARkCZgPvBNEFwAU7BgMG4gTyA/YCoQFXAFj/gP7H/Vn9G/0C/R79Q/2B/bX9If5L/qf++P4o/2z/lP+Y/4//dv9R/wD/lP5U/iL+3P3P/RT+gf5x/9sAkwGWAhAE6QTlBF4FpQWoBPADUgMYAsgAJwAT/wr+tf1G/dn84fwA/Rj9Pf2q/fj9Pv63/vP+WP+x/7//0//r/8b/fP8w/+X+pP5c/h/+dv6J/gT/WABrAdcBDgNoBHsE0wR8BQwFSgQKBBoDngHuABIAwv4G/rD99Pye/ML83fze/Er90f30/YP+Df9I/6b/9f8AAAEA9f+1/2D//P6z/mr+DP4p/j7+Xv5Q/3gA8ADQAVADwgMIBO0ENgWNBH8EJATXAvEBUgHr/+P+af6b/cP8ovyl/Gr8nvwd/VT9xv1n/uD+KP+q//f/9P8IAAYA0v+A/0v/EP+h/pT+nv6O/hL/3f9PACsBNgLsAqkDPgSuBMcExgSBBOEDQwNfAkYBYgBv/2T+g/3v/Gv8/fvu+xP8SPye/Dv9wv1L/uj+gf/Z//7/PAAsANz/xv+A/w7/3v7J/rn+sP4r/63/IQDcAKABHQLfApUDtAMOBHYEEgSmA50DqQKoAS0BIAAI/2j+t/0A/a/8k/x6/Kr8EP1p/ez9hP72/pf/AgAhAFwAdwA/ABUA2P97/yD/9/7M/rn+zv76/o7/FgCcAGsBBAKLAlgDrgOvAwcECwSBAyQDrwKRAcUADgD1/ir+c/32/KD8ePx3/LH8Gf2B/RD+l/4Z/6H/DQBYAJsAqACcAHgANAD6/6n/dv9Z/0r/Uv+V/w0AZgD3AI4BBwKeAiYDSgNoA5wDXAMKA5gC1gEIATkAPf+I/rX9F/3C/IP8Y/yK/On8Rv3a/Xb+Bv+m/woAWwC4AMYAqwCyAHcAKgDi/5T/N/8W/wP/0f45/3//if9JAOkANgHWAXQC2QI1A2IDVANZAwEDhgLnASoBSQCS/8D++f2I/fr8xPzA/NL8//xn/fD9Rf7A/l7/eP/c/0cAQABdAIAAPgApABwAqv+x/6//Vf+l/+D/rv8zAMYAwwA5AfYBKgJqAsYCzgK5ApUCSQLBASkBhADe/xf/kv4Y/pz9gP1O/Vn9c/2+/Q7+SP7o/hn/af/w/9j/9f9NACUAAgA6APP/wf/p/4v/bP/O/3//hP9AAAIAYAA+AUABgAFiApICgwIiAxQDtQKwAioCcwEYAVUAkP8o/37+9v3h/aD9R/2M/av9r/02/mz+vv4v/1v/n//i/+///v8zAPD/5P/1/43/XP+e/1L/F//S/8H/0v+1APAANAH2AT0CHwLwAuECXQK6AkcCkAFhAeMABACl/1j/lf5U/iT+wf3I/db93v0C/mH+gP7I/h3/PP91/77/4//A/+f/9/+W/47/zv9Q/zD/1//K/yr/OACPABEAawGiAUMBmgKvAv4BTwM1AxcCuwJQAiQB+wCRAH3/+f69/vz9rP29/Xf9aP3J/er9Cf6S/uP+IP9P/5v/yP/N//L/1v/E/9D/nv9q/6L/qf9v/5P/CgAVANX/7wAyAesAJgKQAiUCuQI8A30CugLwAvsBmwFgAXsAnf9i/7D+Hv4U/sP9o/2v/dD99P1F/p3+4P5I/2T/cP/f/+L/lv+Y/6r/Wv8H/wX/AP/Y/rz+2/5A/1f/qP+uAOUAewG/AhYDFQPYAxIEbQN5A0sDVgKIAQABAADu/jL+xf1I/eL86/wQ/Rj9g/0V/n/+6P54/7b/1f8eABoA9f+2/5H/g/80/wP/DP8b/wX/Ef+Y//H/TAA6AcYBUwIwA9MD5gMQBDIEvgMcA6oCxwGWANP/AP/y/S799PzS/Jj8tPwY/Xf90v1d/tv+Of+B/5H/p/+3/7j/lv9e/0v/Mv/6/vP++P4U/xn/Vv+1/0wANAEIAqECYwNJBLkEiwR7BD4EkwOvArYBjACT/9j++/1A/d78+vwd/T/9kP0P/n7+5P5H/47/tf+m/43/g/9i/zH/9f66/pL+YP5v/l/+RP5X/pz+Df9T//z/eQF0AhgDHAQlBXEFQwUEBXkEjgOOAngBFgAJ/2T+rP0X/dr8Bf1h/aP9BP6A/u7+QP+A/6v/qv92/zj/HP8G/+f+s/5//lv+T/5Q/kn+Hv4e/nD+zf70/o3/BgFVAigDNwRaBeUF7gWWBb0EpQOBAjEBuP92/r79Xf0U/RP9R/3e/X3+4P41/2b/pf+3/5v/bf9R/xP/Bv8L/wj/E/8I/wH/0v6m/o7+Rf7x/dD9//1V/qX+2f9OAYUC9gMzBQgGVQYwBkAF+wO+AlUBzv97/ov9Kf0Y/Tj9d/0g/tT+af+x/7j/tv+g/2j/EP/i/qf+s/7n/hX/M/87/zH/Cf/f/qf+Tf7O/XD9V/2F/Qb+dP6s/4sBMwPMBDIG0QbXBr8G2AUPBG4C2AAw/yD+df3d/A79nf0c/tP+l//6/zQAKQDC/3D/AP+K/n3+ef61/hD/I/8p///+8P6j/mP+Jf7q/ZP9d/1U/YL9Av5T/mv/KQEMA9oEQAaoBokGSQaaBQIEHAJPAKj+1/1b/e78Cv2v/Xr+V/8nAFcAOgD6/6H/I/+a/ij+K/57/sv+Xv+5/8f/sv9O//j+c/4G/s79mP10/Vn9bP0D/oT+TP/cAPkCIAWzBlMH7gZfBqUFWwR3Ao0AsP6a/Vj9W/2z/Ur+s/5P/xQAhgCQACsAUP+S/iP+C/4E/nv+4f4n/5//7P/x/6X/Bf+D/vf9q/2c/bX9xv3A/fj9dv7d/pL/BgH9AiwFvQZOB6sGggVgBAADXwGu/xf+/vzN/Dr9IP7d/i3/iv/8/2AAigAKADr/gv4I/v39cP4L/zf/kP/f/wgADwC3/zH/d/7o/bH9uv3x/RP+H/5m/tL+Nv8jAK8BlANgBWAGgga7BZ0EaAMNApAAIP/X/Vj9e/0l/hP/qP/p/zgAdQCTAGYApv/M/g/+w/3g/WL+8f4u/4n/3f8QAOX/cv/Q/hb+nf2P/b39+P0w/kz+p/5D/6X/gwC1AVcDJgWjBgMHZwYrBbQDOgLCAID/KP5c/Un9r/28/qP/AAAtAEcAMgD8/2H/ff7C/Vv9X/3a/aj+NP+I/9//xP9p/+f+U/7M/WH9aP2q/R3+av6W/vn+YP/B/3IAnwFfAzsFgwawBhQGzQRqAxgCxQCT/3j+7f0L/of+fP8iAEgAZAAxAOv/l//Y/hL+mv2B/dT9kP5n/8r/9v8BANX/fv///of+6P2n/dj9Sf61/tv+8P4F/0D/jv9QAJ8BdAMqBf8F3wUrBfIDwgK4AZsAmv/R/qj+0v5Y/xwARwA0AOT/Y//g/oH+G/72/eD9w/0B/rz+Tv+L/7n/av/V/lP+lv1Y/Rv9svys/PH8j/3g/sAArQLoBHkGsAYtBjAFqQNRAkEBNABw/zP/X/+m/1gA2AABAUABEwGZABQAdP/w/kj+EP72/fH99P28/d79Nf6G/oz+1f7a/qT+Yv7l/ab9Nv24/IH8tPxD/Y7+bgBfAmEE2wU+BvYFGQXIA30CYQFnAHD/M/96/9D/gQAhAW0B5wHmAXgB7QBLAJH/oP4y/u/9q/2V/bT91f02/oT+o/7m/vr+2f7B/oL+Yf4C/on9CP3j/BL9Bf7M/78BsAP8BLYF+QWHBT8E6QKwAWcAMP+m/sD+Bf/d/5YAMAHkAR8C5AFrAdQA8/8L/2r+3v2U/WD9ff21/Sb+g/7R/iP/NP8K/9P+iP5A/tD9Mv2x/FT8YvxH/S3/TwFOA80E4wVxBgEG5QSsA3ECFQHJ/yX/6/7s/of/EwCgAF4BygGzAXABAgFDAIL/yP4e/rj9ff1t/ZX95f06/o7+y/74/vf+9f7V/qD+Kf6H/fj8evxu/DP98/6+AB4C3ANNBdYFrwVcBXcEJAMIAqwAqf///tj+zv4i/wEAowAwAbgB3wGHAQwBWgBY/4v+z/09/fr8Cv1Q/bT9Pf7B/iH/av+J/1n/Mv+g/tT9MP3A/If8H/2//kgAqgGTAxUFogXQBcAF1ASUA4UC9gCU//r+b/4+/oj+Q//F/4UASwGCAX8BWgG8AAAAVf+Z/u79m/18/XD9wv39/Tn+oP7m/s7+5/74/pT+CP6d/TH96vyH/ZP+6v9aATgDmARTBfQF9QVnBWYEaAPMAU4AgP+F/hD+Jv6B/gf/t/+MAPkAMgE4AcgAMgCp/+P+5/1v/Rf9zPzu/Cb9aP3g/Wb+hP7L/ir/eP4l/vj9Uv2g/K79wf7L/7cBaQNbBJ0FrgZgBgEGqAVkBAsDoAFuABH/bv4I/tD9S/7N/nX/mQD5AAIBWQEfAU4ApP/s/gL+XP3o/Jf8i/zk/D/9gv0J/sD+kP6M/rL+Mf5I/cD9Sf5g/uT/IwG+AR4DdgSkBP8EdgWfBAcEVgPnAeIARgBp/7r+2/7P/rj+gv/5/8H/VAClACsAEADZ/xz/q/5D/qj9Wf07/Sb9RP16/db9WP5I/nP+rf4R/rr9pP7A/iD/uQBQAeoBngNIBGAEVQVNBZcEdwSdA0cCgAGvAIr/Gf/p/nD+gP7X/iT/LP+6/wcA4v/v/7j/Tf/e/mP+7f2d/Wb9MP1N/Xz9x/0s/j/+dP6y/jn+Q/4T/xj/s//tAFUBGgKAA+IDMwTWBMwEQATdAysDAQI4AYAAi//5/r3+bP5C/qz+2/7T/nP/rf+K/7L/sP9X/wf/wP5i/gD+yP2P/YH9qP3Z/fj9DP5h/lL+EP68/vD+Uf8XAM0AsQGZAmsDKASrBP4E7ASTBBMEQANSAm0BggCk//3+ev4l/jn+Kf5F/qX+2/4c/0r/cP9g/0j/L//f/or+Tf4I/sv9zv2//bb92/3g/db91f1L/mf+2P7C/zEAAgE9ApsCdwNmBKcE+AQfBcgERwS4A+gC7wEPAUYAcv/N/nH+CP7j/ej96v0Z/kD+gP6g/rj+zf67/pn+bf5B/hP+7v3o/eL9z/3b/dX9wv0B/k/+jP5a/9X/jwB9ATgC1wLPA0AEmwTGBNEEawT7A24DqQLMAQ4BVQCR/w//gf5O/jD+CP4s/kT+Zf6Y/qv+x/7L/sn+q/6b/oj+aP5a/lr+TP5I/lX+JP48/nz+bP4I/3D/8P+4AGUB8AHcAngD5AM1BFMEMATuA4AD1AIkAn8BwgDp/2b/z/5S/hj+0v3X/dD96P0J/ij+Sv5v/oT+kP6B/nX+af5b/lr+X/5R/mb+UP5w/qT+oP4+/5P/BwC8AGoB3gGqAlQDuQMHBEcERwQSBMsDXAO4AhgCaAGUABwAWP/Q/oD+Bf7V/af9mv2e/aL9vP3t/f/9Hf4+/mf+d/54/pn+oP6n/rH+mP7B/tj+2f43/5T/0v9uAPwAcwEkAsICKAN6A+YD7gPrA8ADagP5AmcC1wElAXwA9/84/+j+d/4q/vn90P23/b790/3v/SH+OP5w/nj+oP6h/q7+wP67/sX+wP6j/sX+q/7h/hD/cf+1/0MAuQAyAdoBeALMAkcDiAO4A68DkANKA90CaALpATMBsQAiAHn/If+g/lj+B/7T/b39qv2y/cz93v3//Rz+PP5Z/lv+Zf6D/on+q/6S/qH+vf64/gH/KP9+/+7/MADiADcB4gFBAr0CTAOLA58DzgOkA4ADMgOxAj0ClwEOAWsA1/9O/8n+X/4e/tL9uP2h/bP9z/3I/QX+Lf47/nj+eP6e/qj+oP68/sX+qf7b/sP++f4u/zL/7P/Y/4EA1QA4AQgCEgLYAicDZgOZA40DdQMlA/ACWALYAU8B1AA7AKr/If+f/mb+C/7Q/c/9rv3Y/db94v0u/jj+ZP5g/of+c/6l/lz+aP6P/lP+h/5u/rP+zv4j/4L/DgBbAPQAcQFYAtoCUgMZBEwEjQSFBHcE+gOdAxgDOAKdAeAAJABe/7z+K/7U/YH9RP1K/Ub9YP2M/Zz97P0b/j7+VP5v/oL+o/6I/mn+uf4+/qb+U/6u/tn+Iv/D/zYAwwBOAQ8CugJVA58DUQRfBHIEcgQPBLADIgOBApgB5AAtAF3/wf4g/sz9cv1l/TX9gP1x/bn91f0T/mH+XP5z/nz+V/5u/jf+1P0R/qD9m/2z/Z79Nf48/jT/1P+eAH0BfwIvA1MExQRSBfsFmQWvBT0FZATSA80CrgEAAcr/7/49/mj95vy9/H/8fPyr/MP8Of1i/dv9Tf5H/qf+uf53/rL+QP4k/hv+lv3e/Y798/0r/pz+hv8aAC4B9gH5At4D8QQ7BdcF3wXIBX4F+AQjBCsDQgIfASEAOf9G/qX9A/2z/Kn8kvzS/An9YP20/Qz+lP6p/ub+FP+0/tf+l/72/fv9S/1C/Sn9Ev2L/cr91P6Y/6EAkwGwAucD1QRtBeIFPQYfBuIFVAWIBJUDoAJWAVsAUv9N/sX9Bf3Z/JD8ofzM/On8bP2q/T7+j/7s/ir/QP8P/zn/xv5m/ib+Yv2B/QD9/vxQ/ab9Wf5r/1AAaQF/ApIDwgSGBdkFYgY8BtcFVAVdBB4DOQLLAHr/mv5g/eT8ffwj/GH8fvzc/E/99f1l/u7+dP/A//f/CwDA/27/Nf9g/t/9Sv10/M78dfy6/FD9/f0e/2wAwQHyAkYEVwV9BhAH6Qb1BoQGcgVpBAYDkAFjAOj+rP3l/AP8ufvJ+9H7Svzi/HT9Rv7c/mv/BwAtAGAAUADJ/17/+v71/W39x/zs+wT8K/xS/D79CP5I/9sAQwJGA8YEvQWyBlAH/QbcBkEGEQXFA1UCrAB5/yj+rfww/HL7NfuB+7j7YPxa/Qz+JP/0/4MATgFoAWYBRQFrALz/yf56/cj81vv1+gD7APvY+2/8Af64/1MBZAOLBA0GPwf6B1MI3wdHB18G4AQWA8wBnv9o/iX9l/tR+9n6lPpC+7v7f/zU/fD+3v/9AIQB0QE3AsEBXQGbAHj/Yf5x/Uj8TPu3+l/6lfpv+9H7rP2d//MATwORBKEFHQd5B4sHQgdBBk0F2QNJAssADP/a/df8sPuT+237aftP/Oz8G/5M/18AKAEIAmQCNgJMAp8B3gAOAM3+kP3I/Kr7ovql+nD63foy/Lv8zf4DARECdwS9BTUGlgfzByUH5gbNBUAE4wJJAVD/xf3H/KT7IvtC+zv7Afz5/Pb9RP9kAEsB9QGxAlcCKQLkAdAA+//o/n/9dvzB+6L6L/ov+jj6iPuD/Jv9NgDoAXQD6gWTBlEHawgCCFcHzgYKBaYDuwEwAFD+t/zN++P6mPrt+jn7EfxX/YP+BQAcAfoBrwIUA74CaQLWAacAsv96/gj9CvxS+1v6H/of+nL63/va/Dn+bAAiAs8DHQbABnYHYwjyBzAHZQbABP4C6gBu/4n91vsh+5D6Xvr5+pb7zPw3/qH/GAEnAuMCVAN1A9oCJAJQAcj/nv5i/e/7D/uP+rL5APoL+uv6ivzc/YD/7AFRAy0FtgYgB6EH5AciB+8FwgQwA90AVv8t/iv8S/sK++n6JvsF/CX9aP6o/yUBKgK3AjEDOQOxAuYBDQHN/1X+af0w/Cj77voq+i36lvqg+9n8Kf4fAOsBwgN0BZMGgAe1B74H9waYBVoEgAKuABn/TP0B/Cj7y/r9+nn7XPyt/fP+VgDAAZECZAPSA80DWQOIAnMB//+O/uj81fvN+iz6yPn3+X/6SPvk/Er++//KAZoD9gT4BRYHOAcgB6wGhAUtBKAC/gBk/7X9gPzk+2/7jPsG/Mj8z/0t/1wAKwFEAu8CGAPZAisCKgHo/77+Uv0k/BD7nvpk+kr6m/pc+z38N/3q/sUA4gGcAzQFFQaRBjkHBwd5BqoFTQTQAjQB8P+J/jP9a/wD/PD79Pt6/Bz96/0k/xsAwACvAZAC7wLkAqYCOwJGAVwAaP8y/v/8v/sX+1X6xflK+er56Pp6/KP+uAC5AhkFzAaoB18IjAjKB8UGHgVGA0kB6/9T/ub8CPyR+3n7nPvy+6X8mP0l/hH/KwD4AHABzgEvAu0BoAEzAT8AR//w/cv8wPua+qD5pflM+oj7kf2c/+UBTwQ6BmgHYAiWCBMIDweNBaoDvAFHAHn+EP1d/L77ifuu+wz8svyY/UP+Ov9GABQBiQHnAToC9AGqASIBHwAq/939oPye+4H6iPl6+Sb6bvtd/Tf/dgEwBDQGZwd8CO0IeAgwB9UFJwTMAR4Adf4I/Q/8Zftg+4r71PuG/G/9L/4W/y0AFQGQAf0BVwIuAuQBNQE8ACH/0/2i/HP7kPr8+f754fpe/F7+JwA1Ap8ERgYvB+wHMghgB+UFgQQgAxsBU/8c/v/8QfyH+4z74Ps4/ND80P2p/nP/dgBHAc8BFgJcAkQC4QEYAfv/7v6R/WD8JPtn+tD51vnV+rn85P7KANMCdgUjB+oHbAimCK4HygUuBIYCjACt/jr9SvyR+xH7Kvug+138GP35/eP+2P/bAGoB2wFMAl0CHgKiAcIAt/+K/jX99vvo+jD6v/kR+nD7cv1J/10B0APqBR0H5wdRCFgIUQdvBc4DTQJ3AIz+Hf0d/In7Jfs7+7b7jvxx/S3+Gv8JAOkAcgHEAR4CGALSAVABeQBc/w3+wvyK+6f6G/rz+YT68/v0/ef/HgINBNQFPgcNCFgI/Ae3Bk8FtwPJAbb/3/2G/IP75frF+hz74vvD/Kn9uf7C/8AAZwHRASgCLwIDApABzwDK/6/+eP1Y/HH7xPqm+gn7KfzQ/aD/dQFzAyAFuQaKB9oHqge6Bl8F0gP2ARcAZ/7s/Oz7K/vc+gf7mPto/D/9Q/5J/0IADAGHAeUB7AG2AVoBuwD1//z+Hv4y/UH8mvta+3r7//sz/dD+hgA7Au4DTQWEBhAHGwfDBs8FnQQdA6cB+v+E/jv9Xvym+1n7efv8+7v8ff16/mz/WAAPAYkB3gG7AXoBLAGUAMf/Df9Q/on9+Pxi/Cf8R/y//Jf9t/7Q/+gARQJZA2kE8ARhBU4F8gRIBGoDaAIyATMAKf9Y/pH9Jv3s/AD9Pf2i/SD+n/5V/9b/JABkAJQAjwBwADcA6P+X/zj/4v6Y/kv+//3Z/f39Hf6B/gD/e/8XAMUAgwE4ArECEANTA2UDOwPyApsCBgJ4AecAVwDC/1f//v6u/oP+Xf5S/ln+Y/6L/qD+vv7k/gL/KP9K/2H/cf99/3n/Z/9Q/z7/Pf82/03/b/+Q/7H/BQBYAK4AIgFwAckBEgI1AlMCTwI3AhMC2wGOAUkB6QCQADoA5/+U/0//CP+//pL+Xf5E/jj+Sf5c/nj+sf7V/vn+J/9Y/2r/e/+a/6j/pP+a/6n/pv+u/8T/7f8GAC4AbgC3AAgBTAGBAbkB5QEAAgAC9wHUAaYBdgEuAdYAhAAkAMf/af8W/9f+jP5o/mD+Vv5e/o3+o/6+/t/+B/8U/zL/Tf9J/2P/Xf9g/3T/i/+z/9L//P8tAHEAwAAJAUkBhAG8AdcB7wECAvABzwGtAYMBQQHyAKgAXAAFALL/Xf8X/97+nf54/mn+S/5F/lf+cv6O/rD+0P7y/hD/L/9P/2T/fv+X/6r/xf/m/wMADwA3AGgApADUABgBQgFXAYEBkQGWAZgBhwFwAU0BJAH4AMcAkwBVABgA2/+k/2j/Pv8c//z+6P7b/uD+5f7q/gD/Gf8i/z7/VP9v/4H/hP+Z/6n/t//R//D/AwASADAAVABxAKAAzAD0ABsBLgFCATYBOAEuAQcB8wDNAJkAUQAZAOj/uP96/0r/LP/+/uj+1P7Q/sn+2P7Y/tT+1v7b/s/+1P7Q/tr+6/4Q/0T/hP/I//f/KQCCAPUARgGgAecBEwItAjgCJwIRAvgBygGSAUgB+wChAEwABADI/4D/SP8X/9H+tf6g/oX+bf5X/kD+Mf40/ib+IP4k/iX+N/5I/oX++/55/w4AeQC4ABsBlQEcAnUCmAKlAqkCnAJeAioC7gGmAVwB+wCuAGAAEAC6/4L/T/8Q//L+y/6p/qr+kP55/ln+NP4S/vr92v24/bX9v/26/Qb+d/5G/zMA8ABoAdYBgAIDA1QDQQPeAm0CLALLAWwB9wB7AEEAQwBmAGMAOAAXAPz/4/+5/2//Gv/o/q3+cP49/u39pP2E/WL9PP0X/RD9Dv0K/Zf9wP5pAN8B2QJcA9gDfQSiBHcEjgOGAsYBLAGMAAEAaP9C/4D//f9DAFAAVABXAFIAHgDF/0j/6f6v/mP+9/2e/WL9EP3r/Jf8bfw2/An8IPz4/IH+xwDyAmUEKQXTBWIGUgaqBeQD+wGyALL/5P43/rj9DP7s/hkANAGLAZEBfwEdAWgAYP9c/rz9gP1S/Qz9+/wK/TL9Sf3f/IH8HPzd+/H7Av3W/r0BhARqBkEHrQfBBwsHwAU4A2gAev5c/dH8qfyy/HD93f7xAKwCIAPbAiwCLQH9/3z+DP1R/Fb8pvwE/Vj9lP24/aj9Cf0q/Gv76Po4++L83/+XAzMHEwm3CZcJ4whCB+wEkAEg/jj8Zvtz+w384Pwx/l8A4QKnBK4E2wNeAqAA4f4C/Xb7//qZ+2z8T/3J/eD90v1a/Tz8RPs++vL5uvpq/XAB5gX3CPQJ/glKCUQIQgZWA5D/wvy++7v7bvwY/ef9ov8HAkoEEQUvBMcCGAF+/7/9APzw+h37A/wA/bf95/0O/gf+O/0I/OT61vnz+Tr7FP6DAvQGwQmWCi4KCAllB+wE4AEy/t77Mvuv+9D80v0Q/7cA7AKmBNQEuAMiAjgApf40/dT7Qfu8+7/8x/1s/nj+eP4e/jP96PvT+qn5m/nx+in+HgPpB6wK/goXCqkIxgYZBOsALP0B+676X/vP/AX+rf93AawDLQX5BKMD4AEKAFv+Df3d+4v7P/wZ/db9QP48/mP+Qf53/ej7m/pw+cT5uPu4/xoFAQntCqQKhAmUB9kE0AHX/vz7BPsp+w38ff0T//4AcgL/A30ErgNHAqEA7/51/W/8z/sq/A39t/0u/kT+ZP6B/nX+cP24+276NPl4+Xz7Wf+IBJoIjAqGCrkJEwiCBW4CSP9M/FD7nvub/Mz9Qf8WAZECOQSBBGoDxQH8/2n+If1D/M37Xfxz/WT++P4D/7j+bf7j/dD8lPt8+q35lPoj/VgBoQWoCKIJSwmgCAEHiQS7Acv+gvwf/Kf8cf1O/pH/8wBOAosDWwMmAqAALP8W/m79A/3c/GD9OP7b/kn/LP+O/vX9XP19/FT7Zvqn+fP5/PvT/1YE6AeFCVQJyQjYB+0F5ALz/yf9SPz//Ob9f/46/34AtgEhA20DGgKgAGH/hf7a/UX96vxU/V7+Z//Q/6T/8P5l/gD+JP3A+2D6bvlk+d36of4TAycHaAlRCZ0IvgfwBR8DRgCY/YD8bP03/uj+aP8+AEYBMgKEAkgB3P/r/mL+Ef6i/Vj9y/34/vb/OQDT/y7/rf4q/kz91PtJ+lv5KPn3+cP88gB5BeIItwnFCHgH2QV4AzkB7v5d/bf9rv6W/0AAwQBcAYoBuAHxAHf/df75/fH9A/4e/n3+Cf8R//3+q/4g/pD9Lf15/OH7Bfu2+j38bv+nA5wG7QeBB98GGgZpBAcCi/8J/o39GP6y/hH/HQBWATACrQIwAr4Am//b/kX+0P1+/aj9M/76/sb+W/4S/rD9jf1r/ev8aPy3+1D7gPyC/6sD8gY9CK4HhQaUBQAEnAEc/9r9wP2G/mX/jf8fAEIB/AFAAswBYABD/+L+p/5U/iD+KP5k/vD+xP7//aj9Wv1I/W39QP3Y/DX8q/tw/Az/EQOEBuMHfQdDBiMFngOMATD/9v00/ib/LgA8AFwAFQGrAasBIAH5/+T+qP6u/pj+bP5z/pz+5/6m/tX9dv2K/Wf9df0q/ZP8IfyC+yv8uf7FAmEG5geXB3IGZAXVA50BKP+j/fn9G/9GAI8AwACjAUUCPQLYAED/U/5o/t7+yv6i/sf+LP8h/3z+pP1+/eD91f2r/fz8sfwo/EL70vvJ/lgDAAdECFEH5wXqBDcDowD0/d78Ff7n//EA3gALAfgBlwIFAgUAVP70/aj+R/8M/9/+Mf91/0//Uv6A/Xf9/v0T/t/9av00/Yz8Pfs++/H91gLxBg0I1gYOBeMDUAIUAAf+gf3e/sUA5QGWASkBiAFZAXAAKv8B/jP+Nf8KABgAaP8L/5X+Gv7F/bb9XP7y/gL/j/7w/Z/9pvwe+yj7F/5sA8sH2whJB84EBwNNAVf/qP2o/a3/ZgFiAsABFwEfAZgAlf+2/j/+BP///4AAcACo/xD/dP6l/Vf9lf2M/kz/a//D/tz9Uf2N/B/7k/rP/HkBoAbtCGEIngXtAuMA5f7P/er99f/6AdkChgJhAaUAzP/5/rT+7P6h/3cAzgCZAMT/7/43/rj9uv0v/vz+if+V/wb/5v0D/Wz8+fs8+4z7j/54A6IHawhyBm8DVQGj/0v+6/1z/xkCeQP9Am4BQgC8///+jv5H/20AJQEJAU8Ahv/H/tj9QP3s/Rf/AABJAH//lP56/Vb83/sl/Kj8ZPxN/Av/EwQMCLkHeASnAY4Apv+a/n7+CwEnBIsEjAI/AIX/fv/S/u3+lQAlAtsBUgD6/pD+Sf7B/TH+3f+1AFsAZf8x/n79+vxv/Nn8qv3s/dX89Psw/kwDhAc7B0EE6wHSAIn/PP7r/jMCkASdA3MBGACm//3+/f0T/5sBlgITAYj/Rv9Y/8f+Rv7R/q4APQHO/0b+dv0M/T79kf0e/sn+If5Q/OP6Gfx7AN4FHQhpBqEDUwF8/+D92v3AACgEWARkAsAAu/8f/xD+bf78AMACUQGV/wD/4P5s/tj9Z/6BAB0BBgCa/jL9zvwX/eH9SP58/vj9Tvyw+iz7aP6mBOkILggDBRQC7v8//oj9bf87A54EIQNgASgAhP+m/sH+zgDlAsEBqP/b/mb++f3t/bj+nABCAXUAb//v/QT98fyo/V3+2/2i/ez8wvsL/G3+jwMtCLwHCAWgAnMAzv4Q/vn+EwL1AwIDIgGV/6j+Of6a/osAnQL3ATQAWf+A/tv9of18/ggAmAAxAIP/P/5X/S/9CP6E/hP+K/7h/f/7tvtP/uMDFghIB7YE4wJoAFT+/v2l/7QCBgQGAyoBWv/y/aP9uP4OAfMCDwJ0AEP/d/4I/gD++/7XAG4BzAB7/8n9z/zu/OD9Wf5Y/r/+0P2p+/X6Lf7DBBgIFAY5BKAC4v+0/Yj9+f/AAj0DVQJ2AfT/R/63/eD+OQEUAoAB1wDl/8X+qf2R/UD/cgCyAHUATv/r/QT9H/3Q/Tf+pf6h/kn9//uS/VsCSgalBWAEsgORAf/+0/1i/2cBAALPAakB4wAo/+79wP7u/6YAiwDeAPcAGQCK/gv++f5C/53/DgC9/xf/Uv6K/n/+of2Y/aD9m/zW+0T+MARgBpwEfgQrBMIBNf83/rb/VAFoARgBaAEFAUj/0v11/gD/y/9RAMMA3AAhAN7+YP7k/gj/af8SAPX/kP+T/qX+gv4j/ur9oP0z/bP8x/4WBIkFhgMGBM0DXwFz/4/+AACAATEBCgGkAWYBaQAT/9j+uv/+/7P/XwB9AEIAa/+I/m7+qP7d/ub+qP93/6f+k/5D/tz9cv0V/fD8kP28AWAFzwPmA58EFQLo/1X//f+tAHMAjgALAbwAJACr/1L/of8OAAcASgA5ABIAs//m/oX+vP6m/p7+Vf9S/9r++/5z/hP+i/1I/dD9ev7hAIYD/gIUA6YD2AFGABoAYgAUAOD/vABqAQ8BwQCTAP//kf+Y/9z/uP+i//r/5P9Q/wz/nf5n/vP+1P63/jj/5f6i/jn+l/3S/Rb+8f8zAnECVAMVBOIC7QGnAWAA8P/7/7D/SQDKANYA7ACFACoAHwCj/4//+/+d/3X/cv82/wv/2v6k/rP+0/7b/sb+sP5Z/r/9Yf3W/Wb/DgEaApED4QPxAsUC1gG0AKoAEwD8/4kAdACtANkAYgBaAC4Atv/W/4j/uP/M/yj/+v7P/pH+qv5p/kj+2P6z/nT+o/5F/vP9WP5O/9sAtQFlAigDyQJwAkICOAGHACMAtP/F/+r/6v8tADsAMAAsAP7/9f/W/+P/9P+I/3n/Qf/8/gv/t/5x/tX+y/6f/qj+qv6d/sT+yf/NAA4BpAFgAkQCQAIkApgBHwGYAEYABgCz/7D/p/+s/+D/9//z/wQA7f8UAPL/gf+Q/1D/Hv8b/9n+7P7k/uT+If8m/zL/Xf9d/5f/LQB6AL0AMAFGAVgBZAE3AREB1QCIAGwANAAfACAADADx//X/0v/R//P/5//9/ywA+//2//T/yv+u/4b/bf9o/0j/Yv9f/0f/bv9h/07/l/+y/9j/EQAdAE8AcwBVAHgAhgCAAJkAkACCAIMAbABDAC0AHAAHAA0AAQD5/xwAAADx//j/0f/N/8P/xf+5/7P/qf+z/6r/tf+//7r/1//X/+r/DwAUAAsAIAARAAsAFgALAA0AFwAWABYAFQARABUACQAAAP7/EAAlABAALAAzABcAIAAWABAACgADAOz/4f/m/9v/zv/J/9b/3P/J/+L/4//l/9D/0//m/97/3//b/+n/AQAGAPL//f8EAAgACAAIABUAJQAbABkAMQAhACQAMAAaACMAGAAIAA8ABwD///X/9P/3/+3/6//q/+v/3v/c/9v/1f/P/8j/0f/K/9D/xf/b/+r/7v8DAAwADAAZABQAEgASAA8AEAAIABUAEAAJAAsAAwALABAACwAKAAwAFAAUAAgADgATAP7/+P/6/+7/5v/f/93/1//O/8j/zP/J/93/5P/s/wgACAALAA4AEwAKAA8AEQAQAAsACwANAAIACQAQAA4AEwAeABcAGQAbABkADwAUABMABgD9//b/6v/t/+n/6//u/+D/5//g/+f/6v/v//j/AgACAAAA/f8AAAEA+v8GAAIAAwAGAP//AgACAAYAAAAIAA0ABwAMAAgA+//v/+f/7v/q/9b/5f/s/9z/2v/l/+r/4//r//L/+f/7//3/9P8DAAIA9P/5//3//P8IAAIA/f8CAAQACQACAAgADQAHAAYABgD+////AgD4/+///f/6/+//9//v//f/7f/s//b/9f/8//T/AwD6//r/AgABAAAAAgACAP//EQAJAAcAFQAQAAgADQAGAAUA9v/5/wIA/v/4//3/9v////r/7v/u//D//f/7//D/5v/v/+//8P/7//r//f8BAAIA+P/8//v/9v8GAP3/AAAOAAUAAQADAAoADQAKAAYACAD4//v/+f/2/wAAAwD5//b/+v/1//T/9P/6////9//3//b/8//0//j/+P/4/+//4f/u//z/9//4//r/AwADAAwADAAMAA4AAQALAAwAAwAHAPr/AAD9//b//f////f/9//z//T/+P/2//z//f/6//7//f/3//f/+P/3//z/+//z//f/+f/v//j/+f/y//j/9P/3//f/9P/0/+//8f/r//f/BAD5/wsAHgAUAA4AFQAAAAAACQD///f/+f/9/wIA9v/z//z////6//f/AQD3//b/9//p//L/9v/t//r//P/5//r/+//+//r///8CAAQAAgAAAAcAAQD7/wEA/f8AAAEA/v8FAAIADgAEAAcADgAAAPP/+//9//D/+P/0/+v////+//H/9v/3/+j/8//y/+7/8f/z//j/AAD0/wAA+//8//7//P/2//X/8//8//z/+/8DAAYABgAHAAcAAAAHAP3/9v/6////BgD+/wMADAD3//j//P/2//P/+v/x/+H/8//x/+r/9v/2//L//P/9//j/BQAAAPP//v/9//z/AAACAAUAEAAOAAUACQAIAAMAAAD//wMA+//8/wUA/f8CAPX/9P/+//j/8P/4//b/7P/u//L/+P/z//P/9v/5/+//+P/+//f/AAD6/wQAAQAAAAMAAwAGABIACAALAAkACwAHAAEA/P/5//7/8v/o//X/+P/x//3/AAD2/+r/9f/0//H/9v////r/+//7/+//AAD+//L/+P/9//3/+P/9/wMAAwAIABQACAAAAAQACwD4/wUAAQD5/wgA+P/9//T/7//v//P/8//x/+v/6f/w//L/9f/x//b/+v/+//n/BgD8/wMA+/8AAAYA//8DAP7/AAD+/wEADAAAAAMA/////woA+f/9/wYACwDu//r//f/4/+7//P/w/+z/+//6//b/7P///+j/AAACAAMADwDz/wkADQAKAN3/GgDv//b/EQAKAPj/AQAPAPf/+//1/wcABgDu/+v/AwBKANT/8f/5/woAv/+f/xYA4//e/8z/SACO/2MA9QBo/9b/pAAHACP/iACx/yr/tv9AAMz/hv/o/y8AFwDW/1kAZQA1ACYAVQA9AOv//f/m/wgAAADX/+v/CQDm/9P/EQAHAPT/AAAbAAsAAAAHAAUAAAD2/ycA7v8dAPL/9//+//L/FAA7AOn/+P8PANn/xf/r//n/0//6/9z//f+8//X/+v/z/wAA1P84APv/+/8IAA8A/P/x/wYAKAD4/+D/6P8GANv/3f/G/wAA7v8IAAAABAALAAQAAgAGABIAAAD9/wIAAAD4//j/JAD7//X/BAAHAO7/HQD///3/2v/8/8j/uv9MAOr/DQAGAPH/+v/J/wAA/f/0/+z/AwD4//D//P8KAAcA4P8SAAAABAAIAAAACgAHAAEAIQADAAMA///9/wsA5/////v/7v/w//H/+//y/+T/6P/d/8z/2f/6//X/7//j/xIA8P8NABIAEwAuAA4AKQAgAGQAQQA4AFgARQAfAA8A8//7/93/2v/s/8j/x//M/7z/zf+4/5b/lf+A/2//fv+d/2v/j/9Q/zL/Xf+I/0r/5v8sAJIAEAFbAcEB1gHoAQ8C1gGgAWUBzQBsAPX/gf8//+v+vf7A/of+hv59/lP+Wf4j/hP+Af7A/QT++/0R/pr+8v7i/9YAlgG+ApgDNATABMQEogQpBEcDjgJwAYAAoP/y/nL+Df7w/eP90f0c/u79+P0F/sL9tf2B/Wr9m/03/W39nP2E/Uv+zf7W/1cBRwLSA/wEnAV6BiwGxAUrBb4DtQJFAez/A/8c/pv9eP0//Xv9jP3e/RP+6P0Z/uT9oP2U/T39ZP2c/Sr9qP2i/c/9mv4Y/3cArQG4AmkEPwXKBYIG5wVyBUwE3QJmAUEACP9M/pr9cv16/cj9DP5k/ov+rf6x/kj+Hf7c/ZH9ff1X/bT9EP7p/XD+U/5x/gT/T/98AJsBqAIGBBMFsAUlBqEF9wTAAz0C4wCn/3L+uP1k/Uj9iP0Q/nj+9P5Q/1//SP8Y/9f+jf5f/k7+W/5g/qn+6f7H/vH+of6O/qj+Af/t/wMBIQJyA4UECgWJBS0FjwR+AyoC+QDM/6z+IP6i/W39rf0G/mH+sP7y/vX+1f6d/lf+R/40/kr+lP6V/sz+Jf/2/uv+rv5k/nD+l/5+/38ApgECAyQE+ASDBW0FDwUkBPQC0AGbAHH/mv4T/rj9vv3//U/+o/7k/gL/Bf8B/5/+e/5h/kz+SP6I/s/+1v4k/0z/GP8H//D+x/6c/hf/1/+AAH8BrQK5Az4E1wT7BKsE3AO3ArABoABI/4j+B/6e/Xr9tf0C/kn+f/7E/sD+1P7I/pb+h/6a/qL+r/4F/xP/Jf9p/zz/Rf9G/1D/Jf9d/w4AfwAbAewBzgJXA+4DNwQKBPADEwM4AoQBeACi/zv/1P6C/or+qP6x/sD+2f67/qb+h/5z/nv+Y/5z/sn+8/4q/4b/uv/N/83/sv+X/2n/Sv/w/h//qv///34AMwEEAo4CDwM8AzUDJgN2AswBSAGAANj/jP8z//3+9v7n/tD+wf66/oT+Yv5X/mH+a/6O/r/+Kv96/7f/CQAxADkAHQDY/5f/Tf/7/p7+x/42/5n/CgDJAJIBCAKbAtYC5wLgAm8C+wGWASsBnQBIAPP/nf9P/xX/zv54/mf+P/4P/hb+Pf54/rX+/f5e/7X/5P8UACQAFQALAOj/tP+M/3D/TP84/3j/xP8OAF8A2QAsAXIB0wHuAQEC+QHEAaEBbwEnAeMAmABDAOr/kP9J/+H+sP6X/mb+Wf5o/nv+qv7X/gH/T/+F/7H/1f/w/wEA+//y/8n/w/+q/3b/ff+q/7D/5v85AI0AzgAsAXoBlgHYAdwB0AHHAY4BagEwAecAogBDAPj/p/9T/xv/8f65/qn+m/6Z/qX+xP7g/gj/MP9o/3v/if+g/8j/u/+1/8b/n/+R/7T/vf+6/9r/AwArAFgAlADMAPoANwE+AX4BiQFjAWoBVQEeAfQAsABvAC0A6f+0/1v/Nf8U/+T+2P7O/sv+3/7g/vr+J/9I/2n/gf+T/7r/wP/H/8b/2//G/6j/vv/B/77/4f///ycAUwB9ALMA/wALAUQBVAF1AX4BQgFAARwB3QCwAGsARQD4/73/jv9c/zL/Ev/+/vj+/P7y/gj/CP/2/h7/Mf9K/zf/Sv9P/17/Rf9+/5r/qP/P/xEADwBuAHwAvwD+ABkBWAFhAZQBewFtAXABKgEIAdMAqAB7AEAABADX/6r/h/9h/0f/PP8o/zj/IP8T/wX/9v4D/wH/Bf8Z/1P/N/9i/2D/Vf95/2r/kP+0/9X/7/89ADIAjgCZAOAADwEhAWgBVwGOAXYBVwFgASYBMQHCALgAiABJABgA2f/M/4j/eP9J/yn/+f4r/wv/6/4S/yH/A/8O/yn/G/81/0r/Nf9X/zH/Rv9O/0f/cP+2/8j/CwA/AHQAwwDiAD8BSgFjAYUBhgGTAVoBUAEWAfwAwAB5AEoAEwDb/9H/h/97/0//MP8T/yz//P4I/yz/HP8G/wX/Gf/x/gj/EP///iX/GP8i/0n/UP+N/9T//v8wAKMAzQAcAUIBmQG9Ab8B4AHXAbUBkQFhASwB8QC9AIsAPQDq/73/pv9W/yT/Jf8W/wn/B/8V/yX/Pv8P/wj/Gv8Q/+f+9v4C/8j+0/4C//r+HP88/5L/+v8eAGsABQFAAXwBvgH6ARsCAQLKAacBgQEsAesAwACYACEA8P+7/43/Yv8v/zf/Qv81/zX/Mf9T/z3/EP8T/yv/Bf/h/uX++/6p/qv+oP6T/rz++/6X/ysAcAAaAbkBAgI7AosCYAJdAgoCrQGSAUsBuQCPAI4ADwCf/17/cP9k//f+BP8n/zX/IP8a/0j/MP/2/u7+BP/i/qL+lv6m/kH+Cf7z/eD9v/1W/iX/3v+rAKABUgLiAn0DlQOSA3ADsgJQAgkCOAGZAIUAIwCq/1D/Wf9a/y3/RP+K/3r/fP85/x3/CP/e/qf+rP6z/nb+Tv4//vj9oP0x/fX8nPwD/Qn+Ov9tAOQBgANyBFIFwwVoBQsFBgSXArABwQCF/w3/Df+y/sr+/P65/xIAVwCeAOYAuQBMAJD/BP9u/tj90P3b/fn94P3v/fv9Rf2g/PD7F/vy+m/74/wd/3YBtAOuBT4HtgfiB+kGkQXaA6cB4f+K/jL9vPwS/V/9Uv5K/3kASgGPAa8BlAH+AAwAHP9U/rb9Pv04/aj9DP5t/tj+4P5O/oD9bfx7+1f72vt+/b3/GAI7BD8Gsgf9B7YHsAYcBf4C5QBQ/8f9uvy9/AD9o/2m/vD/GAG/Af8B9wGAAV0AYP+A/sD9IP34/DP90P1H/sT+L/8g/3z+t/2F/DP74/oN+1H87/5YAdADUAYxCL0Iigh1B5QFLwOTAJv+B/3e+/b7mfyW/QX/ewCxAWgCaAJOAoABNAAN/x7+Wv3j/Ov8Wf0a/tr+f//T/97/wf/K/g7+k/wX+6D6hvpJ/Or+kwE1BN4GsggoCckIPgcVBcgC7f+9/S38U/uY+3D8wP1z/xgBfQINA/AC2QLKATkA+P7U/Qb9t/zy/FX9WP5A/8P/MADs/9L/Iv/e/cD81/qz+b754PrI/aAAgQMmBjwIJQnhCJcHTgUhA9EATP6//Mv7yPuX/Lj9Qv/uAPYB1wIGA28CtQHAAE7/W/6//Tv9Tf3I/TP+Hv/H/xUALwDT/z3/qP5t/VL85Po1+oL6C/zA/lcB4AN3BtMHwgjrB1kGLQTiARAApv1b/Of79vvc/Cf+Of+mANgBeALoAosCkAHbAIz/WP7R/WL9a/3o/Wz+VP8mADgASgDO//b+dP6A/aT8bfut+gj7R/zN/lsBVwMPBngHEwj3B6AGwgTHAiUB2f4b/V/8+Ptl/KX98v4oAM8BqAIwAw8D+AErAb3/dv7b/Uv9OP2o/Rn+//7K/8T/4/+J/8f+KP6b/dr8qPv/+v/6bfsY/vf/dQGcBCgG8QaoBxkHwAUDBKMCYgCL/mL94fxu/GD9Zf41/+AAjwGOApoCBAKvAYYAf//d/iH+yP3g/fj9kv4y/yn/cv9Q/yX/gf47/qj9UfzG+1b7SPuB/bL+KgBYA/UEHgYiBx8H2QWWBCADuQDA/sD90vxW/Gr9EP4E/24AMAFtAmUCQAIXAroA+/86/yv+8f3W/cj9eP7S/lD/qv/T/5D/Cf+//s39ZvzV+1f7Dvsw/av+BQAwAxcFRAZxB1kHGAavBB0DywD+/n79YfxQ/OT8sP3f/kkAIwF9Ai0D2wKwAvQBUQBx/4z+sP14/TL9rf34/Wb+9/5G/1n/GP/W/on9gPzn+xf7U/zV/Wb+7QFzA9QEDAc1B6sGJwbOBJ8CFwE0/0r9dfyd/IX8Xf29/nT/+wBnAo8CwQLJAmQBaADS/5L+nf0r/Tb9G/2V/TH+KP6t/tz+JP5P/nH9iPz1/O384v20/54AAwNLBC0FbAaMBp0F6ATFA8kBgAAn/3f9y/y3/NH8X/2G/jv/agC3AfIBMwJQAlIBogAyADT/Qv5I/sr9hv0t/vr95/1Z/vr9jf3F/Qf9B/3D/Tr+sP8aAVkC9AOuBFMFvQU0BWcEigM4AtwAy/96/lX9I/3+/DD9/v3I/nT/vAB6AaUBBgKFAQQBiACr/8D+lP7w/bH99P2Z/e395P2N/Yn99/zT/Dn9w/3w/ogAxAGKA7IEMwUOBrgFKwWLBBsDwgF8AAr/xf0S/Zr8tfw5/dj9r/65/3UA/wC5AZIBoAE7ATwAyP8Y/0f+FP7D/VL9uP1X/S/9d/3F/MD8Yf2D/cf+MAAQAfYCyAORBKMFdAVCBQ0FiwNtAokB2P/s/hf+WP1e/Rn9uP1l/gz/xv+nACgBlAHGATcB+ACEAKf/OP9u/uj9uP00/cX82fxl/DX8iPzk/NP9PP8wAKoBCwPnAwYFnAWJBZoFswSbA9sCOgH7///+sv1a/ZP8yPwk/bj9ov53/3QAHQFlAeoBSQEIAZoAkf/w/oL+zv2g/TD95vza/Fz8dPzn/FP9lP6+/8IAVQJYA1EESwWlBbkFhAWOBMMDgAL4AOj/ef6R/cL8UvyR/Mj8q/16/mL/bgDIAIsBsAEMARkBXwBk/xL/Wf7o/bH9D/0R/cT8Tfy7/BP9ev1q/8L/egHwAnsDzQSzBWUFnAUSBboD8QKYAe7/CP/Z/a38vvxp/Ef8Lf26/Zv+w//x//cA6gBAATEBqwB7AAMAcv8U/1j+4v1r/ZX8dvzQ/IH8BP7q/mj/jQFjAucCbgXoBAYFeQaEBIEEUQTuAYwBYACK/qD+uP2d/Er9Hf1r/Sr+DP7V/hr/jf/U/8X/4P/B/5j/J//J/pD+6/2o/X39SP1s/Sn+nP5H/7sAcQEGAvQDjAOmAy0FjAPZAx8E8QHxATwBhf+9//3+3P1d/hH+Cf5E/nv+f/6x/g3/5/7k/kL/sP4P/6f+Pf6V/vr9+/1D/u79qf5L/7v/owB2AS0CwgKUA+UDxQPxA8sD3gLQAv4BFQHpAP//Lv8g/6r+Zf46/jP+IP4l/mn+h/5d/t/+sv7h/s3+pP7V/pD+mf7K/qv+7P5k/3L/BQBlALIAgAHdAUMCkALsAtIC2QLwAmYCJgL+ASYBwACoAJv/UP9O/8b+bv5s/o7+Ff6A/rj+4P3H/pr+Sf7o/lD+lP7b/qj+Nv8b/3b/9f/2/1QA+ACRAMoB7wGSAX0CIgL+AVwC5gHJAYABVQGYAJwAUwCD/4r/BP8l/37+4P5M/kH+p/5L/of+iv6y/tr+Cf///ur+bP8B//P/c/9kAJr/vQDGAPf/bgGSAJ8AgQFlAFsBsQGaACgBSAHuALsAIAEPAAgA8gAz//f//v+o/on/Lf/4/uj+Vv+a/oL++P9N/lj/i//j/lH/6v/v/mv/7f8p/wgAJwAVAAMA9QDQABMAnwGNANMAXQHDALMAJAG1AFMAMQF4ACQA0AAdACkAZADo/6z/GADR/17/sgCf/goApP+9/8T/6/8T/24A2v7pAI7+JQC0/0P/BQBn/+b/+wDe/VkBmv+T/9cAPQATAGIBOf+JAS8AngBfAFQAIQDj/9j/sQAs/0cAYv+O/8UAQ//o/xcAjv4SAMcAiv4yAPb/Hv8IAPD/4v7i/+//Vv+Q/5gABf9WACgAhv/H/yEBMf9VAHsAzv9/AMAAiP8oARAABgCTAJ0Apf98AJn/dgC2/7v/HADY/wYAr//U/x0Aj/89AAz/KwD1/2D/iP9JALX+DAFa/6j/bADW//z/MwANAAQAdwDM/w8AdgALACIAAABo/8IAMACf/x8AxACc/ysAcACL/4IAHgHq/RgCYADM/scAawCJ/2sAy//l/yAAygA2/xgAcgA8/zUAXgBz/rsAmP9S/4YAXv++/xAAlf68APL/Av+Q/1QAQ//Q/xQAFAB0/44Az//Y/6oAs//IAOP/pwDZ/50Ah/8kAQH/cgAnAKsAX/8oAVsAWf8eAYf/IAAZAIX/GAANAJj/3v8C/2wAef5rAGz/bP8uAHf////lACv+PAHq/kwA+v+0/zQA1P9U/50A1P/AAHT/dABtAHb/3AAhABIA8f+s/9MAeP/M/1gBKv6VAQD/aP8sAZ7/1P+E/1UARwBG/wb/WAF8/hECpf5AASP/fAA+AKD/pwBKAEL/VgASAO3/RADv/4AAqf85ABsA1v/d/xEAq//SADL/LwCc/zEAFwC7/87/ygAS/18AuwAQ/8kAZf99/yUAGADi/7P/IAD6/1r/qwAAAaX+tgDB/1sAqP/8/24Ac/9PALH/HwDd/7wAH/9bAPP/AQDu/4r/WQAC/wwBLv9PALH/ogCA/wMArf8lAfP+JgCv/2EA4v+V/yH/KgHB/h4BF/89ADUAnP+OAIb/awB9AH3/IwBLASP/CQBhAMX/OQDt/hEBov/q/wQA9P/+/83/0AD4/vQAff8EAP3/2P9ZAID/k/7RAaz+RwAvAIT/lgBf/xT/tAHy/hkB9v+2/5AAyf5rADAAD//BAKn/QwB9AFz/eADM/xYA3v/5/yIA/f8MAOL/JgACAOj/Wv+lAJH/JABm/4gAKP+eAMX/1P9QAOb/EwAuAcj+tAAJAHIADf/FADb/fgAg/ywBQf8RADEAof95ABoAav9uAMf/HgDg/+f/MQDZ/yMA3/8bAHv/cQCx/zIAN/8uAXb+6gAE/0QAKwBz/2cApP9OAND/EABcAbv+AQGy/ysASABq/4oAWQCY/y4AjP9yAMX/Gv/WAP//tf8JAKP/lQAE/0wBeP7ZAMT/af+PAGD/RQDQ/9v/LQDn/wEA7//9/6QAX/+l/28AsP88AMv/6v9OAJT/wQC1/sz/wgAb/3sAVgDF/2kA5v9Z/ysBOv+9ACQA8f9FAEb/XAAWAH7/XQC6/6X/SQCq/yUA6//E/zoAzf8GAA0A7f+vAAn/mwCI/yQAIABMALr/LwD3/0UA2v/G/34Ap//6/wEAHf+WAU/+NgHH/oUA//8DAAAADADs/3YA1f7jALH/mACI/xcAgP94AIn/7P/c/5kAA/95ANb/0f/PAML+BwFf/ykAEQDp/4kA3v+r/08A5P8BAGMAAQC4/28AvP8UANX/LwDy//D/0f/I/54Aw/4MAXD+8QC5/1MAtv4jAfb+7QAH/10BTP9DAHv/OQDm/0IAe/+yANj+sQBK/4YAYAAe/8gAcf+z/5gAgv+hAAAAdv98AMj/AgCIANr/6P9QANj/IQD+/7AAV/+HAHX/bABR/38Arv8AAGP/XwAMAMv/EADo/18Amv8tAAIAEwDo/4AAeP9gAK7/pwA4/90A6P7wADL/EwAyAKT/m/9/AD//HgEn/xgANwDM/wkAhwCS/8wAdP80ABsA0P8MALb/ugBh/5T/QwAOALf/wP9EAPn/XP8EARgA4v9N/5MA8P/w/5v/GQBLAHr/3f/HAKf/2v/N/1AA6//A/zP/sAAW/74A6v56ABkAlwBI//MA8/8tAO7/GQDS/7UAXf+qAJH/TQDV/+n/zv9tAG3/AwCY/x0A2/+t/9b/AgAGAMX/LADb/ywA1v8SACMAbv8EATv/AgA8AEX/gADa/+n/fgC//00A3f8GABAAFwD1/5oAoP/5AIn/fQDn/wkAHQBI/+D/uf9D//H/e/8IAIT/CwDN//3/rgBe/3wA8/9HABoA/v9dAFEAQP8rAIP/CwCq//P/DgAdAK3/LQCV//gAev92ABcADwBVANb/bQAUAG//hABa/z4Atv8YAPv/mv8GAA4Av/+0AKj/bwDv/zAAUADh/3YAmP/w/14AiP+cAB0A+P8zAMf/EQB1/8n/4v92/xgA6//o/ycADAAwAIj/EQCt/4//9v/Q/wgAEACe/wQAiP/N/2z/+/8sABUA+gDYAPAAAAHwAKQALAB6ANr/1v96AOr/OQDZ/4f/aP8E/2b/Av9T/5D/Y/9U/2//TP+j/vr+Bf/X/jz/Cv+D//v/zv9QAMsAHQHRAc8CEwMSAzkDxQI3At0B2wG8AKwAIgBO/9T+av7S/S39J/2i/JD8ivzd/Pb8V/3A/Vf+sv5O/4X/wv+0AP8A4AAAAgMCmAIxA4gDpgNSA8ID9QIMA/YCFgLrAYQBfwAHAFH/bv7g/Ub9w/xT/Bn8Fvwu/HT8wPy//G/9tv1w/bX9pP4n/yn/MQFOAjUDzwQrBZsFkAUhBfYE3wPNA5YCCgKkATMAyP/b/sL9XP1K/Gr82PsF/Dj8aPzI/DL9uP0B/hv+lf5z/ib+4f1p/rf+Lf/TAG4C1wMeBbcF+AVsBTUFTQSKAwYDHQJlAbcArv/l/hD+I/3V/Av8efwO/Hj8w/wz/dT9M/5//oT+8v6M/sr+a/6+/fn8fP20/aL+pAD1At0EwgVpBpIG8QVeBZQEBwR0A4AC8AH2AK//0v6k/cn8Tvzf+2D8J/zK/Dj93/2M/sX+5P7z/t3+av5V/hD+xvy2/Cr99f1U/6kBDgTVBIAF2wW7Bf0EkwQlBGsDqQINAn8BNQBO/6D+ev3o/G38p/yW/OD8sf31/bP+BP+o/4j/P/9M/5H+AP7C/cX81vsi/MT8Dv4aAEUCMQQvBfAFCAbGBR0FZQSVA5YCxAEAASoAGP+Y/rr9G/2U/Ij8t/za/L/9fv5W/6j/YgCGAH8A7/+6/8j+Ev46/Yz8zfsR/NT8Ov5XAEsCCAQEBYUFeAVgBZoEFgRPA14CZQGqAML/0/5O/pj9Tf3v/Ar9UP3N/Zj+D//L/+3/RgBRAOf/p/8K/1D++fzv/Fr7fPu6+wz9vv4MAb4CYwRFBYwF9QXwBV8F+gQOBAgD/gH4AJ//wP7g/Sv9rfxx/LD88PzI/Vn+Yv/I/04ArwBqACAAcv8a//L9Jf3Z/Mr75/v5+xn9YP5ZAO4BgQOIBP4EjgWQBTIFrATwAxEDJwJMATYAJv9L/oH94PyM/KD84/x6/Sj+5/6K/wEAjAB2AJQAEgCa/wz/+f1//bT8I/xA/Hv8jP3x/mMA5AFgA0IE8ASNBXIFJQWWBNIDAwMfAiwBFQAI/yL+af3r/K78tPz+/Hz9Bv6N/hT/lf/a/xgAWwAoAOf/iP/S/kH+yP0m/fT8AP2A/YH+k/+iAPIBAwPeA5QE+wTuBKwERgSsA/MCNAJfAWEAgf/F/h7+mf1c/Tj9Tv10/b39D/5m/rn+Av9i/4z/ov9y/zP/nv4w/sL9Cv3w/Pb8e/2B/pT/vQD2ATYDGQTcBEcFVwU4Bd8EYgSoA8gC2AGnAIj/kv7H/Sr9pvxp/EX8cPyf/O78gv0F/qj+Sf+n/+f///+g/z//0/4K/ov9bf2g/YL+fP+HALIBAwMABNwEbwWyBdIFogXqBPoD0AKeAUgA7/7v/SH9m/wU/OD70fsF/DX8hvxC/eD9mv43/6j/+P/+/7D/Z//Y/kb+Cf4b/pT+W/87AEYBZgJmA0AE9QRiBW0FdwUjBW8EYANEAhABwP+3/rH9BP1h/Bn88fv7+z38f/wK/ar9Vf7l/nD/3/8JAM7/l/8I/2D+Bf7Y/Sb+xv6N/3IApAHVArgDfgQoBWcFmAVwBd0E7wPwAtsBkQBr/2T+kf3L/GP8EPzx+wX8Nfyh/B39rf1E/r/+L/9f/0j/Kf+x/mj+If4b/n/+//7R/8YA9gHvAtQDoAREBWwFggVIBY8ErAOjAnYBSwA2/z3+gP3r/Jj8UPxV/HT8nvwR/Yz9CP58/gn/Xf98/1j/Lv+h/jf+3v2+/Sn+n/54/3wAqwG3ArMDigQjBZAFqQWCBfgELwROAzcC6wDL/8D+4v0l/a78WfxF/E/8fPzg/FD9zf1D/tT+Lv89/xv/4P5t/if+5/0P/nf+Ff/3//YAEQIAA+oDlQQvBV8FbQUxBZcE0gPeAq4BXABD/z3+UP2U/DT8//vo+wb8Y/zk/Fr98f2J/gr/Wf9y/1T/Bv+O/j7++P0N/mT+9v7Q/8sA6AH2AuQDsgRZBZYFpAVjBbgE0gPUApsBNAAP/xD+Rf2P/Db8Gfwo/Fz8wPxP/dX9Wv7c/mD/nv+Q/2j/+f5s/kj+H/4b/pP+M/8YACkBSQL2AswDggTiBOgEyAR/BNEDAAMkAikB/v8j/0j+mP0Z/cf8qPyV/Kj84/xD/af9Cf5y/u/+Nf8g/xL/6f6g/oT+p/6h/hj//v/OAKYBygLQA0UEjgTuBPgEoAQYBH8DvwLQAfQAvP8h/tn9if3h/Dr8Nfxg/NT8Ov10/bX9Kf6Y/sz+9v4r/wz/uv70/tr+w/4N/0P/rf9xACwB0AF2AjADugPlA+0D4wOhAx4DhwLSAfEAIABx/37+sP2g/YL9L/0O/Tj9pv0o/nP+ov7+/mv/n/+Z/7X/x/+S/2//iP94/53/0P8sALEAQgHCAUQCsAIPAzcDFwMAA7cCTQLSAUUBiADg/0T/q/4Y/tD9w/2U/Xz9p/3w/U7+qf7h/h7/bP+i/6H/0f/2/9//zP/V/7v/1P/f/+z/HQBdAL8ADAFmAa0B6AH3AQkC8wHJAY8BLwHkAI8AFQCg/0r/4P6Z/lj+Uv5O/jj+P/5e/pH+wP7o/gn/Nf9x/4P/ov/Q/+P/9v8LABoAIgAwADwAVgBjAHYAqADQAPoAEAEqAVEBRwFCAToBIwEIAdQAmwB1AFIAIwDm/6f/c/9d/0L/NP8n/wn/CP8U/y3/M/9R/2n/fP+d/9P/4//g/+X/3//L/8z/yP/F/8v/5f/0/wsALgA4AGsAiwClAM4A3wDlAO8AvACXAIgAdQAzAAEAyf+U/3D/bf9P/1j/f/+C/5H/s//Q/+f/+f/2//L/7//3//j/2v/E/6z/sv/D/9X/8v8MACoAOQBOAHYAegBzAGMAWgBfAFgAIAAEAO//zv+3/6X/k/+Q/5b/pP/U/+7/+P8HAPr/CQAcAA8A8P/f/+f/4f/O/8L/xP/A/8j/4f/x////OABgAGYAggCFAHkAZgBMADAAHgDt/8r/v/+c/5b/j/94/37/lP+c/8f/6v8DACAAMAA3AEQAPwBFACUAEwAAABMACgD9/wAA+f/0/wEABgAOACgAPgBLAGEAaABhAFoARQAeABAA6P/L/6X/nv+F/37/hP97/4T/i/+W/7r/0f/1/xAAFAAxADgANgBXAE0AUABMAEMASAAxACYAJwAZABYAHQAQABMACgAGAPr/7f/i/8//0v/A/7D/sP+m/7X/mP+h/67/of+3/8L/3P/l/9z/6f/u/wYADwAQACUAKQA3AEIAMgBGAFQATQBSAEkAUABMAEAAOgArAB4ADQD2/+b/3f/I/77/vf+w/6v/uP+v/77/z//P/9f/4f/o/+7/+//+//f//f8KABIADQD+/wwABgAGAAQACwAeAAwAFQAgAB0AGAAWABMAGwATAAEAAgD8//3/8//r/+//5v/T/8z/2P/d/+P/5f/h/9X/4P/o/9z/8v/1//H/+/8CAAkA+f/5/wgAEAAQABMAEgAmABgAIAAWAB0AGAAPABIAEAAAAAQAIAAAAPf//v8BAPT/+P/9//f/9P8HAOX/7//g//v/AADh//j/7//7//D/7/8AAAkADgDr//7/8f/t/wEA5/9Q/87/RQDv/yQAAQAUAEMAOQAlABcADQAQAAEA8//y//f/mwCqACT/xgBj/ub/4P+j/sb/Kv/d/4AASP95AB0AaACkAP7/YADYAEMALAHD/1oACv+//4P/Uf+l/3j/GAAbABUAWQA4AFcATQAgABUAKACB/wsAc/+YAIP/oP9L/zQAAQF3APEAMwBnAN//5/+U/1v/jf9i/8H/t//O/8kAvwCRAKwAEwBtAPT/eP+M/2z/6f9J/+j/Zv/H/xkAJADO/zAAm/+3/yAAnP+Y/jT/IP9w/ncBKABIAXADoQC4Apf/TQAuAJb+XP98/mcAIP4hAB3+jP/k/8z/dwDc/5gAQwBQAK8AWv9A/5j/Sv7a/zEAkP+qAqwAxwGdAG0Al//x/yv/cP+P/2H/mgBn/4MA+v+KAIcAMADXAEAAbgARAHEAFQANAMr/yf/d/6r/yf9EAE8AFgAcAPb/LgDY/3D/uf+F/yEACADs/+f/2gAOADEA3/9KAEsAmP9A/2f/uP+I/4//c/+2/9v/DQBOANT/UAAVAC4AiP/d/wcAuf+g/67/2v8XAAYACQCNAGsALQCh/wUA3f/g/6T/zf8oABIADQAIAEQAmwD2/wsAzf8XAMD/wf8UAOT/EgAiAAgARAAiACYANQBlAOT/if/b/9T/1P+W/93/IgAwAP3/GgBSAFUA/P/n/y8A7/95/7z/PwDy/2D/0f+qACYA5//5/2UAXgB9/7H/agAQAJ7/vP94AEEA0f+3/zUASQDP/6b/8/82APD/pf/s/0YA+f+W/+b/BgD9/3b/lf9NAAYAof/a/0QAXwAUAP7/jwAvANT/2f8/ABgAc/9n//X/MgDx/9n/NwCAACgAx//v/y8AKgC4/4D/8/8dAM7/CgA6ADQATQD9/wEA6v/d/wUAAADM//j/6P8yAAAAu//N/+D/GwAUAO7/IQA1AF0A+P+w/+H/QQAEAJb/XP/5/+X/6f9OAH0AxgBIAJT/s/+g//j/+P+w/3AAWAAIAAgAZv+U/8D/pf8dAC4A5/9JAAEAHAAGANj/AADN/xoAAQDy/50ATACs/9D/w//L//f/u/97AG8ABABfAND/qv+w/2X/8f8TANP/UABCAFIAMQCu/8j/uP+4/+v/CwCPAE0Ayv+4/5f/w//d/6H/RQBQAFoAiADz/+P/yf+K/5T/kf/b/+EAmgBpADQAzP/d/9T/df+v/yEAeACBABIAzf/L/8j/vf/3/2wA6/9YAHAANQARAI7/fv+7/4L/h//K//r/RQC8ABcAmP+l/7P/yv+a/57/YAAIAT8AEAAQABgArQARAFP/x/85AFQA9P+Q/1gAXQDr//L/EQAXABQA4P8DABoAwv+R/4T/o/+r/4f/If9R/+X/1f9u//X+U//B/7n/0/9pAGQB1gBHAGQAlAAfAc8AGgDxAEYBeQBmAHUAfQFlAZ8AjAAOAHD/Qv/2/nj/bf/g/tf+rP7c/vj+Qf5U/1L/t/7v/uH+Gf/f/qn+q/9lAJgAPwFmAfgAvQCjAK0AWAFQAVkBGwJ3A7gCgwGBARQCzgHXAMj/FP9i//L+6/27/Y79aP5C/jL9s/3o/Xb9kP2Q/WD+1f7f/tj/1QDjAOEAwwCDACAA5v8nACwBtgHQAdICDgSlA1sCSALhAsECugEoAQEBFwFVADX/EP/y/vv+2P64/nH/E/8p/pb9wPyL/AH99vxg/cj9O/6I/mn+Mf4s/xD/lP7J/l//jwCAAdMBgwMgBeEExgPgAhkDlgIsAdQAQgGNAX4BywCYAHIA5P+U/+z+A//7/kv+/f1a/d78Gf2k/NX8WP24/TD+G/6q/RX+8P1y/Zn9E/49/+sAQAIRBMgFAgauBTwE+wL5AUUA4v9VAPUAEAJAAgkCugEiAWAAjP/I/lT/ZP88/yL/Hv7G/WH9/vtC/Jf8F/0O/rn9oP2q/bX8Ifwc/LD8Hf6EAAQD0wWCB54H8AYBBTQDQAGN/6j/2P+oANABUAJ4AqwBrQAxAI7/Ev82/5b/rv/m/2f/X/73/Tn9hvzL/NH8av1B/gz+6/3e/HX7xPra+jH7Pf3gAIsEGQiJCVEJ4gcBBQoCPv/P/TP+TP98AMIBoQLRAsIBKAB4/x3/+/5C/4v/5P8LAJz/vv48/jf+6P3a/R7+RP6o/oj+Af5N/SD8N/tD+6P7qPye//YCHQZTCA0I6wasBDcCKgBm/r/9eP7V/yEBqwH8AVgC6gG0AGD/wP7Q/kj/uP8oAEYAIgB+/3P+GP4X/vD9Hv5e/rT+iP7b/R/92PuN+gv6xPpC/Dj+1wFPBZ0IAgq4CK8GigNdAD7+Lf2x/e3/7gHCApECLwJgAjMB/P/9/m7+LP+C/7f/XwCaAG4AgP9L/n79PP2m/en9b/2c/bz9iv03/Yn8+/xY/I37yvoE+0L90QAxBBkHsgibCDMHQAQQAQH/HP50/rb/KAHvArED4QNeA54BFACr/rv91P04/jv/FABMADoAAACJ/+L+YP6J/tn+lv55/vn9rf1k/f78//w0/df8oPxt/Nz8Wf/MAi4FPQfqB4kHVAaVA+wAIv86/sT+W/93ANMBfwLzAh4CkgBZ/w3+X/02/X/9vv7K/04AoACnAFUAp/8A/0j+5f3Q/dH9o/2O/Zn9Uf0e/UH9+vys/Jj8f/y4/igC4wRAB/QHtQfoBpIE0QF5/yD+Q/4h/8j/uAAFAjQDGAOoARUA0P5l/vT9o/0//jb/gQAkAS4B8wBMAHH/jf7I/Wb9S/0o/eH8svy3/HD8YPyz/LP84vzs/Nv8C/+BAoEFaAdkByMHhwZ5BIYBy/6Z/Ur+qf9AAAoBVQKAAysDZQGS/4X+d/5c/u39T/5Y/6cAGAGoABgAmP8p/4P+6P3i/S3+R/6h/e/8sfxD/BP8S/xe/B79q/3P/cz/1QLKBbcHaAe7BuEFQQTVAYn/aP4Z/4EAEwFYAf0BwwKNAh8BX/+4/s7+sf41/h7+zv7s/5oAigDg/1D/7P5r/vD9nf09/YD9RP3r/Mz8Mfwj/JX8cPy5/N38+/ys/mgBsARQBw4IEwhMB9YFuAMuAW3/I//V/24A6QCZAW8CnAK8AWgAh/8I/5n+Cf7P/Sr+AP/Y/yoA2/88/9b+XP7o/Xf9Cv1E/V39gP1m/Q79ufzE/Pj8Pv2L/b39Wv4tAMoCxwVlB8IHoAegBjAFAAOlAGT/YP8HAGQAvQB5ATECIAIRAbb/2/6b/k3+6v3o/Xn+dP8/AD4AeP/Q/oL+Mv7F/TL9Wf3X/fb9nP3G/LH8q/zZ/B/9cv0w/sX+Xv/mABkDxQV6B44HHQcLBqcErQJgAO/+2v6B/9D//P+DAFUBtQEGAcL/Af/o/tv+cP73/WD+Lf///9n/Qv/4/vn+vP43/oD9bf3h/f39Zv3D/L38/vwb/Ub9i/1I/s7+R/+SAIwCFAXeBkIHCAdZBksF4AO8AeT/Qf9w/5j/pf+t/2YAUAFRAYMAw/9x/1//u/7u/bX9RP4w/4z/K//X/vf+6P5r/qT9Ev1I/Zv9Z/3z/N/8G/1x/dr9Bf5U/q/+4v65/08BggPABfkGiwecB+0GqAWpA1sB6v+I/1//Rf9S/8X/qgBNAQgBSgCf/23/8f78/Wj9eP38/aX+zf6H/oD+mf5j/hf+5P3R/SD+Gf7F/Yz9l/2q/eD9I/56/un+BP8n/yAA2AEzBAEGzwZXB2wHjwYOBfQCyACD/xn/yP6q/t3+ef9NANEAjwDf/1//F/+T/tD9Yf2H/Rn+rv7F/oz+ov7W/rf+mv5Q/gT+IP4C/r39i/2Y/cH9IP6Q/uv+RP9E/2j/cwD+AQIEwAWXBhoHDAfvBX0EngJzAAP/g/4y/jz+pv5b/z4A7wD8AJkA+f9s/8j+9P1+/W79wP04/n3+dP6L/tP+A/8f/9r+hP5x/l7+9/3C/aj9v/34/Wb+6f51/9j/7P+hANoBaAM3BTkGYwaMBssFpgRlA3kB4f8r/7z+lf7J/vP+mf9QALAAjQAMAI7/Iv+q/jf+Af7P/eL9Mv4i/jz+Xv52/rn+3v67/nL+Vv4u/jr+HP75/eL9Kf6o/iP/f/+k/08ApQEuA+kE9gUMBhwGjQVtBDMDfwHO//j+k/5t/pD+0P5y/z4AsACwAFgA5P94/xL/YP7z/fj9Nf6K/oX+ev6T/sv+zf6m/kX+LP5A/lX+cv52/mv+d/6I/sb+D/9D/2j/uP+vACMC3QN0BRsGPQZFBoEFQQShAp4ASf+e/h/+5P0D/pT+Yf8dAHMAawAmALj/Uv+9/iD+8v0I/jD+UP5v/rz+If9U/2H/Vv9X/yb/5f7B/oL+Sv4d/vP9I/51/tD+Ff94/40A1QGLA2gFEwYlBjQGjgV5BBsDDgGZ/7z+EP4A/vL9N/7i/pj/DgAzAA0Ar/9r/+P+Vf4U/gD+If5Q/oL+tv75/jD/Qf9J/0P/DP+1/ov+VP4z/gv+7v3n/Rr+jP4A/1z/vf+5ABoCoANWBeIF8QX1BU8FbgRBA1QB4P/5/lv+O/4w/l7+6P6L/zQAjgCAADcA1P9S/8j+gP4q/v/9AP4l/mv+y/4c/2j/mP+0/3//Cv+m/lD+Fv7L/X/9oP0d/pL+7P5G/9f/BAFwAgMEQAWGBa4FnAUIBTQEygIVAeb/L/+Y/mb+PP5s/uz+if8lAFUATwAcAN3/jP8Y/7P+PP4E/uD97/0p/mT+u/4I/2D/fv9M/wP/xv6G/kf+7P21/eb9N/6K/r7+Cv/d/wkBjAIfBPYEbwXfBasFDAUYBIMC/QDj/xD/e/4t/gH+Pv7j/oP/8/8fADcAJwD7/6//Rf/Y/m/+OP4G/gf+If5H/pr++/46/1z/NP/r/qb+jP5W/vD9rP3T/R3+ff7Y/k//EABWAc8CLwQpBbgFCwbQBVoFWQTjAmEBJQAr/4H+K/7+/Qv+Y/78/mv/uP/R/63/hv9V/x7/zP6Y/n7+j/7D/ur+KP93/7L/1v/B/3f/D/+o/in+yv1X/Rb9Nv2K/Rv+sP5L/wgAAgEzAs0DAwWhBQQG0AVlBaIEUAPJAV0AYf/X/nb+YP5h/p7+Jf+u/wcABQDZ/5z/Tf8M/6n+Yf45/ir+MP5c/n/+v/4Q/1T/ef9g/yz/+v6m/kz+Dv7M/cr99f1h/uv+ff/w/6UAkwG5AgAE1AQ0BVkFGAWwBMsDawL+AMn/Af9+/jv+G/47/qz+Mf+w/97/4//S/67/hP8e/83+j/55/l7+a/5x/o/+6P4b/0v/Of8S/w//3P6h/mn+Kv4f/jT+ef7T/jj/iP9IAFIBgAL1A8cETAWpBYQFDgUWBKoCYQExACr/c/7u/bj93v1J/u3+YP+u//n/EQASAPL/h/8g/9b+m/5T/jn+NP5Q/pb+2P4X/wr/Av8J/+j+tf5o/hf+7v3h/Qz+gv7E/hr/t/+2AOYBFgM9BPgEfgWbBUYFoARiAxQC/wD3/xD/Z/4U/hL+YP7X/jT/iP/Y/xQAGAD//9D/b/8s/wD/vf6L/nn+gP6y/uT+DP9K/0X/XP9N/xb/wv6X/lX+Hf7+/Rf+Zf6j/vn+hP+LAMABFANMBAQFYQVlBTIFcAQvA+gBrACg/+v+KP7U/c39JP6S/vT+Tv+f/+j/AQD4/7L/bf9G//r+rv5w/mX+gP6s/tr+F/9Q/2r/oP+p/3//Ov8Z/9X+j/5r/m7+sf7z/jP/u/+bAJ0BmwJ/Ax8EgwSbBG8EAAQjAysCJwFEAI7/uv4y/v39Df44/mb+qf4G/1//ov/I/8b/uf+o/3//Mv/h/rH+sv67/sP+5f74/gn/NP8v/x3/HP8F/8D+ov6c/q3+5f4K/0X/0P+xAIMBbgJhAx0EkwSvBGgEFgSAA40CjgGLAMr/Iv90/iH+Cf4l/l7+o/78/lb/o//g//r/5f/P/7//eP8h//H+wf6r/p7+of68/sz+5f4N/wL/HP9A/yj/BP8M/x7/Lf9O/2b/q/9WAOQAgAEqAtECWgO0A7oDlQNlA+ECOwKIAdwAHwBo/87+b/5K/ir+SP6M/tD+IP9o/73/9f8AACEA/f/J/5X/T/8a/9D+kv55/m/+Zv5m/or+sf7c/hP/QP94/7X/BQA6AHgArwDYAP8AKgEzAUEBSAFFAUUBKwEuASABBwEUAfIA4ADLALAAiABaABUA5f/D/6v/hf9i/1z/UP9P/1X/Qf9O/0f/Rf9I/z//S/9O/0v/X/9m/2//fP+c/7X/xv/b/+T/+/8EAA4AGAAhAC8ALwBAAEoAVwBXAGUAaABsAHwAhQCcALYAsQDDAMgArwCWAH4AaABEACYADADw/9f/sv+s/6D/kv9//3X/cP9a/1j/Xf9R/0v/Vf9k/3D/gf+Z/7D/v//P/+H/+P/0//7/DQD9/wsADwASABkAGQAhADIASwBXAFwAfACRAJoAnwCoAKoAjgCRAJAAdwBcAEcANgAYAP7/9P/Z/8b/uf+p/5r/jP+F/3//cf93/2H/XP94/4D/kP+q/8D/2P/f//D/DQAAAAQABgD8//z/7//4//r//f8FAAgAEwAzAEcATQBhAHcAegB4AIsAgwByAHYAXgBUAD4AMwAjAB0ADwDx/+f/3f/W/77/uP+7/7H/r/+i/6P/qv+u/7v/vv/K/+D/4v/v/+7/7//6//P/7P/y//b/8P/s/+b/8P/0//D/9P8FAAcACgAIABMACwAaACAAKgAsACAAKQAwACsAIwApAC0AFAAQAAoA+v/t/+D/3v/c/9T/z//R/9f/5//s/+r/4f/w//H/9v/7//b/+//5//L/+f/4//P/8//3//j/9f/2/wMAAwD//wEAAQABAAIACAD8//f/+/8HAAYA7P8AAAwA/f8LAA4A//////f/6P/x//H/5v/s/+T/6P/v//D/6P/t//H/+//v/wQABQAHAAoAEQAMAAoAAQD8/wAA/f/8/+7/9/8EAOb/+f8AAAcAAgAAAAoACQD9/w8A+f8UAAQAAwAAAAsAGAAGACIAEwAAAAgACAAGAPj////x/+j/+v/x/+v/6v/w//L/9P/9//P/8f/u//b/8ABHAaf/4v9Q/7b/Xv+9/3T/d/+y/9T/AACN//T/CwAkADcAUAC6AE8AVgBKADAAFgAQAPv/5v/w/+T/3//p/+f/8v/w/+n/8f/6/zsAFwAIAD0AHwD8/1EAcgDY/8v/tv+t/1n/Xf+E/4D/bv/D/+7/GgAYAFUAiwBVAFsAbAD//wIA///C/3z/rf/P/8r/xf8zAPX/MgAzAE8APQAeADUAOwAgABAA9f8dAO//BAARAOj/7P8IAPn/EQA0ACsA6P/A/9D/tP+i/7D/yP+//7v/8f/X////+v8AADYAEgApABMADAARAOz/+f8EAOj/+/8DAAMA8/8KADAA9v8FAAEACgAPAAAAEwALAAUAAgABAAgA+P8GAPz/7/8aAAoABQD2/xMACwDm//z/8f/w/+z/0v/u/+b/1P/7//L/+P/w/xkAKAD0/wkAAgD5/+L/1f/1/9j/zf8LAAAAFQAxAD8ALAANABwADgDi/+7/4P/f/+b/6//+/+r/7P/8//7//P/9/wAA7//7/wIA/f/+//T/DgDx//n/CADv/+7/+P8LAAcA+P8IAAAA+P/4//r//v/o//H/+f/b/+r/+v8BABAADgAWAAkA+v/4//v/8f/s//n/BQDz//L///8DAAwA/v/4////AAD///r/8P8GAPn/DAD8//3////u//r/8f8FAAkA8f/+/+7/BgD6//n/CgD+//3/+////wIA+f/y/wAA8P/z//T//P8IAAAA+/8AAPv/CwAJAAMACAD8/wgA+P/+//r/9v8BAAAA9v/u//j/8//5//X//P/3//r/AQD+/wAA9f/0/woAAAD+/wIA/P/7/wUA9f/3//T/+v8EAA0A+//1//v/+f8FAP7/8/8DAP///v8OAAAA9//5//b/8f////L/9P8AAAMA+//6/wkA/f/4/wIA+P/5/wgA+f///wMA9P/0/wAA/f/+//f/AgD7//X/+P/8//n/9P/0//b/8P8AAP///P/7/wMAAAD+/+3//P//////9//y/wIA/f8EAAAAAAAAAPz//f/6/wAA/f/9/wEA+v///////P/8/wMACAD9//r/CgAMAAEA9f8EAAkA/v/5/////f/+//r/+//7/wEAAgD5//7/AwAFAP3/AQAAAPz/AAABAAAA9v8AAAsA+f/4////BQD+/wAABgACAAAAAwADAPj/BAAGAAEA///8/wAA9P/2////AgD8//j/AAADAAQA/P/9/wgA+f/6//3/AgAGAAAAAAD7//v/BAACAP3/AQADAPr/+P8BAAkA+P8AAAkA+v/5/woAAgAAAAAAAgACAPX/AAD8//n/AgD+/wAAAQD//wAABAD+//f/AwAAAAQAAAABAAEA/P8JAAIAAgAAAPz/+/////f/9v8BAAIA//8FAAQA+P8DAPz//P8DAAIA///4//////8GAAEAAwACAP7//v8EAAQAAAD3/wAAAgD7//3/AgD9/wAAAwADAP//+f/3//7/AwAGAPj/+P/+/wEABAD8//3///8JAAUABAAFAP3//v8CAAsA/f8AAAQA/v/2//3///////7/AAD9//n/CAAAAAAAAgD4//v//f////v/+f8EAP7/+v/9/wYACAD+/wUAAgAAAP//CwACAP//CgD7//n//v8AAAAA/v/8//n/7//8/wAA/f/7/wAA/////wMAAgD8/wYABQAEAAMAAQD9//7//v8JAAUA/P8DAAEA/v/7/wAA/f/6////+f/2//z////+//r/AAD///7///8BAAAAAAD9//H/BgAGAAIAAAAAABAABgAFAAoAAgAGAP///P/7//n/7//8//n/+P/2/wMABgD0/wEACQD+/wcADgD+/wAABQAFAAAA+v8AAAAA//8AAAAA/P/7/wsAAAD7/wAA/f8AAAMAAwD7//3/BgD+//r/AAD+/wUA/P///wEAAQD///v/AQAHAAYAAAD////////5/wAAAQD2//n/AwABAAAAAAAGAAYAAwADAAYAAgABAAgAAAD6/wEA9//4/+7/8P8CAP7/8v/9/wAA//8HAAsADQACAPv/BAD6//T/9//0//X/AAADAAMA8//1//j/AQD2//T////7/+r//P8AAO7////3//P/9P/3//z/9f/5//n/CAD+//L/DQAIAAAA+//2/+3/+f/t/+X/7v/y/+z/7v/4//v/7f/x/wAABwD3/wIA+/8HAPz/AAAFAAAAAwDx//3//v8DAPf/+P8AAAQAAAD4/w0ADAAAAAgAAQD//wcADAAFAPD/+v8FAPX//v////T////4/wYABwDt//T/BAAEAAMAAAAAAP7/BQD+//b/AQAEAPv/BgD+/+v/7//7//X/8v/y/wcA+f/s//j/CgADAAUA+v8AAA0A8v8AAAEA/P8AAP7/7v8BAP7/AAAAAAoAAQAAAAoABQABAPz/BgAEAP//+v8AAAAA//8EAP//AAD7/wEAAQDy/wMA/f/w//n/+v/6//H/9f/5/+3/+P8BAPf/8v/6//v//v/1/+z/+//7//r/+P/v//r/BwD2//L/+v8HAPf/7v/8//j/8v/t//L/+f/5/+3/6P///wAA+v/9////BQAKAAIAAQABAAIABgAHAAcABgD///7///8AAAEA+/8AAP//9v/9/wAA/P/9/wEABQD9//3/+P/6/wQA///+/wMAAQAIAP//////////AAD7/////v8JAAQABAAEAP////8GAAUA+f8CAAAA/v/1//z/AwAAAPb//v/5/wAABQD4/wEA/v8EAAwA//////j/+f8HAAEAAAD//wMAAwD4/wEA/P8JAA0A9//9/wMA///6//z/CQD6//n/BAAEAP//AAAAAAAAAAAAAPr/+v///wQA9//3/w0AAQD8//v///8DAP3/+P8AAPv/AQAGAAAA//////7/BQAAAPr/AQABAAAA9//9/wkA+P/1/wMA///8/w0AAwD4/wAABgAGAPn/+P8FAPv/9P/9/wcACQAEAPL/CAAIAPr/AAD//wQACwD7//z/AwD+//D/+f////7/+P/5//r//v/9/wIAAQACAAoABwAGAAwAAQABAAkA/v/+//3/AQAAAPv//f/3//f//f/+//7/+P/z/wEA+/8DAAQA/f/+/wAAAQABAPv/9f8IAAQAAAAHAAcABgAFAPz/AAAAAAEA+v8FAAQA+//5//v/AQAAAP//+P/x/wIABgAAAPr/AwD9/wIACwAFAAAA8/8AAAAA/v8FAAAA8//+/woA//8LAAUABgADAPf/+v8NAPz/8f8GAAAA+f/5/wAAAAAAAPn/AAAAAAAAAAD4/wUAAAD5//n/AwAGAPn///8LAAUAAAD6//r/AAAFAP//+P8FAAAAAAD6/wAAAAAFAP//+P8AAAAA8//9/wIAAgACAAIAAAAFAAAA+v8AAAAAAAAAAAAABgD//wwACQD2//3/CgD8//z//P/8//z/9v/5//j///8AAPn/8//9/wkAAgACAAIAAwAAAAAABgAGAAAAAAAFAAUAAADy/wAA+v/5/wAA//8MAAYA+f8AAAYABgD5//n/BgAAAPL/AAAAAPL//f8CAAkABgAAAAYABgAGAAMA/f/8/wMA/P/7//z/AwD9//X/AAAAAAAAAAD4//H/AAAGAPL//P8JAAAA/P8DAAMAAwADAAAAEwAGAAAAAAAGAPz/AgD8//H/AAAAAPn/8v/8/wwADAD4/wAAAAAAAAAA+f8FAAUAAAD5/wAAAAD5/wAAAAAAAAYAAAAAAAAABgD4/wYA+f/6/wAA+f8MAAUABQAAAAAA+v8AAAAA+P8FAAAAAADz//n/BQAGAPn/+f8GAPn/AAAAAPn/AwAAAPz/AwAGAAYABgAAAAAADQACAPz/AwD2//b/AAAAAAYA/P8AAAAAAAAAAPn/+f8AAAUABQAAAPn/8v8AAPn//P8CAPz/CQANAAAA+f/5/w0ABgAAAAYA+f8AAAAAAAAAAPn/8v/2/wIACQAFAA0A+f8GAAYAAAAGAPz/AgD8//X/AAAAAOr/+P8AAAAA/P/9//X//f8JAAgADwAAAAAA+f8GAAAA+f8AAAAABgAAAAYAAAD5//n/+f/5/wIABgD5//z/AwACAAYABgD5/wAABgAGAPn/AAAGAPn/AAAAAAAAAADy/wAABgAAAPn/AAAAAAAABgANAPn/AAANAPX/+f/5/wYA+f/5//L/AgACAPX//P8DAAkACQD8/wkADQAAAAAA+f8GAAwA/P/5/wYAAwACAPX/+f8KAO7/+f8AAAAAAAAGAAAA+f8GAAAA8v/5/wYABgD5/wAA8v/8/woAAgD8/wkADQD5/wAABgAAAAAA+f/5/wYABgAAAAYABgD5/wAAAAD5/wAABgAAAPL/AAD5//X/AwACAAkA/P8CAAYABgD5//n/AAAGAAAABgANAAMA/P/8/wIAAgD8//X//P/8//L/+f8AAAAAAAAAAAAAAAD5//X/AwACAAIAAwD8/wMAAgAJAAYA+f8AAAYABgD5//n/DQAGAPn/AAAAAAAAAAD5/w0ABgD8/wMA9f/5/wAAAAAAAPL/+f/8//z/CQD8/wMA/P8DABAAAAAGAAAAAAAAAPn/BgAGAAAABgAAAAAAAwD8/wIACQD8//z//P/1//L/+f8GAAYA+f/y//n//P8CAAIA/P8CAAIAAwD9/wIAEAAGAAAAAAAGAAYABgACAAkAAgD1//X//P/1/wAA+f/5//n/+f8AAAYA8v/1/wMAEAD8//X/CgADAPz/AwACAAkABgAAAA0AAADy/wYADQD5//n/BgAGAPn/AAAAAPn/BgAAAPn/AAD5//n//P/1/wkA9f8QAAYA9f8DAAMABgAGAAAABgANAPz/+f8AAAAABgD8/wIA9f/4/wYAAAD5/wAAAAAAAAUABgADAAMA9f/5/wkA/P/y//n/8v/8/wIACgAAAAAABgAGAAAAAAAAAAAAAAAAAA0AAAD5//n/AAANAAAABgD8//L/+f8AAAYAAAAAAAAA+f8AAAAAAAAAAPn/+f8GAPn/AAAAAAAAAAAGAA0A+f/5/wYABgD5/wAADQD8//L/AAD5//n/BgD5/wAA+f8CAAAA9v/8/wMAAgACAAkA/P/8/wIAAgAJAAAAAAAGAPn/8v8KAA0ABgAGAPn/BgACAPX/AAD5//n/+f8AAAAAAAD5//n/AwD8/wMAAwADAAYABgAAAA0AAAAAAAAA8v8AAAYABgAAAAAAAAAAAPn/AAAGAAYAAAD5//n/AAAUAPz/+f/5/wYACQD1/wMAAwDu//n/AAD5//n/BgAGAPn/8v8CAAUA+f8DAAAAAAAGAAYADAACAP3//P/5//n/AAAAAPn/BgAAAPn/AAD5/wAAAAAAAAYAAAD5/wAABgAGAPn/+f8AAAAAAAAGAAAA8v8GAAYABgAAAAAABgACAPz//P/8//z//P8DAPz/+f8AAPn/BgD5//n/AADy/wIA/P/8/xAAAAD8/wMAAgAGAAYAAAAGAAYAAAAGAAMAAwD8/wIA9f/2/wAAAAD5//L/8f/8/wkA9f8DAAIA/P8KABAAAAAAAAYA+f8AAAYADQDy/+v/DQAGAPn/BgAGAPn/+f8AAAAAAAD5/wYABgAAAAYAAAAAAAAA+f8AAAAAAAD5/wAABgD5//n/AAAAAAYA+f8AAAYABgANAPn/+f8AAAAAAAAAAAAA+f/5/wYABgAAAPn/+f8AAAAA+f8GAAAAAAAGAAAABQAGAAMA9f8AAAAA8v8AAPn/9f8CAAMA/P8DAAMACgAAAPz/BgAAAAYADQAAAAAAAAAGAAoA9f/8//z/+f/y//L/BgAAAPn//P8DAPz//P8DAAMAAwAQAAAAAAAGAA0AAgD1/wMACgD8/wMA/P/8//X/9f/5//n/6/8JAAYA+f8AAPX//P/8//z/CgD8/woACgAGAAYABgAGAPn/AAAGAAUA/P/9//L/AAAGAAYA+f/5/wAAAAAGAAAAAAANAPL/8v8AAAAA+f/8//z/AwADAAoABgDy/wIABgAGAAAAAAAGAAAAAAAGAAAAAAAAAPn/BgAGAAMA/P/1/wAACgD1//L/BgANAAkA9f/8//z//P/8//L/+f8GAAAA+f8AAPn/AAAAAAAAAAAGAAYAAAAAAAYAAAAGAAoA9f/8/wMA/f/x//n/BgD5//L/AAAAAPz/CQAGAPn/+f8DAA0AAAD5//L/AgAJAA0ABgAAAAYA+f8GAAMA9f8AAAAA+f/5//n/9f8CAAkABgAAAA0ABgAAAAAA+f8AAAAABgD5/wAAAADr//z/EQAGAPn/AAAAAAYAAAAAAAYABgAAAPn/BgAAAAAAAAAGAPn/AAAAAAAAAAD5/wAA+f8AAAAAAAD4//z/AgADAAMABgAGAAAABgD5/wAABgD5/wAAAAD5/wAABgAGAPn/+f8GAAAABgANAPz//P/8//n/+f8GAAAA+f8AAOv/9f8DAPz//P/8/wkA/P8KAAkACQAGAPn/AAANAA0A/P8DAPz//P/8//z/8v/5/wAA+f/5/wAA/P8DAPX//P/8/woAAgD8/woACgAGAPn/AAD5//z/AwANAAYAAAAAAAUACgD9//X/AgADAPX/AgACAPX/9v/5/wAA+f/5//n//P/8//z/AwD8/wkAAgD8/wkA/P8QAAYA+f8UAAoA/P8DAAMA/P/1/wIA9f/1/wAA8v/5/+7/7v8JAAMA/P8DAAoAEAAAAAAADQAGAPn/AAAAAA0A+f/y/wAAAAD5/wAAAAAAAAYA+f8GAAAAAAAGAAYAAwD8//z//P8DAPX/AgAJAPz/9f/1//n/+P/5//H//f8KAAkA+f/8/wMAAwADAAIAAwAGAAAABgAGAAYAAAAAAAYA/P8CAPz//P/8/wMA/P/1/woA/P/1//z/+f/y//n/AAAAAAAABgD5//n/AgACAAIAAAAGAAAABgAAAOv/BgANAAAAAAAAAA0AAgD8//z/CgADAO7/9f8AAPn/6//8//z/AwAJAPz/AwADAAkAAAD1/wMACQAGAAAABgAAAPn/+P8AAAYA+f8AAPn//P8NAAYAAAAGAAAAAAAAAAAABgD5//n/AAAGAAYA6//u//z/AgAJAPX//P8QAAoAAAAGAAYABgAJAAMA/P/1/wMAAgD1//X/+f8AAAAA+f/5/wAAAADy//z/CQAGAAAABgAAAPn/AAAGAAYABgAAAAAA+f8AAAAAAAAAAPH/AAAAAAAABgAGAAAAAAAAAAAABQD5//L/+f8GAAAAAAD5//z/AwANAAAA+f8AAAAAAAD5/wYABgD5/wAADQAGAPn/+f8GAPn/8v/5//X/AwAKAAoA+f/8/woABgAUAAAA+f8AAA0AAwD1//z/+f/r//n/DQD5//X//P/8/wMACgAKAAYADQANAPX/AAAJAAMAAwADAPz/AwADAPz/9f/u//j/+f/5//n/BgD5//3/BgAGAAAA+f8GAAAAAAAGAPn/+f8AAAYAAAAAAPn/+f8AAAYAAAAAAAYAAAANAAAA+f8GAAAA+f/5/wYA+f/y/wAA/P/8/wMAAwADAAMA/P8DABEABgAGAAYAAwD8/wIA/P/u//L/AAAAAAAA+f/5/wYAAADy/wIABgAAAAAABgAAAAAAAAD5//n//P8DAAYA+f8AAAYAAAD5/wYAAAAAAAYABgAFAP3/CgACAPX//P/8//X/AAD5//n/+f/5//z//P8DAAMA/P8DAAMAAgAJAAYAAAD5/wYABgAAAAAAAAD5//n/BgAAAAAAAAAGAPn/AAAAAAAADQADAPX/AAAAAPn/8v/1/wMACgD8/+7//P8KAAIAAgACAAIA/P8DABcABgAGAAAAAAAKAAMA7v/y/wYABgAAAPL/AAAAAPn/BgAAAPn/BQAAAPj/+f8GAA0AAAAAAPn/+f/5//n/AwD8//z/AgAJAAYA+f8GABQACgADAPz/AwD1/+7/BgACAPX/8v8GAAYA+f8AAPn/8v8AAAYAAAAGAAAABgAAAAAAAAD5/wAAAAAAAAYAAADr//z/CgAAAAAABgAGAOv//P8JABQABgD5/w0ACgADAPz/6P/5/wYA+f8AAPn/+P/1//3/CQADAAIAAgAGAAYA+f/5/wYA+f8AAAYA+f8AAAAABgAGAAAAAAD5/wAAAAD5/w0ADQADAPz/9f8DAAIA9f/8//L/6//8/wIA/P/1//z/AwAQAAMA/P8KAAoABgANAAYAAwAKAAMA7v/u/wAABgAAAPn/+f/5//n//P8DAAMAAwAGAAYA+f8AAAAA8v/8/wkABgDy/wkADAAGAAYA+f8AAAAA+f8AAA0A8v/5/wYA+f/y/wIABgD5/wAA/P/8/wkA/P8DAPz//P8JAPz/CQAGAAAAAAAGAAAABgAAAAAADQACAPz//P/8//X/+f/5/wAAAAD5//L/AwAGAAAAAAD5/wYABgAAAAYABgD5//n/AAAAAPL/9f8JAAIABgAAAPn/BgAGAPn/AAAAAAAABgD5//n/AAAGAAAA+f/4/wYABgAAAAYAAAAGAAAAAwD1//n/BgAAAAAA6//5//z/AwD8//X/CQD8/wMAEAAGAAAABgAAAA0ACQD8//z/CQACAPz/9f/u//n/+f/5//n/9f8DAPz/9f8JAAoA9f8DAAkAAwADAAMADQANAAAAAAAAAAkA/P/1//L/BgD5/wAAAAD5/wAA8v8DAAMAAAD8/wMABgAAAAAABgAFAAAA+P8GAAwA/f/5/wUAAgD9/wIAAwD8//z//P/8//X/AAAAAPn/+f/5//n//P8DAAIACgAAAAAAAAAAAA0ABgAKAPz/9f8CAAMA/P/1/wMA9f/y/wAABgD5//n/AAD5/wYAAAAAAAYABgAGAAAABgD8/woAAwD1//z//P/y/wYABgD5//n/8v8AAAAA+f8CAPz/CQAAAPz//P/9/xAAAAD8/wkABgAAAAYABgAFAPn/AAAGAPL/AAD5//n/AAD5/wMA/P/8/wIA/P8DAAoA/P8DAAMAAgADAAIABgD5//z/BgAAAAAABgAAAAYA+f/5/wAAAAAGAAYA8v8AAA0AAAAAAPn/8v/u/wMAAwD1//z//P8DAAIA/P8RAAMACQANAPn/AAAGAAAABgD5//n/BgAGAPn/8v8GAAYAAAD5//j/BgAGAAYACQD9//X//P/5/wAAAAAAAPn/+f/y/wkABgD5/wAAAAAAAAAAAAAGAAAAAAANAAMA/P8KAAMA/P/1//z/AwD1//z/8v/y/wYA8v8DAAMAAwAAAAYABgD5//n/AAANAAYA+f/5/wAABgD5//n/AAAAAA0AAADr/wMABgAGAAAA+f8GAAYAAAAAAAAA+f/5/wAA+f/5/wMA/f8JAPz//f/1/wIAEAADAAIAAAAAAA0AAAAGAAYA+f8GAAMA9f8CAPz/+f8AAAYA+f8AAAYAAAD5//L/+f/1/+7/AgADAAMA/P8CABAADQAAAAYABgAAAAYACgADAPX/AgD8//z/9f/8//z/8v8AAPn/+f/5//z//P8CAAkAAwANAAYAAAAGAAAAAAAAAPn/AAAGAAAA+f/5/wAAAADy//X/CQAKAAYAAAAAAAAA+f/4/wIADAANAAMA/P/8/wMA9f8DAPz/8v/5/wAABgD5//n/+f/8//z/9f8JABEAAAAAAPn/DQANAAAAAADy/wAAAAAGAAYAAAAAAPn/BgAGAPz/+f/5/wAABgAAAPn/+f8AAAAA+f/8/wYA9f/8/wMAAwADAAMAAwAKAAAAAAAGAAYABgACAAMA/P8DAPb/9f8AAPj/AAD4//L/AAAAAPX//P8JAAMAAwANAAAAAAANAAYACQD1//z//P/y/wAAAAD5/wYAAAD5//n/+f/8/wkABgAGAAAAAAANAAoA/P/8//z/9f8CAAIA7v/5//n/8v/8//z/AwADAPz/CQANAA0ABgD5/wYAAAAAAAYA/P/5/wAAAAAAAPn/+f8GAAAAAAD5/wYAAAD5//n/AAAAAPj//f/8/woAAwACAAYABgAMAAIA/f/4/wAABgAKAPz//P8DAPz//P/1//L/+f/5//X//P/1/wMAAwAJAAIA/P8DAAoADQAAAA0ACgD1//n/BgADAPX/+f8AAPL/+f/8/wMAAwD8//X//P8KAAoACQAGAAYABgAAAAAABgD8//n/AAAAAAAA+f/5/wYAAAAAAAAA+f8AAAAA+f/5/wIAFQAGAPL/AAAMAPj/+f8AAAAAAAAMAAAAAAAGAPz/AgD1//n/BgD5//n/DQAAAPL/+f/5/wIABgD5//z/CgANAA0AAwACAPz/AwD1//X/AwD8//z//P/5//n/+f8NAAAA+f8AAAAAAAAAAAYABgD5/wYABgAAAAAAAAAGAPz//P8AAPn/AAAAAPn/AAAGAAAA+f8AAPn/+f8NAA0AAAAAAAAADAACAPb//P/4//L/+f/9/wYAAAD5/wMAAwD8//z/AwAJAPz/AwANAAAABgANAPz/AAAAAAAAAAAAAAYA+f/5/wAAAAD5//n/7v/8/wMAAgARAAAA/P8DAPz/AwAJAAAAAAD5/wMAAAAAAAAA+f8GAA0AAAAAAAAAAAAGAPn/AAAGAPn/+f8AAAAA+f8AAAYAAAAAAAYAAAD5//n/+f8AAAAABgAAAPn/+P8GAAYAAAD5//n/BgAMAAYAAAACAAMA/P8DAAMA9f8CAAkA/P/8//X/9f/8//L/+f8AAPn//P8DAPX//P8JAAIACQAGAAYABgAAAAYAAAAAAAYAAAD5//n/BgANAPz//P/5//n/AADy//n/AgD1//z/CQAQAPn//P8KAAYAAADy/wYADQDy//X//P8DAAMAAwADAAYAAAD4/w0AAAAAAAYAAAAAAAAABgAAAAAAAAD5/wAAAAAAAOv//P8KAPz/9f/8//X/AAAJAAIACgADAAIACQAGAAYADQADAO7/+f8GAAYAAAAAAPn/BgADAPz//P/5/wYA+f/y//n/AAD5//z/CQD8/wIAAgAGAAYABgAGAAYA/P/8/wMA/P/1/wAA+f/y//n//P8DAAkA+f8DAAYAAAAAAAYABgAGAAIA+f8AAAYA/f8AAPn/+f8AAAAAAADy//z/AwD8/wIA/P8JAAYABgAGAAAABgAAAAAAAAD5//n/AAD5//n/BgAAAAAAAAAGAAYA+f8GAAYAAgDy//n/BgD5//L/AAAAAAAABgAAAAAA+f/5/wYA+f8AAAAAGAAAAPL/DQAAAAAAAAAAAPn/BgAGAAMA9f/y/wAA+f/y//X//P8CAAMAAgAJAAwADAAGAAAAAwADAAIA9f/u/wAABgAAAPL/BgAGAAAA+f/5/wAA+f/1//z/CgD1//z/EAAJAAAABgAAAAAAAAD5/wAAAAAAAPn/BgANAPn/AAAGAAAACQADAPX/AwADAO7/+f8GAPn/8v/u//z/AwAKAAIAAgADAA0ADQAAAPn/+f/5/wAAAAAAAAYA+f/5/wAAAAAGAAAA+f8GAPn/AAAAAPj/AAD5//3/AwAJAAAADAAGAPn/AAD5/wAAAADy//z/AwD8/woABgD5/wAABgAAAAAADQD5//n/AAAGAAAABgAAAAYACQD1//z//P/8//z//P/5//n/8v/1/wMA9f/1/wAADQAKABEADQANAAoA/P/1//z/+f8GAAMA8v/5//n/AAAAAAAABgAAAAAAAAD5//n/+f/8/wMACgAAAAUABgAAAAYA8v/4/wAA9v8CAPz/AgADAAkAAAAAAPn/BgANAAYAAwD8/woAAwACAPX//P/8//X/AgD1//z/+f8AAAAA+f/5//L//P/1//X/BgAGAAAABgADAAMAEAAXAAAAAAAGAAAAAAD5//n/+f8AAAAA+f8GAAAABgD5/wAABgAAAPn/+f8GAPn/8v/1/woACQAAAAAA+f8CAP3/AgAJAAAAAAAGAAAA+P8AAAAAAAAMAAYA/P/8/wMA/P/1/woA/P/1/wAAAAD5//n/BgD5//L/AAAAAPX/AgAJAPz//P/8/wMACQACAAoABgAAAAAAAAAAAAAABgD5/wAA+f/y/wYAAAD5/wAABgAAAAAAAAD5//n/AAAAAAAA+f8DAA0AAAD5/wYAAAAAAAAA+f/5//n/AwAGAAAAAAAAAAYABQAAAAYAAgACAPX/9f8AAOv/+P8AAAAAAAAAAAAA+f8CAAYAAAAAAA0AAAD5/wYA+f8AAPL/AAAGAAAABgAGAAYA/P8DAAMA/P/1//n/AAAAAPL/+f8AAPn//P8DABQABgDy/wYADQD5//n/AAAGAAYAAAAAAPL/AAAGAPL/+f8GAAYAAAAAAAAADQADAPn/+f8AAAAA+f8GAAYA+P/5//j/9f/9/wIACQAGAPn//P8JAAAAAAAGAAAAAAAGAAAAAAAGAPL/+f8NAAAA+f8AAAYAAAAAAAYABgD8//n/+f/5//n/9f/1//z/CQADAAMAFwAGAAYAAAARAAMA/P8DAPz//P/1/wMA9f/8//n/8v8AAPn/AAAAAAAA+f8DAAAA/P8DAAYABgAAAPn/+f8DAPX//P8JAPz/AgARAAAAAAAFAAYABgD5//n/BgAMAPH/AAAMAOr/AAAAAPL/AAAAAPz/BgAGAAAABgAAAPn/+f8GAPn/+f8AAAAA9f/8/wIAAwAKAAMABgANAPn/BgAQAAoA/P/8/wIA9f/8//z/9f/5//n/+f8AAAAA8v/8/wIACgAAAPz//P/8/wMAEAAAAPn//P/8/wkABgANAAAAAAAAAAAAAAAAAA0AAwD9/wIAAgD1/+7/8v/5//j//P8JAA0A+P8AAA0AAAAAAAYAAwD8//z//P/5/wAA+f/5/wAA+f8AAAYAAAAGAAAABgAGAPn/AAD5/wYABgDy/wAADQAGAPL/+f8AAAAABgD5/wAAAAAAAPn/+f/1/wMACgADAAYAAAAGAAYA+f8AAPn/+f8GAPn/+f8CAPz//P8CAAMAAwD8/wMAEQAAAAAA+P8GAAwAAAAAAAAACQADAPX//P8CAPX/+f/5//n/+f8AAPn/AwAAAAAABgANABEA/P/8//z//P/8//L/+f/5//L//P/8/wMAAwADAPX//P8KAAMAAgADAPz/AwAKAAYABgAAAAYABgAKAPz/9f8DAPz/9f/5//L/+f/5/wIA/P/8/wMAAgADAAMA9f8JAAoAAAD1/wMAEAAAAA0ABgADABAA/f/2/+7/AAACAP3//f/y/wAAAAD4/wAAAAAAAAAA+f/5/wIABgAGAAAABgAGAAAA8v/y//z//P/8/wMACQAJAAYAAAD5/wYABgAAAAYABgADAPz//P/1//n/DQD8//L/AAAAAPL/7v/8/wMAAgD8//z/EAAKAPz/DQAGAAAA+f/5/wAAAAAGAAYA+f8AAAYA+f8GAAAAAAAAAPn/+f/4/wYAAAAAAAAAAAAGAAAAAAAFAAYA+P8AAA0A9f/y/wAA6//8/woAAgADAPz/AwANAAYABgANAPz/AwD8//z/CgD8//X//P8CAPz/7v/5/wAA+f8AAPn/AAD5//X/CgAJAAAAAAAAAAYA+f8AAAYABgD5/wAABgAGAAYAAgD8/wIAAwD1//z//P/8//z/8v/y/+v/7v/5/wAADQAGAA0ACgAQAAUAEwAJAAIA/f/1/wMAAgD1/+7/8f/5/wAA9f8CAAMAAwACAPz/AwAJAA0AFAADAPX/AwD8//X/AADy//L/AAAGAPn/+f/8//z//P/8/wMAEQAGAAYABgD5/wAABgAGAAYA/P/5/wYAEQD8//X//P/8/wMAAwD1//z//P/y/+v/9f/8//z/CQADAAoACgD5/wYABgANAAkAAgADAP3/9f/2/wAA8f/y//3/9f8DAAkAAgADAAMADgAAAPn/AAAGAA0A+f8AAAAA+P/4//H//P8CAAIA/P8DABEAAAD2/wMACgAGAA0ABgACAAIA/P/8//X/+P/4/w0AAwD1//n/AAAHAPn/AAD5//n/AAD4//z/AgACAPT//P8CAAIAEQAUAAcABwADAAMAAwAKAPz/9f8CAPv/7f/q//f/8f/0//v/+/8JAAMAAwATAAkAGQAOAAYADQAFAP3/+/8AAOr/4v/7/+z/6v/5//v/AwD+/wYADQAOAA4ACgAQAAEAAAAAAPf/9v8DAP3//f/2//D/AQD8/wMABAD//wwACQABAAgABwAAAAUA9//2//b/9v/2/wEAAgAHAAEAEAARAAcABwAAAAUAAwACAPr/8v/x//H/9P/1/+j/9P8CAAQADAD4/wUADAAGAAYAEAAPAAgABAD9//z/9/8FAPr/9v/u//3//f/2////+P8DAAQAAQABAP///v8LAAcABgAAAP//////////+P/5/w4AAAD5/wcABgAGAAIA+//z//f//v/3//f/BQD4/wAABwAIAPv/CQAQAAUA+P/7/wAAAAAGAPf/9//9//b/9f/y//L/AAD6//v/AwAEAAUA//8VABQACQAIAAgAAwAJAAIA9P/z//T/+P/3//j/+f/8/wIA/P8CAAIA9f/8/woAEQANAAYABgADAPz/AwD8/wIA9f/1/wAA8v8AAA0A+f/5/wAAAAAGAA0A/P/8/wMA9f/5//L/8v/8//z/9f8AAAYAAgADAAoACgADAAYABgANABEAAwD8//X//P/8//X/6//y//X/9f8DAPz//P8KAAoAEQAGAAAAAAAMAAYAAgACAO7/+f/4//n/6//8/wIAAwAJAAMABgAAAPn/AAANAA0A/P/5/w0A/P/y//n/+f8AAAAABgAGAPn/BgD5/wAABgAAAAAABgAAAPn/+f/5/+v/9f8KAAIA/P/8/woACQADAAoADQAUAAkACgD5//z/AwD8//X//P/8/+f/+f8AAOv/9f/8//z/+f8GABAACgADAAMADAANAAAA+f8MABAAAgD9//X/9v/1//j/+f/5/wAAAAANAAYA+f8AAAAA+f/5/xQAAADy/wAAAAAGAPn/8v8CAAIA/P8KAAAA9f/1//z/EAAKAAYABgAAAA0ACQD1//z/CQD8//z//P/8//X/8v/5/wAAAADy//z//P8DAPz/AgADAPX/AwADAAMACQACAA0ADQAGAAAAAAD5//n/BgAAAAcACgACAAMAAwD1//X//P/8//v/+P////j/8f/1/wMA9v/v/w4AGQAEAAQABwAHAA4AAAAAAAYACQABAPT/7f/3//f/8f/7//z/AwAKAAcABwAHAAgAAQALABIAAwAAAPn/9f/7//T/9P/3/+n/9P/7/wIA/P8QAAoA/f8DAAcACAAAAA4ACwADAAMAAwACAPz/7f/7//H/6f/7/wgA+P/q//z/CgADAAoACgADAAYAAAAAAAYADAAAAAAAAgD1//j/+f8AAPn/BgD5//n/BgAAAAAAAAANAAYAAgD8//z/+P/4//j/AAD4/+7/AgACAAMAAwANAAAAAAAOAA0A/f8KAAoA/P/8//X/9f/1//j///////j/+P8GAAAABgAAAAAAAAAAAAcAAAD5/wAABgAAAPn/+P8AAAAA//////j/BQAGAAAA+f8AAAAAAAAAAAYABQAGAAMAAgD8//z//P/1/wAAAwD8/+v/+f/5//z/9f/1/wkACgD8//z/CgAKAAMAAwANABgAAgADAAoA9f/u//X/+f/y//L/AwAKAAYA8v/8/wMACgAGAPn/AAAAAA0ABgAAAAAA8v8AAPL/7v8JAAMAAwADAAoA+f/8/xEABgD5/wAADQAKAAMA/P8JAAMA9f/2//z//f/1//L/8v/1//b/9f/4/wYADQAKABEACQAGAA0AEQAKAPX/AwAKAPn//P/8//X//P/u/+D//P/1//X/CQADAAoAAwAJAAYABgAGAAYAEAADAPX/7v8AAPn/+f/5//n//P8JAAAAAAAGAAYABgAGAAAAAAACAPL/BgAGAPz/+f/5/wAA+f8GAAAA8v/8/w0A+f/1//z/AgADAAkABQAGAAwABgACAAMA/P/8/+7/AAAAAPn/+f/y//z//P8JAAIA9f8JAAkABgANAA0ACQAKAO7/AwACAO7/9f/5//n/8v/8/wMA9f/1/wIAAgAKAAMACgANAA0AAAAJAAoA/P8KAAAA9f/8//X//P/u/+v/9f8JAAAA/P/8/woAAwAGAAYABgAGAPn/+f8AAAAA8v/8//X//P8DAPz/AwACAAgAEwANAPr/+/8BAAgACAAEAP7/BAD9//z/9P/3/wQA/v/v//b/9v/s//v/9P/y/wAADgAZAP//GgAQAAkAAQAPABEAAwD1//T/AQAAAPr/8//6//P/8P/x//j/9f/9/wsA/v8FAAUADAAIAAgA+v/5/xQABQDx//f/CwDw//D/AQAFAAUAAAAGAAAABwALABIABAD6/wAA+v/u//z/+v/t//b/7//y//n/+v/7//v/AAAIAAwADQANABgACgAKAAwA/v8DAAkA8//k/wAA+P/m//T//P/x//n/AQD1//3/DAAGAAAADwAdAAsAAwAKAAgABAD8//r/+f/x////7f/t/wEA/P/9/wQA+P/s/wUADQADAAsACwADAAMAEAATAAMA9f8BAPr/8v/5//j/5//n//n/+v8BAPz//f8SABIACAAIAAcABgADAPv/+//w//j////3//L/AwALAAgAAQACABAACQD+/wQABAD8//z/+//6/+//9v/2/+//AAD6//v/9P8DAAoACwAFAAwAFwAJAAUA///+/wQA/f/8//v/+v8AAPL/7//2//7/9//3//v/9f8RAAQA/v8FAAUABQAMAAEA+v8DAPb/AgAJAAUA///+/wQABAD///f////5/wAAAAD6/wAA+v8HAA4AAAAAAA0A/f/8//z/+P8IAPT/8P/3//7/7f/t//v/BgAAAAcACwALAAwACAAIAA8ACwAEAPb/AwD1//v/+//3//7/7//+//f/9//7//z/AwARAAAAAQABAPv/CAAIAAEAAAAAAAYAAAD4////BAAEAPf/9/////j/8f8CAAYAAAAAAA4ABwD6//r/FQADAPX//f8CAAgA+//z//v/8//2//f/8f8FAPn/BwAAAPD/9/8FABMABAALAA4ADQACAAgAAQDz//r/7P/2//7/9//x//z//f8EAAUABQAMAAkACQACAA8ACwD9//z/7f/3//b/6P/y/wAA+f/z//D///8NAAAAFgATABQAFwANABcAAQD6/wAA+f/4//f/8//r/+7/7//v//P/8/8CAAIA/f8EAAsADAATAAkA+/8IAAEAAAAFAPn////2/wQA/v/3//7/8P/7/wIACQAAAAAACAD7/wEA+////wgACAAHAA0AAgABAPP/+v/5//n/9v/v//f/9//1//3/CwAFAAUABgAGABcAFwAFAAQAAwAJAPj/+v/z//L/8v/o/+j/7P/6////BgAKAP7/DAATAAkAEAAXAAwACwAAAPL/9f8BAOz/6P/2/+//8/8BAA8AAAD9/xAACAAIABQABQD+/wsAAwD8//v/7P/o//b/9f/y//L/+v/6/wgAAgD2/wsAGgAQAAIACgAUAAYA//8EAP3/AwACAAEA8//y//n/8v/5//b/9v/+//H/7v/2/wEADAATAA0ABgAXAAIA+/8HAAAAAAAFAAUA9//+/wQA9v/v//7/BAD///j/AAAAAAAAAAABAAEABwABAAcABwD//wEA+//7//r/7//p//P/CAD7//X/CgALAAsACAAPAAgABQAMAAQABAADAPz/9f/0//r/+v/6/+//9v/3//f/AQAGAAAA+f8AAAgACAAIAAEA+/8PAAAAAAAAAAAABQABAAEA8//6/wEA+/8BAPv/9f/5/wAABwD6/wAAAAAHAAcA8/8AAAcA+f/5/wAA/////wUA//////n/8f8IAAAAAAAGAPj/AAAFAPn/AAANAAYAAAD5/wAABgAAAPn/+f8GAAAA8f/4/wIAAAD1/+7/AAAJAAMAAwADAAoADQAGAAAABgAKAAMAAwD8//z/AgACAPX/9f/1/wAAAAD4//j/+f8AAPn/AAD8/wMAAwADAAYABgANAAYA/P8DAAkA7v/4/wkA9f8AAPj/+P8AAPn/+f/8/wkAAAAAAAwADAAAAAAACQD9/+7/+f8GAAwA9f/r/wAAAAAAAAYAAAD5/wAA+f/8/wMABgANAAAA+f8AAAAAAAAAAAYAAAD5/wAA+f8AAAYAAAD5/wAA+f/8/wMAAwADAPz/AwANAA0AAAAAAAYAAgD1//L/AAAAAAAA8v/1//X//P8QAPz//P8DAAMACQAJAAYABgDy/wAAFAADAPz/AwDu//j/AAD4/wAA+P/5//3/AwD8//z/CQD9/xEADQANAPz//P/8//z/AADy//L/9f/8/wMA/P/8/wMACgAQAA0ABgAGAAMA9f/8/wMA/P8CAPX/+f/y//L/AwAAAPz/9f/8/wkACgAGAA0AAAAAAA0ACgD8//z/AwD8//z/7v8AAPn/8v/5//z/DQAAAPn/AAD8//z/CgAAAAAABgAAAPn/AAAAAAAAAAAMAAYA8v8MAAMA/P/8/wIA/f/x/wAA+f/5//n//P/1//X//P8JAPz/AwAQAAoA/P8JAA0AAAAAAAYAAAAAAAYA8v/5//n/AAD5//X/AgARAAAAAAANAA0AAgD8/woACgD5//X//P/1/+7/6//5//z/9f/8//X/AAAUABEAAgAJAA0ABgAGAAMA/P8KAAIA5//5/wYA+f/r//b//f/9//z//P8JAAIACQADAPX/CQAJAAwABgAAAPn/AAAAAAAAAAD5//n/+f/8//z/AwADAAMACQAGAPL//P8NAAYAAAD5/wYABgAGAAMA/P/8//z//P/8//n/+f/5//n/AAAAAAAA8v/8/wIA/P8DABAAAAAAAA0ABgAGAAIA/P/1//n/AAAAAPn/BgD5//L//P8NAAYA+f8AAAAABgAGAAAA8v8AAAAA+P8AAAAAAAAAAAAAAAAMAAAAAAAGAPL/AAAGAAAAAAAAAAAAAAD5/wAABgAGAAAAAAAAAAAAAAD5//n/+f8AAAAA+f8GAAYA+f/5/wYAAAAGAAAA+f8AAAAABgAGAA0A/P/1/wAABgD8//n/AADy//n/+f8CAAYABgAAAAAABgAGAAAA+f8NAPz/AgAKAO7/+f/y//n/AAD1/wIA/P8DAAMA/f8JAAwABgAAAAYABgAAAAkAAwD1//z//P/8//X/+f/y//n/AgDu//z/AgD8/wIAAgAQAAoA+f8GAA0ADQADAPz/CQD8/+7/8v8AAAAAAAD5/wAAAAAAAPn/BgAGAAAAAAANAPz/+f/5//n/BgAGAPL/AAAAAAAAAAAAAAYA+f/5/wYAAAAGAAYAAAAGAPL/AAAAAPn/AAAAAAAA+f8MAAAA+f8AAAAADAAAAAAABgD5/wAA+f/y/wAABgD5/wAAAAD5//z/AgADAAYABgAGAAAABgAKAPz/AwD1//z/AgD1//z/+f/r/wAAAAAAAPn//P8QAAAAAAAAAAYABgAAAAAA+f8AAAAAAAAGAAYAAAAAAAAA+f8AAAAAAAAGAAAAAAAGAAAAAAAAAAYAAwDy//L/+f8GAAYA+f/4//z/AwACAAYAAAAGAAwABgD4/wYAAgD1//n/+f/5/wAAAADy/wMABgD5/w0ABgAAAAAAAAAGAAkA/P/y/wAAAADy/wAA8v/8/wkAAwADAPz//P8DAAkABgAAAAYABgAGAAoA/P8DAPz/7v/5/wYA+f/r//z//P/u//n/DQADAAMAAwADAAkACQANAAAAAAAAAAAABgAGAPn/+f8AAAAAAAAGAPj/6//9/wMAAwACAAIA/f8DAAMAAwACAAYAAAAAAAAA+f8AAAAAAAAAAAYA+f8AAA0ABgD5/wYA+f/5/wAAAAAAAAAAAAD5//n/BgAAAAAADQAGAPn/+f8GAAYAAAAAAPn/AAAGAPn/+f/5//n//P/8/wIAAwADAA0ABgAGAAYAAgAJABAA+f/1/wMA/P/1//z/AwD1//b/+P/5//H/9f8DAAIACQADAAMAAgAGAAYABgAGAAYA/P/5//n/+f8AAPn/7v8CAAoAAwACAAMABgANAAAADQAKAAIA/P/8//z//P/8//X/+f/y//L//P8DAPz//P/8/wkACgD8/wkADQAGAAYAAAAGAAMA/P/8//X/AAD5//n/BgAGAAAA+f8AAPn/8v/8/wkABgD5//z//P/8/woACQAAAAAA+f8CAAAABgAGAAAAAAAGAAAAAAAAAAAAAAAAAAYA+f8AAAAA+f8AAAAAAAAAAAAABgAGAPn/+f8GAAYA+f/5/wAA+f8AAAYABgAGAAAAAAD5//n/+f8GAA0A+f/5/wYABgDy//n/BgAGAPn/BgANAAIA/P/y/wAABgD5//L/BgAGAPn/8v/1//z/CQAKAAYA+f8AAAYABgAGAPn/BgAAAAAABQD5/wAADAD1//j/AAAAAAYA+P/5/wAAAADy//z//P8DAPz//P8DAPz/AwADAAkACgAGAAYABgANAPz//P8DAPz/9f/5//n/8v8AAAYA+f8AAAAAAADy/wIADQAAAAAADQAGAAMA/P/8/woAAwDn//n/DQD1//n/+f/5/wAAAAD5/wAA/P/8/wkAFAANAPz/AwADAAMACgADAPz/9f/u//z//P/x//n/AAAGAPn/+f8GAAYAAAD5//n/BgAGAAYA+f8AAAAA+f8AAAAA+f8AAAYAAAAAAAYABgAGAAAAAAACAPz/+f/y//L/BgD5//z/DQAAAPn//P8DAAYAAAAAAAAAAAAGAAYABgADAPz/+f/5//n/BgD5//n/BgD5//L/AgACAAMABgAGAAYABgAGAPz//P/8/wAAAAAAAPL/AAAFAPn/AAD5/wAA+P/1/wkADQAGAPn/AAAGAAAABgAGAPz/AAAKAPX/8v8GAAYA+f/5/wAAAAD5/wAAAAD5//z/AwADAAIA/P8NAAYAAAD5/wYA+f8AAA0AAAAGAAIA/P/8//z/AwD8//X/AAD5//n/AAD5//n/AAAAAAYAAADy//z/EAAAAAAABgAGAAAA+f/5/wAA8v/8/wkAAwAAAAAA/P8DAAYAAAAAAAYAAAD5/wAABgAGAAAAAAAAAAAAAAD5/wYAAAD5//n/8v/8/woABgAAAAAAAAD5/wAAAAAGAAYABgD5/wAAAAAAAAAABgAGAPz/AAD5/wAAAAAAAAAABgAAAPn/8v/5/wYA+f8AAAYA+f/8/wYAAAAAAPn/AAAGAAAADQAGAPn/AAAGAAAAAAAAAAAAAAAAAAAA+P8GAPj/+f/4//X/AgADAAMAAgACAAwABgD5/w0ABgD8/wIA/P8CAAMA/P/1//z//P/8//z/+f8AAAYAAADy//L/AwADAAYABgAAAPn/AAAGAAAAAAD5/wAAAAAGAAYA+f/5/wAAAAD5/wAAAAAAAA0A+f8AAAYAAAAGAAYA+f8AAPn/+f/y//z/AwD8/woAAgD8//z//P8DAAMA/P8JAAMA/P8UAAYA+f8AAAYADwD8//z/AgD1/wkA/P/8//X/9f/5//n/AADy/wYA+f/u/wMACQAJAPz/AgAGAPn/BgANAAAAAAAAAAAAAAAAAAYAAAD5//n/AAAGAAAA+f8AAAYABgD5//n/AAAGAAYA+f8AAAAA+f8AAPn/+f8GAAAABgD5//n/AAAAAAAA9f/8/woACQD5/wMABgD5//X/AwAKAAAABQAAAAAAAAAGAAYABgD5//L/BgAGAAAA+f/5//n/AAD5/wAABgAAAAAABgAGAPn/BgAAAPn/BgAGAAAAAwADAO7/8v8GAAAA+f8NAAYA8v8GAAYA+f8GAAAAAAAAAPn/AAAAAPn/+f8AAAAA+f8DAAIA/P8DAAMAAgADAAYAAAAAABQAAwD8//z/AgACAPz/9f/8/wMA/P/1//H/AAAAAPj/AAAAAPn//f/1/wMAAgACAAoAAwAGAAYABgAGAPn/BgAKAPz//P8DAPX/+f8AAPn/+f8AAAAAAAD5/wAAAAD5//z/AwADAAYAAAD5/wAADQAAAAYAAAAAAAYA+f8AAAAAAAAAAAAA+f/5/wYA+f/y/wkABgD5/wAABgAAAAAAAAAGAAAA+f8AAPn/+f/8/woAAAD1/wkABgAAAPj/AAAAAPn/AwAGAAAABgAGAPj/BgD4//H/BgAAAPn/+f8GAAYAAAD5/wYAAAAGAAAA+f8AAAAADQAAAPn/+f8AAPn/DQAAAPL/AAAGAAAA+f/5//z/AwAGAAAABgAAAAAABgAAAAAAAAAAAAAABgDy//L/BgAAAPn/9f/8/woAAwADAAYAAAAGAPn/AAAGAAYABgAAAAAAAAAAAAYA/P/9//3/AAAAAPH/+f/5/wAABgDx//3/EAAAAPn/DQAGAAAA+f/5/wYAAAD5/wYAAAD5/w0AAAD5//L/AAAGAAAAAAD5/wYADQAAAAYAAwADAPX/9f8AAPn/+f8AAAAA8v/8/wMA/P8DABAABgDy//z/DQANAAAAAAD5//n/FAAKAPX/AgD8//X/AAD5//n/AAAAAPn/AAAGAPn/AAAAAPn/AAAAAAUA+f8GAAYAAAAAAAYAAAAAAAAAAAAAAAAAAAAAAAAA+f8AAPn/AAAAAAAAAAAAAPn/AAAAAAAAAAD5//X/AwADAAoABgAGAAAAAAD5//L/AwAGAPn/BgAAAPn/9f8CAAoABgAAAPn/+f8DAA0AAAAAAAYADQAJAPX/9f/8//z//P/5/wAAAAAGAPL/+f8GAAAA8v8AAAYAAAAAAAAABgAFAPn/+P8MAAAA8f8GAPH/+f8GAA0AAAD5/wAAAAAGAAYAAAD5//n/+f8AAAYAAADy/wAAAAD8//z//P8DAAkAAwADAAAAAAAAAAYABgD5//n/AAAGAAAAAAAAAAAABgAAAPL/8v8CAAIAAAAAAPz//P8CAAoABgAAAAAABgAAAAAAAAAGAAAAAAD5/wAABgDy/wAA+f8AAAYABgAAAPn/BQAGAPH/+f8GAAAA+f/5/wAABgD5/wAAAAAAAPn/AAAAAPn/AgAGAAAA8v8JAA0ABgAAAPn/AAD5//n/BgAGAPn/+f/5/wAABgDy/wMAAgAAAPz//P8JAAMAAAD8//X//P8QAAMAAwAAAAAADQD5//n/BgAAAAAAAAANAAAA+f8AAAAAAAAAAPn/+f/5/wYABgD5//n/AAAAAAAA+P8GAAAAAAAAAAAAAAAGAAAA+f8GAAYAAAAAAPn/BgAGAPz/AAD5//n/AAAAAAAAAAAGAPn/BgAGAPL/+f8AAAAAAAAAAPn/BgAAAAAADQAGAAMA9f/5/wYAAAD5//n/AAD5//n/AwANAA0A+f/5/wYADQD8//n/AAAAAAYAAwD1/wAAAAAAAAAAAADy//L/CQAGAPn/+f/8/wkADQAGAPj/BgAAAAAABgD5/wAABgAAAAkA/P/1/wMA/P/8//L/+f/5//X/9f/8/woA/P/8/woAAgD8/wMACgAQAAAAAAANAAYA+f/5/wYAAAAAAPn/+f8AAAYADQD5//n/AAAGAAAA+f8GAAAAAAD5/wAAAADy/wYAAAD5//X/CQANAPn/8v/8/wkABgD5//z/CQAAAAYABgAAAAYA+f/5/w0ACQD9//X/AAADAPX/+f8GAPH/8v/2//X/AgD1/wAADQADAPz/CgAQAAMAAAAGAAYAAAAAAAYAAAAAAPn/AAAAAAYABgD5//n/AAAAAPL/AAAGAPL//P8KAPX//P8DAPX/CgAQAAAAAAD5/wYADQANAAMA/P/8//z//P/8//X/AAAJAO7/8v8AAPn/AAD5/wIABgAAAPn/9f8JAAYAAAAAAAAABgAAAAAABgDx//n/BgAAAPn/+f8CAAAABgAGAAAA+f/5/wYABgD5/wAABgAAAPn/BgAAAAAAAAD5//n/AAD5/wAA/P/8/wMADQAGAPL//P8DAAYABgAAAAAAAAAAAAAABgANAAMA9f/5/wAABgD5/wYAAwD1/wAAAAAAAAAAAADy/wAAAAD5//n//P8CAAIAAwADAAMAAwACAAAABgAAAAYAFAD8//L/AAAGAAAAAAAAAAAAAAAAAAAA8v/5/wAAAAAAAAYA+f/5/wYABgD5//n/AAAGAAAABgANAPz/AAACAPz//P8DAPz/9f8AAAAAAAAGAAkA9f/1/wYA+f/5/wYAAAD5/wAABgAGAAAAAAAAAAAAAAD5/wAA+f/5/wAAAAAAAAYABgD5/wAA+f8AAAAAAAAGAAYAAAAAAAYAAAD4/wAABQDy//H/BgD5/wMA/P8CAAkAAAAAAAAAAAAAAAYAAAAAAAYAAAAAAAAA+f/5/wAABgD5//n/AAAAAAYAAAAAAPn/BgAGAPn/+f/5//z/BgAAAAAAAAAAAPn/AAAAAA0ABgAAAAYA+f8AAAYAAwD8//X/AAAAAPn/BgAJAPX/+f/5/wAA+f/y//z/AwAQAPn//P8KAAAAAAAAAPn/DAANAAAAAAAAAAYA/f/4/wAAAAAAAAAAAAAAAAAABgAGAAMA/P/1/wAABgD8//z/AAAAAAAA+f8AAPn/AADy//X/CgAKAAAAAAAAAPn/AwADAAAABgD5//z/BgD5/wYABgAAAAAAAAAAAAAABgAAAAAAAAAAAAAAAAD5//n/8v8CAAYA+f/1/wMACgANAPn/+f8GAAYAAAAAAAYAAAAGAAIAAgD8/+7/+P/5//n/+P8DAAAA/f/9//z/CQAJAAAAAAD5/wIABgANAAAABgADAPX/AAAGAPz/+f8AAAAABgAAAPn/BgAAAPn/+f8GAAAAAAD5//n/AAD5//z//P8DAPX/CgAKAAoABgAAAAAABgAAAAAABgD5/wAABgD5/wAAAAAGAAAAAAAGAPn/8v/y/wYABgD5/wAABgAGAAAAAAD4//n/AAAAAAAABgAGAAAAAAD5/wAAAAAAAAAAAAAGAAAADQADAPz/9f/5/wYA+f8AAAYA+f/5//n/BgAAAPn/+f8AAAAA/P8KAAYA+f8AAAAAAAAAAAAAAAD5/wYABgD5/wYABgD5/wAADQD8/wAAAAD5//n/+f8GAAYA8v8AAA0A+f8AAPn/+f8AAPn//P8DAAkABgAAAAYAAADy/wAAAAAGAAAAAAAGAPn/AAAGAAAAAAAGAPj/+f8NAPn/AAAAAAYA+f8AAAYA+f8AAAAA+f8AAAYA+f8AAAAAAAANAPn/+f8AAAAABgAGAAAA8v8AAA0AAAD5/wAAAAD5/wAABgD5/wAABgAAAPn/AAAGAAAA8v/5/wYAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABgAAAAAAAAAGAAYA+f/5/wAAAAAAAAYA+P/5/wAABgAGAPn/BgDy//n/AAD1//z//P8DABAAAwD8/wIA9f8CABEABgAAAAAAAAAGAAYAAAAAAAAAAAAAAAAABgD8/wAAAAD5/wAAAADy/wAAAAAAAAAA+f8GAAAAAAD5//n/BgANAAAAAAAGAAAA8v8AAAYA+f8GAA0A/P/5//n/BgAAAAAAAAAAAAYABgD8//n/BgD4//L/+P8AAAYA+f/1/wkABgD5/wAABgAAAPn/+f8GAAYADQAGAPn/AAD5/wYABgADAPX/AAAGAPL/+f8GAAAA+f8AAAAAAAD5/wAAAAD5/wYAAAAAAAYAAAAAAPn/BgD5//n/BgAAAAAA+f8GAAAAAAAGAPn/+f8GAAAA+f8AAAYABgD5/wAAAAD5/wAAAAAAAAAAAAAGAAYAAADy/wAADAD5/wAABgD4/wAAAAAAAAAA+f8AAAYAAAAAAAAAAAAAAAAABgD5//n/+f8AAAAAAAAGAAAAAAAAAPn/AAAGAAAAAAD5/wYABgAGAPn/AAAAAAAAAAD5/wAAAAAAAAAA+f/5//z//P/8/wMACQD8//z/CgAJAAYA+f/5/wMAAAAGAAAAAAAGAPn/+f8GAAAAAAAGAPn/+f8GAAAA+f/5/wYAAAAFAAAA+P8AAAAAAAAGAAAA+f/4//n/AAD8/wYAAAAGAAYA+f/5/wAA+f/8/wYADQAGAAAAAAAAAAAABgAAAPL/BgAGAPn/8v/y/wMACgAGAAAA8v8DAAAAAAAGAAAAAAAGAAAAAAAAAAAAAAANAAoA9f/1/wAAAAAGAAMA9f8DAPX/6/8NAAYA+f/5//n/+f8DAAMAAAD8//z/AgASAAIABQAGAAYAAAD4/wYAAAACAP3/9f/8/wMA/P/8//n/AAAGAPL/6v8GAAAA+f8AAAAABgD5//H/+v/0//v/CgAAAAAABgDx//j/BQD+/+r/8f/+/wUA+v/x//H/+P/+//j/AgD7/+b/+P/q//j/+P/4//j/+P/4//H/8f/4//7/8f/0//z/AgAJAPX/AwD7//r/+/8CAP7/9v/4//H/+P/4//j/AAD4/wAA+v8GAAgAAAAAAPj/+P8GAOn/8f/4/+3/AgAGAPL//P8KAPz/BAADAAIAAwAEAAMACQD4/wAA/v/+/wYABgD8//H/8f/p//7/BQD0//T/8f/4//7/+f/5/wAA+P8IAAEA+P8BAAEAAgDt//v/AgD7//r//P/7//v/9P8KAAYAAAD5/wYA/v/+//7/8f/x//b/9v/6//3/4v/w//H/8P/4//n/+P/8//P/AgASAAAAAAAAAO7/AwAPAPn/8f/8/woADQD4/wAAAAD+/wAA8f8AAAAAAAAAAPn/AAAOAAYA+f/5/wEA/v/+/wAA8f/4/w0A6/8AAP7/AAAAAPH/BgAAAP7/AAABAA4ACAAIAAgA8f/x/wAA/v/+//j/BgD7//H/8v/+//7/8P/4//j/+P/x//D/8f/4//j/8P/w//j/AAD+/wYA/v/5//n//v8AAPH/+P/5//H//P/1/woAEADp/wQA+/8CAA0A6f8QAAUA4f/7//7/AAD5//j/CAD4/wYAAADg//j/AAAAAPL/+P8NAAAACQAAAP7/BgD5//n/+f/u//n/8v8ZAO7/8f8IAPj/+f8AAPj/DgDx//n/BgD+//D/CQAAAPX/AAAAAOj/CAAGAAkAAAD+/wAAEQDw/xAA8f/4/wAABAABAPv/8f/0/+3/7f/t/wAA+f/y//3/+//0//z/+/8KABEA5P8SAOn/JgDW/zAA+P/1/wkA8P/+//j/6P/5/+b/CADS/wgABgAAAAAA4//8/wIAAQAAAO3/AgD7//v/6v8WAPj/+f8GABYA8f/5/+n/AgD+/wEA4P/4/wEA9v8AAA0ABgACAPH/2f8QAP7/8f8AAPj/AAAAAAwAHgDp/yoA7v/Y//r/7v8BAO3/8f/8/wAA3P/9/xYA4v8KAAAAAAAGAO7/EwDt/wAACQD6/9X/BQAYAMj/OQDZ//n/AQDw//z/AwADACwA1f8FABsA8f8SANv/+/8BAPj/9v8GAOb/OgDz/wMACAD0//z//P/s//T/9f/x/9n/CADw/+v/AwAbAOb/3P8pANv/BAAiAPH/HQD3//7/BgD4////BgD4/wgAFwDk/wAACADo//z/8/8BAOv/9f///wsACADV/xwABwDn/w4A7v/2/9P/IwDM/wsA8f/8/xQA4f8CAAMA+/8HAAcA9////xAA1v8eANL/OQDl/+7/7/8ZAPj/DQDU//j////r//b/4f8JAAMABQDz//7/HwDx//P/BQAXAAYAz/8cAN7/CgDu/9v/FgDq/wUAFgD9/9P/HwDo/wsAAQD0/xgAKwDj/ywA8P8AAPD/6P/5//T/7P8WAAsA9/8IANz/EgDD/wgA2v8tALz/KQADAAAA8P8IAAgAKADs/xIA6P/g//X/1f/k/ygA6v8rALT/KADw/wAA9//2/+D/AQAEANf/LgADAAcA4P8PABAAMAD9/+3//f/j/wAA7v8GAPP/EgANAPz/2f8wALD/7/8AAPj/FgDo/wkA2P84AOj/IwAqAPj/AADi/xoADQC2/w0ACwAFAAAAxP8cAPv/+P8QAPj/zP/V/xAA8P8UALn/PAAVAO3/GADA/x0A6v8GAO7/EgDy/xsAFQABAPv/3P8wAJX/WgCt/zsA2P/5/x4Ayv/D/wAAKAAUAPn/LADQ/9z/xf8MAAIAEQAAABUAkf8hAL3/VgDm/wkACQACAN3/MgD+/wYAAgD1/wUA8P8JAAAA9f/0//z//P8GAPz/+f8DAEwAnP8ZAOv/CADs/8r/+f/8/zYA5v8eAPr/PQC2/xgA6v/8//7/7P8WAPL/AQDp/wkA6P/L/zoA2/9QAMT/EQAaAAYA1v/x/xYAEgDQ//7//f/Z/+z/BQALAPT/7f/4/wMAMABh/14A0v/W/ygA3P8BAAUAAQAEAAsAHgAZAOT/KwCo/z0Avf8bANj/7P8YAPL/CADt/wUAHgD4/7H/TgC0/0YACgD0//n/6f8EAOT/CADk/xkA3P8ZAPT/tv9MAMn/8P8IABIAyf9SAHj/AwAZAPz/RAAZAAAAkP/x/yIAAAAJACIA6/8DAOj/GAAEALX/igB8/0gA1P8GADoA3P/Q/wsA9P/w/x4A6P8MAPD/AAAgAIz/YgCx/yMArf8qABgAKAC6/wUABQDo/xoA7v8WACAA6/88AJj/EwDh/0oAs/8BABgAGAAWANj/0v8KAAYA8f8QAAoA8P8cAKr/FQCu/0oA2/8JAPT/rP+EAKz/YQCu/ygAwf9mANb/pP8sABwA6//b/xEA4P8kAP3/vP8aAOT/EQD2//7/4v8OABIAKgD0/5P/dQCy/xQAwv8UAOr/6f8UAPj/+//z/+7/5f/u//3/CQAUAAAAMAABAAgABQAAAP//6v/1/wQA7v/w//n/AgACAPz//P/z/wIAHADf/wAABgDi/w4A7P/9/yQA2v8TACQA9v/q////6//5//3/2P8JAPL/CQACAPX/EgASABQABgD3/+r/6f/w/8j/BQDi//r//f/9/w4ADwAiAOz/DgD+//j/7v/y//7/8/8aAOj/KADo//n/8P/t//j/8P/7//b/AgDt//D//////xgA8f8XAO//+v/Z//3/8v/5//f/8v8HAOr/BwDk/xUA8f8XABgA2P8dAND/CgAMAOn/AAACACAA6f8oAMr/CQDm/w8A7P/x/wIA7f/7/+f/BQD9//f/+f8GAAYA+v8AAPr/AwD4//r/AgAAAAAACwDe/wQA0P8CAAAAIwDY/w8AFwDS/w4A+P8FAPH/+f/7//T/CAD2/9H/BwDl/9r/9v8JAOj/3/8VAOb/DQAYAAEACwAaADQA+v8LABoA+P8FAPj/9v/0/+X/CwD6//b/7v8FAAAA+//3/wgAJgDy////+P8FANj/4/8JABgA0f8IACsA+v/4//z/BQD3//n/8v8DAAAA+P8AAPT/FgDx/wAA1//+//H//f/7/9X/KAD2/wYA+P/5/wAAAAD+//r/CQD4/+D/AAD2/yMA0/8FAPv/2P/8//r//P/x/wcA/f////L/+f8IABYA/f8AAOL/4v8FAP7/GwAQAAAAAgDl/woA+/8IAPX/5f8KAPX/HADs/wQAAAAFAPn/7f/8/xQA8f/5/xgA9P/5//f//f8SAPX/8f/G/woA8P/b/+b/9P/V//3/AAAFAAAAEQARAP3/CADl/wEA9P8GAAYAAADo/xIACQADAPz/8//n/zMA8v/5/+z/AgAJAP3/+P/q//v/9f8vABAA+P8LANP/BwAWAO7/+v/7/wAA6P/3/97/CAAXAOP/6f8IAPj/3P8IAPj/GQDw/9f/CgAhAPP/AAD9//r/4/8DABkA7f8KAA0ABgD8//b/+v/1/wMABAAAAPn/AAAaAMz/BQDO/wcA8f/4/wMA4v8NAPj/CgADAAoA/f/6/wAA+P8AAPH/3f8NAPj/BgAAAAAA4P8JAPz//f8GACYAEQD0/woA9f/6//j/CQANAO3//P/6/97/JgACAOX/1v8QAOL/yv8FAAAAAwDc/wwA8f8ZAPT/BgAMANj/CwAYAPP/AADg/wgAGADp/wwACgDi//3/6v/9/wMA9v/4/xIA+P8AAPn/+P/4/xgA7P/6//7/AQDJ/wkA/v8FAPn/GgAVAOj/+P/x//3/wf85AOL/CgD1/wAABADE/x4A+P8FAO7/+P/K/wwAAwDk/xEA8f8VAAMA9f8kAO7//f/6/wYA8f/W/xYA8f8AAAYAAAACAAYAJQC9/xUAxP86ALT/FwAMABIA8//s/wgAGADo//D/+/8hAO7//v/7/wEA+P/x/wAA+P8FAPT/7//+/y0A6P/6//j/9P/u//j/AAAiAOj/6v/4//j/8f/I/0MA4v/5//D/+P8oANX/KACw/x4A9v/8/9L/EwDh/xYADgAJAA4A+/8RAND/EQD+/wMA9P8hAOD/8v8CAOr/GgDi/wAA/v/5//H/AAD5//3/9v/0/zgAEgDo//H/IADt/y0A2P/x/+n/+v8DACIAtP8QAPH/7f8qAKz/EQDp//z/+v/q//j/0P8OAPr/DgD6/wAAPgDd/wAAJQCg/zAA5v8EAMr/HgD4/wgAAgD1/wQA8P8JAPj/AgD4/wAABgD8//z//P/B/1gACADr/zIAxf9CAIr/HAD2//j/+v/C/zAA9v8IAP7/CAD8//r//P/u//X/8v/8/8D/IACy//j/IAAAABAAAABAANz/+f8uAOH/AADo/8T/VADW/wwAzv8mAAAA+P/1/8H/IQDq/wIAKQDl/wgA+f/K/1gA1P/e/ykALgDy/wIA7f/2/+3/5f/J/xIA6f8KAAMABgALACsA4f8LAAEA+v8zAOD/EQCt/00A0P8IAOr/9f/8/+z/DgD7/wMA/v/E/yIA9P8xABIAGwDc/7j/DADq//X/8P/8/wAA/v/8//n/+f8uANT/+f+0/+r/HgAFAA4AxP8zAP7/zP8ZAPj/CwD7/wAACAD2/wgA9f8AAAAABgCY//H/6v/i/wEAAQAZAPj/EQAdABoAfgAQAIgAjAAZAKX/af9j/xz/Kv+l/zEA9P8xAE0AVQBRAEQAUgArABoABAD4/+r/2f/o/9X/zv/g/y0ADAAUACIAaAA2AP3/FQDw/97/tP/Y/97/6f8yACAABgA5ACYAGgDi/8H/AgDC/9H/8P/Z/+H/0P8JAPv/+P8UACMAMQAYAAoAbADW/wgABQDF/9X/xv/z/+H/5f/4/4T/pv8h/y7/If8C/xb/Lf9j/5L/0P8eAEkAxQBRAXsBqQEWAlQCAQLcAe4BcgEJAa0A9f+e//3+ov5h/gb+OP77/fD9/v0E/kr+JP5c/iT+Vv6V/mb+av/4/8QA/gHQApkDCASKBJgE9gNQA7QCswHOAOH/+f6B/s79I/7m/QP+YP6s/jT/Jv8o/wz/CP+0/gb+vf3o/MH8ifxn/B39Iv5z/y8BrwIjBB8F/QVDBpUFnASdAwQChwAr/839Jf1u/Pf8Vv3U/Qn/2P/OAPsA8QCsAPH/W/+u/rD91/w1/Ij7j/tm+8n7D/3Z/vIATwMHBXYGfQfTBy4HrQXSA7sBx/8P/p38GPzq+0z8k/2O/q7/9gDqAXMCWQLiAd8ApP+n/nn9MPys+xH7r/qD+m/6I/ss/WT/7wFTBCEGjgc/CFMIMAdEBTYD+wAZ/2L9Tvz4+/X7vvz7/fj+IwBbASACdAIsAoQBKQAG/zf+Lf1n/Bz8wPt1+1r7RPtE+2H8hv6lAJkC5gTGBgIIWQj3B4UGNQQBAqb/kv3z+zf7c/v/+3H9A/9XAMYB3wJyA0MDogJ9Acf/fv5v/V/80/v9++v7BPw//Az86fsM/H/9w/+PAb8DpAU4BwUIuwfhBswEmwJoAFP+nfxn+2T7CvwY/b3+OABdAbcCYQN6A+oC5gF5AMb+of3b/Cf86vtO/Ij8CP1m/UP9H/3T/JX9mP9KARUDCQV0BlUHLwdVBocEQAIDACL+ofyW+5r7avyE/UX/1ADHAcoCMwP8AnYCUAETAJb+gP0S/dj8Cf2Z/Q3+b/6I/vH9Jf3V+/n6gvu+/eT/YgIRBQ8HVQhICD4HLgWGAuj/Sv3c+936Hft0/OD9HgC+AS4D5APOAzkDBwLxAGv/C/5I/f/8MP2B/TP+i/4R/wL/KP6s/Tv8/fpA+nP7Pf5xAJYDfwZVCD8JfgjtBh4ECwFF/tz72/pt+rv7gP0D/78BGwMyBGAEjwOKAtgAlf/n/bj8hPyZ/CL93P2o/i//sP8r/1X+nv1R/Hf7kPo1+oX75v7nAXIEEQfDCPUI6Af+BSADKADU/Qr8cfu1+xD9Qf8DARoDPQRxBP8DLwLOAAb/w/3t/ET8ZPwP/fj9xf6d/w4AWQD//9H+Cf7u/MP7CPuS+vf6pv0fAUQDxwUMCKUI1QcCBoMDsAC8/jH9jfyx/Kv9n/8lAXwCbQNFA8kCIgGp/43+ef0+/Wr9vP2C/pL/2/8RAFcAyP8z/8L+w/3w/Jn8JPzN+9v7/vtL/VEA5QKqBBAGkweeBzMGaAQLAi4AWP5T/Tf9SP2+/j8AXAFxAr8CjwKIAX0ASv8q/qf96f1J/o7+Bf+B/9X/a/8d/+f+U/4d/vz9oP1s/WL9c/1S/ZD9e/1i/tgAHQOSBDUFhAZ8BigF4AOWAcz/Hf5m/Vj9Xv36/g8AGAH/ASoCCQIkAWYAU/+O/gz+4f22/jr/4/8bACkAqv/U/lH+eP1K/ZX9BP5Y/p3+yP6Y/oH+Uv7C/W/+lwDiAlIEGQVqBkoGKgW8A30BhP/e/VD9Y/2//Sn/IAAoAZoBiAEjAVsAw//S/n7+h/7R/jv/KQDPAPsA5gBtAFf/ff4K/mz9iP3N/TH+df54/lD+5v3u/T/98/y+/aX/dQK+BPwFugbZBlwFrAOQAXL/Ff5g/dz9VP48/7EAOgGTAWUB1QD4/0T/qP5S/or+Hf+w/1wA0wD0AJ0ABgAo/yn+1v2W/Tv9nf3k/e397v3Y/X/9kP14/RD90f3F/hwB2QNTBXgGVwf/Bk8FkgOZAaf/aP4A/nz+zv7Y/24B5gEVAsYB5QDI/8z+SP74/Sj+2P5q/zIAuQCEAPf/gf+V/sP9wP1o/Tn9v/3m/cf90v3Q/YX9lP0Y/gH+A/7f/oD/XgHhA0IF7wXGBqYG/gR4A/ABKgDV/nb+sv6p/oD/uABbAZkBsAGHAX8Apf/9/kv+6v0P/n3+Fv9v/2v/Tf8v/6L+Ff7t/ZD9Zv2u/fD90P3M/fn91f04/uf+9v7n/n3/5/+pAEoDLwWjBdkGbAcCBlUEsgItAVz/dv7N/m/+xv4iAPkAKAHrAD0BdgDI/lj+u/1M/Yn9M/62/kr/uf+V/2D/Qv+1/iX+/f3N/db9Fv5g/mT+Uv5t/lL+AP++/6D/pP8SACwApAD2AvEEJwVQBlgG6AQ7A34BVgDC/sb9XP6P/gn/OABQAUoBvADgAJ3/Ev65/UP9Q/3S/a3+dv8RAI4AUgDy/7P/EP9g/hD+7v36/Vf+cv5g/sr+8P6e/lP/DAC4/7z/LADz/x0APQI7BNQE7gVBBvgETwO1AYgAC/8W/nz+vf4i/w8A6ADYAJEAqAC3/7L+Vv7//cL9Av7P/kL/p/8pAPf/Zv9Y/0H/zf6I/oj+eP5v/gj+2f0W/i/+M/4E/+z/+/8XAD0A1P+Y/9wAMwNPBDMFyAYlBrUEZgOKAcb/Sv4G/kr+Xf44/+H/OQBKAF8ACwD0/nL+Kv6v/dD9b/74/on/CQAQAJr/af8U/87+0v6r/s3+BP/n/oj+fv6C/qH+2v5t/wIA+/8bACAAuP8lAIoBQAMgBCgFDgYcBfMDowLjAGj/TP4z/pX+Gf/r/3MAsQCiAH4Axf/O/iz+tf1i/bb9J/7w/pX/HgA+ABcA1P9P//H+0/6V/qD+sP6X/kf+Sf5W/ob+6/6N/zEAMQBIADgAAQCEAN0BvgOFBEQF7AW4BGgDMAJ8AFL/jv57/vL+Vv/4/8QAkABdADAAf/+r/j3+7/28/fL9aP4A/3b/2/8AAOn/sP89//j+4P6r/rb+yf6g/lz+Rf5Z/of+1f5n//H/v/89/4v/mP/u/1wCwwNnBPMF3AWuBOkDCwKbAGL/f/7N/iv/gP+AALQA3ACnAA0Adv+S/vD91f24/Q3+oP4n/6n/6P/c/9T/YP8F/wf/0P7F/gj/E/+m/rj+m/5I/on+uf4P/4T/U/98/7n/HQBpATID4wPBBF8FfwSjA9UCVgFFAFD/9P4Z/yD/mP8cAEIAbwAxAOz/nv8R/9r+v/6+/vz+Tf9L/3D/UP8c/+z+u/61/r7+vP4I/xf/0v7L/sD+b/5c/nj+q/7p/ij/df8NAPUAIQLQA3MEqgQOBQoECQMuAsEACAA9/87+FP8H/0//8f87AIMAiwBVAPn/k/84/+r+1v7r/tv++/47/z3/Qf9B/zj/FP/3/uD+s/6g/pr+gv5Y/jj+Pv5o/nX+ef4F/8b/wAAwArYDdwQ+Ba4FxwQQBPECYgGHAGf/0/65/pP+CP+h//j/WACBAH0ANwDm/27/EP+5/lX+RP5l/mr+mv7c/gf/HP8m/yT/8f7N/pH+cv4//gD+L/5f/nr+pf4K/7D/dQCQAb0CfwMLBL8EtQToA4sDkQIqAboA6v8w/x//8P4g/4j/sf/Y/wYABQDb/7f/av8j/+/+pf6Q/oH+dP6S/qT+tf7T/ub+8f73/ub+zP7f/s/+y/7z/hH/Wv+4/x0AsABLAeYBggLiAgUDKgMYA4oCLQLZARABswBwANT/tv+Q/1X/kv+i/5H/qv+f/3b/aP8w/+v+3/64/pr+rv62/t7+CP8q/0//Z/+L/4n/kv+V/6P/nf+l/7n/2P/8/x0ASgBoAJwAwwDdAOsA7QD0AAAB9gDWANkAtACWAIkATAA7ACIA9v8GAAIA8f8BAAUA6f/o/77/kv99/1j/Rf9P/0f/UP9q/3D/mP+v/77/zv/a/+P/8v/p/+b/8f/0/w0AGwAmAEkAWwBMAF0AewB2AHcAfQB6AGsAUABAABYADAD7/8z/zP/D/6n/rf+7/8v/xv/O/7f/sf+//6X/pf+s/6b/uP/B/9P/4//o//7/FgAnACsAKwAlACUAFwAbACkALQArADwASAA3AD4APgBCAEQAQAA4ACsAMgAaABgACADt/+j/3//Q/9H/zv/F/9X/0P/T/9H/0P/h/9j/2//Q/8f/v/+0/8D/wf/K/+T/AwAWACQANAA0ADYAOAA2ADMAMgAuACUAIwAnAB4ADQAdABwAHQAeACIAFgASAAkA+P/9/+T/3f/R/8D/tv+v/7X/rv+k/7j/yP/I/9X/0P/R/87/1v/L/8D/yP/L/+b//v8DACcAOQBHAFIAWwBeAGEAZwBqAFoATQBGAEoALgAeAB4AHwAQABIACAD2//T/7f/n/9H/0v/F/7v/uf+7/7j/uP/B/9L/1P/Z//D/+P/y//7/AgD6//L/AQAFAAsAFQAgABcAGgAoACgANAAjACcAGwAFAAMA9v/v/+7/1//e/9r/2P/S/9z/4P/d/+b/6v/c/9b/1P/b/9f/0v/Y/9P/3v/W/9r/4P/o/+7//f8JAA8AGAAiACQAIwAZACUAKgAoACwAMAAsAC4AMwAwACoAIQAgAB8ACAD8//f/8P/j/9//4P/i/9v/z//X/9//3//i/+v/7f/l//j/8f/4/+3/8v/t/+n/4v/r/+X/5f/5//3//f8IABAAGQASAA0AGAAcABMAEQASABoAGQAOAA4ADQATAAUA/f/0//D/6P/k/9z/4P/a/9r/1//g/+P/4P/p/+z/6v/6//v///8EAAAAAAD8//f/7//4//T/6v/4//f/AAAWABgADAARABEACgANAAsAAgAAAAQAEAAPABMAGAASAB4AFQASAAgACgD2//z/+//y/+X/4f/j/+r/5//n//D/6v/r//n//P/r/+v/9//w//j//v/5/wAA+P/7//r/AgD9////BQD0/wcAFgD+////AwAIABcAEQAMAAcADgANAAoACwAIAAgAAAD+//r/8f/s//H/+P/r//b/7P/w//f/7//n//H/9//n/+//9f/4//b/8//+/wIA+//5//X/BwD+//b/BgALAP3//f/5//r/BAABAAIAAAAMAP7//v8DAPn/8P/z//j/8P/r//H/5P/e//X/5v/o/+H/8v/+//f/9P/7/wAABAACAAUAAgAJAAEABAAMAP3/9v8PABQA+//1/wMAFwAJAPL//f8JABMACwD9/wsAGAD4/+D/+P8MAPv/6//0//T/5f/W//H/9f/x/+j/7f/2//v/+P/5//n/AQAEAPD/6v8OAA0A9P8AAA8A/f/+/wQAAgALAA4AFwAPAPj/6v8GAA0A8//3/xYAAwDs/+///f8DAPf/8v/4/wQA+v/5//3/5f/g/+//9P/6//j/CAACAJ4AawDa/sj+oAAhAaT/If88AK8A3v9w/xIAwwAdAGf/0P9SAA8A7P/4//n/4f/2/xQA+f/nAJMAoP6g/sUA0QBE/0L/HQBgANL/uv/gANwAmf9o/wQARwBo/yv/qv/U/8f/yv+y/wQAQAAsABUAIwBLADYAEgASACMAEgABAAkAEAAJAFYAOwD3/wYAGwAJAAIA+//x/wYADAD3/+3/9//+/+j/8f9wABYAuv8CADUA6P+3//3/9v/K/8X/ZQAXACQAeQCyAIIAp/9w/wgAEQBZ/9/+PP/J/5v/+P5C/2IAZwC0/yIA0gBrALb/agBZABEAc//9/z4AxP80/+T/5ABr//z/fQBJAAYADABrADkAMwDw/w8AGwBWAF//N/+vABwANv/S/5kAIADp/1EAngBIAKr/8P9SAPf/eP9g/77/+v+T/zj/OABAAIEAKv+Q/w4BKwBS/8D/gACf/3b/9f8vAPP/bf8N/4ABDACI/zMAqAC6ACD/LgC7AEIAnv/I/wEAdQCC/zb/hQBGAN//2v9aADsA8/8DABIAJgDc/97/HABt/ywAMgDy/xoAP/9OAGAAWABj/xgAFQFw/7H/rP+dAGz/DAATACsAEQDj/0gA5f+hAGj//v/dAKP/hf/p/50A7P9j/w4APwCT/9b/9v8KAI7/LwCF/7UAaf8CACcAFgCR/y4ACgDo/y0As/8nACIAOABu/wIAQgDI//j/6/8uAE4ARP9GACoAKgCB//j/zP/y/yEAtf87ACwA6f9I/yEBhv/t//j/YACY/8r/VADe/ygAxv99/0MABQBo/zwAWgAQAKb/1v/SAAr/AwDP/7cAiv/C/24AMQAeAAoAx/+nAK//yP+l/6AAAACn/6X/uABY/2kArf9aAPz/4f8rAOX/SQDm/zoA3v9rAO7/lv9SAAgA3P+C/28Ajf8bANT/GwD+/9b/MQB0/4gAl/82AFv/YQAeANn/qP9qAI7/twCl/+H/DgCPALj/LwDD/xQA2v/x/wIAYwC3/93/KQByAJT/AQAfAHkAmf/u/wUA8v/v/8H/AgBvAHj/5f8IAPD/8P+I/1AAr//x//f/DQDD/8T/lwC+/8D/AADx/wAATQBT/8X/fwAMAGwAt//w////FgCm/2kAFwAGAB8ACgAaAHv/+P9XACAAsP/0/9r/WQDy/wEAFAD+/7X/9P8WAM3/iQCf/6P/OgA/AMz/7f/m/0gA6v/V/0IA0P/4/47/XQAjAKr/uv8jAAYAxP/P/2EAu//Q/w8AEgDS/+r/DwBlALn/+v8gAN3/5v9oAN3/AwCY/4UA0P/2/+n/KAD1/+//IACV/1AAuP8cAAUADQDs//D/BAD8/xsANwDb//H/TADE//P/+P93AEn/hACu//z/7//m/wcA4f+f/zkA/v98/24Azv95AJ//IwCF/08A6P+g/2gASf+PADAAav9HAPr/m/9YAAYAZAC5/wwA8P8GAA8A//8MAOj/EwDw/wgAHgDs/0QA1//D/yQArP9yALT/MAAmAKj/PADN/xsA7v/e/xEA/P/c/w4A+P8eALT/IQDI/xYAyP/6/1AA2//G/2MAif9DAAgAv/8yALP/EwADABkAIwDo//P/GADy/7z/CAD7/xIAAAAtADv/OQADANT/RwDY/zUA4P9iAKz/GQD2/wIAGAA2AIf/BAAbAPj/HgALAPD/5v9SAJj/UAC4/1EAs/9aAMD/AwC+/4AAm/8kANn/5P8YAOX/BwDe/xcA1P8HAOj/+P/x//r/EQAmAA4A4P/9//z//v/7//T/2/+//y8ArP9DAMr/CAA2AM//DADb/w4A8v/H/+T/JQAIAPn/AgD9/wcAAgD7/xMAJQDD/ygAIgDT/w8ALADX/+z/6f9MAKf/RADO/xcAKwDR/wUAMQAgAMT/yv9mAKn/OwCg/9H/TAD4/+H/4P8eAPn/5//+/wsA+//d/wAACADw/woA9//U/yUA5P8DAOP/LQDb//b/KADj/xUA2v+//yQA9v/1/+P/JAD2/+b/NQDL/yUA6v/9/7b/SgCv/zQAEQDs//n/IgC2/wwABQAwAO//BwDt//X////x/8j/IQD//wcAAAD9/8b/6v9UAMz/FAAAAPf/8f84AMb/UwDO/0kAx/9WANz/8v/z/+n/yP9gAMz/4v8WAOL/8/8+AM7/7f8FANv/+v8NACcA0P9oAKb//f/2//f/5v/A/0oAz/8mANb/CgC7/9X/FwAIACsA3v8wAG3/jADS/yAA8v/q/wwABwALAPf/BAD3//T/6f8FACAA6P/0/+j/9v/3/wEAEQD5/14Ayv/8/7//QQDu/8D/EADu/wgA3f8VAMr/7P8LAEAA6//8//n/5P8oALr/GgDw//T/8/8CAAgA9//2//j/CAAWAMn/SADg////9P8BAMX/CAADAAkAIADo/xAA8f8oAMn//f8oABYADwDX/wEA9v/P//v/yP8GAOz/AgDC/0wA9/8PAAAA+v/3/y8AAQD2////8f/1////+f/6/wQA6v8AAAMAAQD7//7/zf87ABgA+//A/0EA4f/3//f/KwD//yAA9f8tAOj/0P/S/xsA+f+4/8j/+P///+z/wf8BACAA2v85AO//YADN/wAA8//o/wEA3/////D//P/x/wsA//8GABEA+//u/1kAc/8jADYA5//h/+7/AADr/9r/DAADAPb/9f9XAJX/JABFAJv/HgAzAKf/AAAIAPT/9v8QAOb/DAAAAO7////6//v/BAD7/73/6/8YAP7//v8XAM//VQDr//r/1v8fAAAAIgD6/yAA3/8AAO//7f/z/+v/7/8JAMv/FgAHAPL/CQANAAcAzv/v/xAA7f8FABIAAwDL/1gA7P/u/xIACAD0/+f/0/8QAP3/LQDw/wMAwv8YAAAA0P8TAP7/6P8JAAkA+P/9/zkA2f/0/zQA0P/9/9X/1P8SAC4A1/8EAEwA2v/4////5//8//X/7P8gAPL//v/y/wUA1v8GABMA1v+7/1cA3f/h/0AA0f/y/ywAFgDK//H/BAD0//f/3P/j/xAAAwD7/wsA/f/h/1IAtv/L/zMA3//p//v/6P/O/zQAHQDo/zUA7//z/xgA7v/k/xMAw//7/+T//v+v//b/NwDu//r/PAD8/wUAQQDo//P/FgDg/+7/3P8DAPn//v/q/+n/DAD7/yEA2//4//v/IADa/97/CgDe/wUACAD9/wMAPwAtAPv/IgD4/+z/AAAVAAsA6v/8/9L/6/8AAOb/8/8AAOz/7/8zAML/JgAOANr/OADp/+3//P/3/+T/+P/4/wkA4//5/0AAEAACAP3/9f/5//T/+P/6/xQA7//J/+7/8f/q//D/FQDQ/wgAGwDU/yIACAC5/x8AIADh/wcA+v8EAAAA/P/f/+L/+P8bABIAAwAmAE8ADgABADYA4f/s/8P/if+o/+X/1P/I/8z/CQAQAEoAMADw/y0AIQDx//z/4f/X/8r//f+x/+j/DQD7/xgAEAAOABIAGgAdABEABgAMAAoA+f8HANP/GgD7//r/HQDs/wwA+f/r/xsAAQDj/+7/CwDe/wkABADQ/wcA7v8DAAcA9/8BAAcA9f/V/+z/+P/t/wAA/v/Y////MADo//r/DgDR//b/8P8PAPL/9f/l/+z/+P/i//v///8ZAPz/5v8cABYAAQAAAAAA8f/8//L/5v/7//f/+P8NAPT//P8GAAsA/f/2/xkA7//W//3/9P/s//b/AAANAA4A6P8FABYA+/8BAAIA+P8PAAEA7v8JAPv/+P/2/wYACAAGABQABQAAAP7/7v/x/+n/4//q/wkA9//v//3/CgD2/xMABgD0/wcA9/8OAAcA6P/y//X/AAAQAPj/7/8GAPr/CAD7//T/+f/2/wUAAQDm//j//f8FAAsA9//y//j/+P8IAAIAAwD9//j/+P/s//H/9P/7//H/7f/4/wAA+v/y//j/RwDE/xEA7//0//7/9/8FADwABQDg/0cA2v/C/ywAqf8GAJH/KwAFAPT/+//6/w0A+f9HAHj/QgDV/w8ACADs/wUAQwDI/8L/JQDz/xAAIADI/9D/HQDr/w8A8P8AABMA9f/6//b///8AAKn/KwDs/w0ATQB9/1IAJQDQ/1gAp/8TAO//KwDY/wUA9v8IAPL/8P8TAD0AvP+//ysAlf/3/xcA/P/M/yoA/v9jAMD/BQD9/+v/CACs/0wA9v8CAAgADgAOAPr/AgACAPr/6f9HAML/DwDp/6z/OADg/8//OADo/xoArv8qAP7/AQDu/wgACgD4//f//f8KAD0AwP8IAAMA+P/x/+n/FQD+/zkAx/8IAKD/5//i/ygAAgARAL3/PAD1/0gA1f8EAAAALABt/+v/IgD1/xUA7/9RAMj/zP8yAPL/CQD1//L/DABCAML/VACy//3//f/t/wUApf+DALj/FADp/wAAAgCk/zEA8P8FAO///P8CAP3/+v9IAML/uP95ALf/4f8gADIA3f+y/zMAAAD4/+v/wP89AOL/DwACAPr/RAC5/wcA9f/9//3/OQDF/8X/JADp/2YAwP9KALT//P/s/wAAAgDu/wYA/v/B/yQABQC7/zgA6P/V//j/cgDU/8D/GQD9/xIAof84AO3//f8CAPr/CACq/0AA+P8EAPj/AAAKAPb/AAAGAAMA+P/9/wIAtP81AAEACwBHALb/CQCl/zQA8v8AAAYA+P/5//n/DgD6//r/8v8GAPj/AgADAAEASADD/xEA7f/6/wUApf/p/+X/6v8/APz/DQBQAHn/gwCz/wgA7v/i/xYAOACC/0oA4v8AAFEArP90AIH/LgCI/yUA6v/2/1QAyP9pALv/IwDe/9n/sf8gACgA2/8uAPL/AwD6//n/+P/4/zgAvP8MAPL/+/8AAO3/RgDN/wIA5f/1//v/8P/t/+3/+P+8/ysA4P8UAPr/sP9DAC4A1v9jALr/EAD2/+L/7//n//r/9v/5/wIACgCp/20Apf9cAMj/wf86AAkA1/8FAOb/BQBOAHb/TADK/wEAyf8lADQA2/9lAL7/JADi/+n/+P/t//r/7v9BANX/IADy/0EAyP8BAOf/MADK//z/7v/v/wAA4/+w/3sAtf8WAPT/8f8KAJb/MwC1/zMA8P/X/1EA6v8YAAEAsP/9/xUA8f8dAPD/v/9KACEAzf8WAO///P/8/6r/OwDq/wgAEwAMAAoA/f8DAFAAvP8VAPb/qP9BACkA2/9iALD/HQDw//P/9//o/6r/QADp/woAt/8sAAEACAD6/////v/y/////P8NAK3//P94AMv/HQDm/8r/9P8jAP7/CQDu//v/vv98AL7/HADa/7b/PwDh/xgA+f+3/z4AAAAQAP3//f8JAAAA/P8HAPX/PwC//wIA6/8DAFEAt/9YAKj//v/n/wYAQgC1////5v9TAL//VQCg/xcAHQC7/10AmP8EAOj////z//j/5/9DAMD/wv8zAOT/x/8zAEAAz/8AAPH/EwD0//T/WAC5/7b/JQDv/xIA7P/q/wMAQwDB/w0A4v///0sAbP9QACIA1P/+/zEAx/8GAN7/uv9DANr/0/81APX/IgAKAPj//v/m//z/AQD4//7/AAABALT/OQDw/wMA9P/9//f/r/+QALb/FwCk/58AuP9cAAEA0f/w/+P/GAAAAA4A6f/+/wsA9P8QAPX/+v8CAPv/CgD6//z/+//4//H/8v////j/9P/w/+v/7f/x//j/9//1//v/AADy/+7/5//1//v/+P8AAPj//f/7//j/7v/t/wAAAwADAPX/AgAAAPv/CAAJAAMAAQD2//L//P8EAP7////9//n/+P8AAAsAAAD5/wAABQADAAMAAgAEAA8A/v/3////DgAGAAAA8f/4//n/7//4/wMA/P/4//L/9P/z/+7/7//u/+7/9//1//j/+f/u//H//f/8//3/+//4//j//v8BAP7/+//9//j/+P/8/+//8//4//n/8f/9//j/7v/5//v/9P/v/wEA/v8BAAEAAQD2//r/BwAEAAEA+f/6/wcA+/8BAAkAAwD7//3/CQAFAPf/+P/9/wIAAwANAPn/9v///wAAAAD+//D/+v8DAPP/8P/4//j//P/4//j/+f/1//j//f/4//H/+P/9//X/8//u//r/AQD0/+7//P/4//T/9P/2/wgA/v8BAPX/9v/z/wAA9f/y//z/9v/z/+7/+P/+/wAA8f8HAAAABQAAAAAABgAGAAAAAAAAAAAAAAAIAAMA/P/1//n/AAAAAP//+v////n/+f////b//P8BAP3/AwAIAP7/CQAIAPn//f8JAAYABgALAAAAAwABAPb/+f8AAAAAAAAAAP//8v/y/wIAAwADAAYABQD6/wAABgAGAAAAAAAAAPn/+f8GAAwA+f/y/wAABgAAAAAABQD6/wUADQADAPX/+f8FAAAAAAABAPP/+P8AAAUA+f/z/wEA/f/9/wkAAgD3/wgAAwACAAIAAwAFAAAAAAAGAAAA+v8LAAAA+f///wAAAAD///n/BQAAAPr///8AAAUAAAAAAPn/AAAAAAAAAAAAAAAAAAAFAPr/BQAAAAAABQAAAAAAAAAGAAAAAAAAAAAA+f8GAAYA/f////P/+P/y//z/AgADAAkAAAD8/woADAD5//n////5/wAAAAD9/wwABwAGAAUA+v8FAAAA///5/wUAAwD5//n/BgAJAPb/+P/5//n/+f////3/AgD8//z/AwAJAAIAAwAMAAAAAAAAAPn/AAAGAAYABgAAAAAA+f8AAAAAAAAAAAAABgAAAPn////5/wAAAAD5//j/9v8CAAMACQACAPb/AgAJAAcADAAAAAAABgAGAPz/+f8GAAMA/P/8//z//f8IAPb/9f8CAPz/8v/5/wAA+f////n//f8QAAYA+f8AAAAA+f8AAAAAAAAAAAAA+f8AAAYAAAD4//n/DAAFAPn/AAAMAAYA/f/5/wAA+f/4/wAA8v/1/wIACQADAAIAAgAAAAAAAAD5/wYABgAAAPn/AAD5////+f8DAAYA+f8AAAYAAAAGAAYAAAAGAAkA/P/1//z/AwACAPz//P/1//n/AAAGAAAA+f8AAAAA+f8AAAYA+f/5/wYABgAGAAYAAAAAAAkA/P/1/wAAAAD///L/AAAAAPL/AgAGAAAA+v8GAAUA+f8AAAAA+f8FAAAA+P8AAPn/BQD5//z//P8CAAMAAwACAAMABgAAAAAABgAGAPn/+f8GAAAAAAAAAAAAAAD5/wAA+f/5//z//P8CAAMAAgD8//z/AgADAAIAAwANAAAAAAAGAAAABgAAAAAABgD8//n/+f/5/wYADQD8//L/AAAAAAAAAAAAAAAAAAAAAAAA+f/y//z/EAANAPL/+f8UAA0AAgD9//z/AgD1//z//P/5/wAAAAAAAAAAAAD5/wAABgD5/wYABgD5/wAAAAAGAAAA+f/y//z/AgD8//z/AgAKAA0ABgAAAAAAAAAGAPn/+f8GAAAA+f8AAAYAAAAAAAAABgAAAAAAAADy/wAABgAGAAYA8v/5/wYA+f/4//X/AgAJAAAA/P/8/wIACQAGAAAA+f/8/wUA+f8AABMABgACAAIA9f/5/wUAAgD9//z//P8CAPz/9f8AAPn/+f8AAPn/+f8AAPz/AwANAAAA+f8AAPn/AgAGAAYABgAAAAYAAwD8//z/AgD8//X/+f8AAAAABgAAAPn/AAAAAPn/+f8GAPn/BgAAAPn/BgAAAAAABgAGAPn/AAAGAPn/BgD5//n/DQAAAAYA+f/5/w0AAAAAAAYA/P8AAAIA/P/5/wAAAAAAAAAAAADx//n/BgAAAPL/AgAKAAAA+f8CAAMAAAAGAAAABgAAAPL/BgAAAPn/BgAAAAAAAAAAAAAA+f8AAAYA+f8AAAYA+f8AAAYA+f/5/wAA+f8AAPz//P8CAPz/AwAJAPz/CQAUAAYAAAD5/wYAAAD5/wYAAAAAAPn/AAAAAPL/AAD5//z/AwAGAPn//P/8//z/CgAJAAAADAAUAP3//f/9//X/AAAGAPz/+f8AAPn/BgAAAPn/AAD5/wAAAAAAAAYA8v8AAAAAAAAAAPn/BgANAPn/+f8GAAAAAAD5/wAABgAAAPn/AAAGAAAAAAAGAAYAAgD1//n/DQADAPz//P/8//z/+f/5/w0AAAD5/wAA+f8GAAAA8v8AAAAA9f8CAAMAAwACAPX/CQANAPn/AAAGAAAAAAAAAAYAAAD5/wAABgAAAAAAAAD4/wAAAAAGAPn/AAD5/wAABgD5//n/AAAAAPn/BgD5/wAA/P8DAAIA/P8DAAkABgAGAAYABgAJAPz/AwACAO7/9f8AAPn/AAAAAAAA+f/5/wAA+f8AAPX//P8KAAMA/P8JAA0ADQAGAPz//P8AAAMA/P/8//z/+f8GAAAA+f8AAAAAAAD5/wAA+f8AAAAA+f8AAAAAAAD5/wMAAwD8/wIAAwAGAAYAAAAGAAAA+f8AAAAA8v8AAA0AAAANAAAA8v8AAAYA8v/y/wMA/P8DAAMAAgADAPz/AgAKAAYABgD5//n/BgAAAAYA+f8AAAYAAAD5/wYAAAD5/wAAAAAAAPn/AAD5/wAA+f8CAA0A+f/5//z/AwACAAIAAAAAAAAA+f8DAAYAAAAGAAYA+P8GAAAAAAAAAPL/AAAGAAYAAAD5/wAABgAAAPn/BgAGAAAAAAD5/wAA+f/5/wYAAAD5/wAAAAAAAAAA+f8AAAYAAAAAAAYABgAGAPn/AAAAAAAAAAAAAAYAAAAAAAAABgD8//L/AAAAAAAAAAAGAAYAAAAAAAYA/P8AAAMA/P/y//L/9f8DAAMA/P8QAAAA+f8DAPz/AwAJAAYAAAAGAAYAAAAFAAMA9f8AAAIA/f8DAPb/+f/4//n/+f8AAPz/AwADAAMABgAAAAAAAAD5/wAADQAAAAAAAAD5/wAABgAAAAYA+f8GAAkA9f/5/wAAAAD5/wAAAAD5//L//P/8/wIAAgADAAoAAwAAAAAAAAAAAAAABgAGAAAAAAAAAAAADQADAPX//P8DAAMA9f/8//z/+f8GAPn/BgAAAPL/+f8AAPn/BQAGAAAAAAAAAAYABgD5//n/AAAGAA0A+f8AAAAAAAAAAPn/BgAGAAAABgADAPX/+f8AAAAAAAAAAAAADQD5//n/+f/y/wkA+f8DAPz/9f8JAAoABgD5/wMAFAAGAAMA/P/8/wMA/P/y/wYAAAAAAAAAAAAGAPz/AAAAAPL/AAAAAPL/BgAAAPL/AwAKAPn/AwADAAAABgAAAAAABgAAAAAAAAAMAAIA9f8AAAAABQACAPz//P/1/wAAAAAAAPn/+f8AAAYAAADr//z//P/8/xAA/P8DAPz/AgAKAAMABgAAAAAABgANAAMA8v/5/wAAAAAAAAAAAAAGAAYA8v8GAAAA8v8GAAAA+f8AAAAA+f8GAAAA+f8GAAAAAAANAAYACQD8//X/AgD8//z/9f/5/wYABgD5/wYAAAD5/wAABgAFAPn/AAAAAPn/BgD5//n/AAAAAPn/BgD5//X/CQADAAMABgANAA0A+f/5/wYAAAAJAPz//P/1/wAA+f/5/w0A+f/5/wYAAADy//n/BgAGAPn/+f8GAPn//P8CAAYAAAD5/wMADQAAAPL/AAAAAAYADQAGAPn/AAAAAPL/AAAGAAAAAAD5/wAA+f/1/wMAAwACAAMAAgD8/w0ABgDy/wAAAAAGAAYA+f8AABQAAwDu/wAAAAAAAAAA+f/5/wYABgD5/wAAAAAGAAYAAAADAAMA/P/8//z//P/5/wAABgD5//L/8v8KAPz//P8DAAoAAAAGAAAABgAGAPn/AAAAAA0A+f/5/wAADQACAPz/+f8GAAMA9f/y//L/AAAGAAAAAAAAAAYA+f/y/wYAAAAAAAAAAAANAPn/+f8AAA0ABgDy/wUABgDx/wYADAADAPX/+P8GAAAAAgD5/+v/+f8DAAYAAAAGAAYA8v/5/wYAAAAGAAYA+f/5/w0ABgD5/wAAAAAAAAYABgD8//n/+f8AAAAAAAAGAAAAAAAAAPn/+f/5/wAABgAAAPn/BgAAAAYAAAAAAAAAAAAAAAYAAAAAAAAA+f/5/wAABgAAAPn/BgAGAAAAAAAAAPn/DQACAP3/CQD2//z/AwD1//3/AAADAPz/8v/y//b//P8DAAMA9f8JABEA9f8CABAADQD5//L/DQAGAAAA+f8AAAYAAAD5/wAADQAAAPn/BgAGAPz/+f/5/wAADQD5/wAA+f/y/wAA/P8DAA0ABgD5/wYABgD5/wAABgD5/wYA+f/5/wYAAAAAAA0AAAAAAAMA/P/8//z/AwD1//n/AAD5//L/AwAGAPn/AAAGAAAA+f8AAAAA+f8CAAIAAAAAAAAA9f8KAAYA+f8GAAYAAAAAAAYA+f/5/wYABgD5//n/+f8AAAAA+f8AAAAAAAANAAAAAAD5/wYADQAJAPX//P8DAPz/AgD1//X/+f8GAAYA8v/5/wYABgAAAAAAAAAGAAAAAAAAAAAAAAAGAAAA+f/5//n/BgD5/wAA+f/8//z/AwADAAkABgD5/wAAAAAAAAAAAAAAAAwAAADy/wAAAAD5/wAABgAAAAAAAAAAAPn/AAAAAPn//P/8/woAAAD8/wMABgAAAPn/BgAAAAAAAAD5/wYABgAGAAYA/P/8/wIAAgD8//z/9f/y/wAAAAAAAAYA8v/y/wYABgAGAAAA+f/5/wYAAAD5/wAADQAAAAYABgADAPz/9f/5/wAABgD5/wYABgD5/wAAAAD4/wAAAAD5/wAAAADy/wIAAgD9/wMAAwD8/wMAEQAGAAAABgANAPn/AAAAAAAABgD8//n/AAAAAPn/+f/5//X/9f8CAAMA/P8JAAMAAwAJAAAAAAAGAAAA+f/5/wAABgAAAPn/9f/8/xAA+f8DAAYAAAAAAAAAAAAAAPn/+f/8/woADQAAAPn/AAAAAAYA+f/5/wYAAAD5/wYAAAD4/wYAAAD5/wAA+f/1/wMAAwACAAIA/f/8/wMACQAGAPn/AAAGAAYABgAGAPz/AwD1/wAAAwD8//z/+f/5/wAAAAD5//n/AAAGAAAAAAAGAAYAAAAAAAYAAAADAAMA9f/8/wMA/P/y/wYAAAAAAAAA+f8AAPn/AAD5//X//P8KAAIA/P8KAAMA9f8CAAoAAwD8/wMADQAAAAAADQAGAPz/+P8AAAUA+f/x/wAABgDx/wAADAD5//j/BgAAAPL//P8DAA0AAAAAAAAA+f8AAAAAAAAAAAAAAAAAAAYAAAAAAAYAAAD5//n/AAAAAAAABgAGAAAA+f8GAAAA8v8AAAYAAADy//n//P8CAPz/9f8DAPz/AwAQAAMABgAAAAYAAAAGAAYA+f8GAAAAAAAGAAoA9f/8/wMA9f/8//n/AAAAAPj/AAAAAPn/+P/9/wYA+P/8/wIA/P/9/wkACQD8/wMAAwANAA0AAAD5/wAAAAAAAAYABgD8//n/AAD5/wAA+f/y//z/AgADAAMAAwD8/wMACgAAAAAAAAAAAA0ABgDy/w0ABgD5//n/+f8AAAAAAAAAAAYABgAAAPn/AAD5/wAABgD5/wAABgAAAPn/+f8AAAYABgDy//n/AAAAAAAABgAAAPL/AgAGAAYABgAAAAAAAAAAAAAAAAAGAAAA+f/y/wAABgAGAAAAAAAAAPn/AAANAAAA+f8AAPn/+f8AAPn/9f8CAAMAAwACAAIAAwADAA0AAAAAAAAAAAAAAAAABgAAAAAAAAD5//L/AAAGAPn/+f8GAAAA+f/8/wMA/P8CAAkABgD5/wAADQAGAPn/8v8NAAYABgD8//z//P/5/wAADAD9//b/+f8AAAAAAAAAAAYAAADy/wAA+f/1/wMAAwAKAAAA/P8DAAYAAAD5/wYABgAGAAAA+f8GAAYA+f/5/wAABgD5/wYADQD8//n/AAAGAPz/AAAAAPn/BgAAAAYA+f/5/wYABgD5/wAAAADy/wYABgD5/wAAAAAAAPn/AAANAAYA+f8AAAYACQADAPz/AwD8//z/9f8DAPz/8v8AAPj/AADx//z/AwD9//3/AwADAAIAAgAKAPz/9f8JAAoA/P8JAA0AAAAAAAAABgAJAPz/9f8AAAAA8v/y/wAABgAAAPn/+f8DAAYA+f8AAAAABgAAAPL/AwAAAAAAAAAGAAYAAAD5/wAABgAAAAAAAAD5/wYABgAAAAYA+f/5/wYABgD5//L/AAAAAPn/9f8DAAIA/P8JAAYAAAAGAAYA+f8AAAAA+P8AAAYAAAAAAAAAAAAFAAYAAADx/wAABgAAAAAAAAAAAAAA+f/5//n//P/8/wMAAwAKAAAAAAAAAAYABgDy/w0ABgAAAAAAAAAAAAYAAwADAAMA/P/8//z//P/u/wAAAAD5/wAA+f8AAAAAAAD5/wAAAAD5/wIAAwAGAPn//P8DAAIA/P8KAAYAAAAGAPn/BgANAAAAAAAAAPn/BgAAAAUA/P/9/wIA9f/4/wAA8f/5/wAA/P8CAAYAAAAAAAAA+f8AAAYAAAAAAAYAAAAAAAAADQADAPz//P/8//z//P/8//n/AAAAAPn/AAANAAAA8v/5/wYAAAD5/wAA+f/8//z/AwAKAPX/AwADAAMAEAAGAAAAAAAGAAYAAwD8//z//P/8//z/AAADAAoA9f/u/wAAAAD5//L/BgD5//3/AgACAPz/AwAJAP3/AwADAAIAAAAMAAAA8v8AAAYABgAGAAAAAAAAAAYAAgD8//L/8v8AAPn//P8CAAYAAAD1//z/CgAGAPn//P8DAAkABgAGAPn/AAAGAAAA+f8GAAAAAAD5//n/AAD5/wAABgAAAAAAAAAGAAYAAAAAAAAAAAAAAPL/+f8AAAAAAAAGAAYABgD5//L/BgANAPn/8f/1/wkABQAAAAAA+f8AAAAAAAAAAPn/AAAGAAAAAAAGAAYAAAAAAAAA+f8AAAYA+f/5/wAA+f8AAAAABgAAAPL/BgAAAPn/AAAGAAYAAAAAAAAABgD5//n/AAAAAAAAAAAAAPn/+f/8//z/CQAGAPn/AAAAAAAABgAAAAAABgAAAAAAAAAAAAAAAAD5/wYA+f8AAA0AAAAAAAYA/P/8/wMA9f/5/wAAAAAAAPn/AAAGAAAA+f/5/wYAAAD5//X/AgAUAPn/+f/8/wMAAgAAAAYAAAAAAAAAAAAAAA0ACQDu//n/DQACAPX/AAACAPn/+f8AAAYAAAAAAAAAAAAAAPn/+f8AAPn//P/8//z/EQAGAAAADQAGAAMACQDu/wMAAwD1//n/8v8AAAAA+f/5/wMAAAD8/w0AAAAAAAYADQADAPX/AAAAAPn/8f/5/+7/9f8DAPv/AgAKAAMACQAQAAYADQAKAPz/AgACAPz/AwD1/+7/+f/5//n/+f8AAAAA+f8NAAAAAAD5//n/AAAAAAAABgAAAPL/AwANAA0A+f8AAAAA8v/y/wkAAAANAPn/8v8GAAYA+f8GAAYAAAAAAAAABgD5//L/+f/1//X/AwAKAAMACQANAA0AAwADAPz/9v/9/wAA+P8AAPj/+f/5/wAABgD5//n/AwADAAYABgAGAAYAAAAAAPn/AAAAAPL/+f/1/wMA/P/8/wIAAwAQAAYA+f8GAAYAAAAAAAAA8v8AAAYA+f8AAAAAAAAAAAYAAAD5//n/AAD5/wAAAAD5/wMA/P8DAAoAAAAGAA0A+f8GAAYAAgAKAPz/9f/8//X/+f/5//L//P/8//z/AwAJAAMAAwAGAAUABgAAAAAAAAAAAPn/8f8AAAwA+f/5/wAAAAAAAAYABgD5//n/BgAAAAAABgAAAAAABgACAPz/AwAKAPz/AwADAPX//P/1//z/8v/y//n/AwD1/+7/AgADAPz/CgAJAAkAFAAGAAAA+f8NAAoAAgD8//z//P8KAAIA5//y//n/+f/5//z//P8DAPz/AwAKAAMAAwD8/wIACgAAAAAABgAAAAYABgDy/wAAAAAAAAAABgAAAPn/AAAGAA0A/P/5/wAA+f8AAAAA+f/y//z/AgD8//z//P8CAAMA/P8KAAIA/P8DAAoADQAGAAAAAAAGAPn/8v/5/wAAAAAAAAYA+f/5//z//P8KAA0AAAAAAA0A+f/5/wAA+f8GAAAA+f/5//n//P8DAAMA/P/8/wMACgAGAAAABgAGABAA7v/r/w0ABQAAAPj/BgAGAP3/+f8AAPn/AAAAAPL/9f8DAAMA/P/8/wMAAwD8/wkACgAAAAYADQAGAAMAAgD1//X/+f8AAAAAAAD5/wAAAAAAAAAA8v8GAA0ABgAAAAAABgD8//n/8v/5//n/9f/8/wMAAgAJAAoABgAGAAYAAAAAAAYA+f/5//n/AAAAAAAAAAD5/wAAAAAAAAYABgAAAPn/BgAGAPj/8v/x/wkA7v/1//z/AAAAAAAABgANAAoAAwARABQADQD8/wMA/P/1//z//P/5//n/+f/5/wAAAAD5/wAAAAAGAA0A+f/y//n//P/1//X/AwAKAAIAAgD8/wMACgANAAAAAAD5/wYABgAAAAYAAAAAAPL/+f8AAPn/AAAGAPn/AAANAAAAAAAAAPn/+f/5/wAAAAAAAAYAAAD5/wAAAAAAAAAAAAANAAAA+f8GAPn/AAD4/wAA+P8AAAAABgD4//j/DQAGAPn/AAAAAPn/AAAAAAcA+f/5/wYAAAD5/wAA///4//v/+/8JAPv//P8KAAMABwAHAAcABwALAAMA/P/u//j/BQD+//D/8P/7//z/AwALAA4AAQABAAcAAAAAAPj/+P///wQA9//3//j/9f/1/woAEQAEAAAAAAAIAAcADgAKAAIA/P/1//z/+//0/+v/+P8AAPX//P8KAAoAAAAAAAAA+f8DAAYA+f8AAPz//P8CAAkAAADu//z/EQANAAYABgAGAAoAAwD8/+7/+f8AAPn/AAD5//n/+f/1//X//P8CABAAAgADAAMACgAUAAoAAwADAPz/AgAJAAAA8f/u/+7/5/8AAAAA9f/8/wMACgADAAMA/P8DAA0AAAAGAAUAAAAFAPH/+f8AAPn/BQAAAAAAAAAGAAYABgD8/wAAAwDy//n/BgAAAAAA+f/4/wYAAADy/wYAAAAAAA0AEQD8//X/AwADAPz//P8CAPX/9f8AAPH/6v/8/wIA9f8KAAoAAwADAAoADQAAAAYACQD8//X/AAD4/wAAAAD5//n/AAAGAAYAAAD5/wAAAAD5/wYAAAAAAAYAAAD5/xQA/P/4/wkA9f/y//n/+P/8/wMABwD5/wMADgD6/w4AEQADAAMA/P/8//z/7f/4//H/8f/0//z/AgACAPz/AwAKAAoABwAOABUA/f8DAP3//P8JAAkA+P/0/+3/+//7//j////x//L/AwADAAMAAwADAAAAAAAHAAAA+f8AAAYAAAAAAPH/AgD///z//P8CAAkABgAAAAAADQAAAAAADQADAPz/AgD0/+7/8f/u//v/9f/4/wUABgADABEAAwD9/woADgAOAAYA/P8CAPH/+P////j///////j/9P/8/wkA/P/1/woAAwAKAAcABwAAAPr/AAAHAAAA+f8AAAUA///4////+P/4//v//P/1/wkACgD9/wMAAwAOAA4ABwD9//3/AwAKAPX//P8CAPz/AgD0//T/+//q/+7/CQACAPb//f8DAAoACgD9/wIADQAGAAAABQAGAAoA9P/1//j/+f8AAPn/+f8AAAAABgANAAYA+f8AAAYAAwD1//n/+f/y/wIABgAAAAAAAAD4/wAA9f/8/woACgAGAAYABgAGAAAA+f8AAPL/+f8AAPn/BgAAAPn/AAAAAAAABgAAAAAAAADy/wYABgD5//L/AwADAPz/CgAAAPn//P8JAAAABgAAAAAABgAAAAAA+P8AAAYA8v8AAAUABgAGAAAAAAAAAAAA+f8AAPL/AAD5//X/AgADAAMA/P8DAAkA/P8DAA0ABgAAAPn/AAAGAAAAAAAGAPn/AAD5/wAABgAAAPn/AAAGAAAAAAAGAAAAAAD5//n/AAAAAAAA+f8AAAAAAAD5//z/CQAAAPn/BgAAAPL/AwAGAPn/BgAGAPn/BgAAAAYAEQADAP3/7v/5/wYA+f/y/wAA8v/u/wIACgADAAIA/P8JAAoAAAAGAA0AAAAAAPL/8v8AAPz//P/8//X//P8JAAMAAwAQAAAADQANAAMAAwD8/wMACgD1//z/9f/1//z/+f/y//L//P/u/wMACQD8//z/CgAJAAoADQAAAA0AAwACAAMAEQAAAPL/7v/n//n/AAAAAPn/8v8DAPz/9f8DABEA/f/9/wkAAwADAAYAAAAAAAYA+P8AAAwA+f/y/wAAAAD5/wYAAAD5/wAADQAGAPn/AAAAAAAA+f/y/wAADQAAAOv//P8JAAMABgD5/wAAAAAGAAYAAAAAAAAABgAAAAoA9f8CAAMA9f8CAPz//P8CAPz//P/1//n/AAAAAAAA+f/5//n/AgAGAAYABgD5/wAABgAAAPn/BgAGAPn/+f8AAAYA+f8FAAYAAAAGAAAA+P8AAAAA+f/4/wYABgD5/wAA8v/8/wMACQAAAAYABgAAAAYAAAAAAAAA8v8AAAAA+f/5//z/AwAJAAAA+f/8/woA/P/8/wkABgAGAAAAAAAAAAAAAAD5/wAABgD5/wAADQD5/wAAAADr/wMABgDy/wMABgD5/wMAAAAAAPz/AwADAPz/DQAAAAYAAAAAAA0AAwADAAIA/P/8/+7/+f8AAPj/+f/x/wIABgAAAAAAAAD5//X/9f8KAAkACQANAAYABgAKAPz/9f8CAAoA/P/u//z//P/5/wAA+f8AAAYADQDy//n/AADy//z/AgADAAMADQAAAAAAAAD5/w0AAAD5//n/AAANAAAAAAAAAPn/+f8GAAYA+f8AAAYABgD5/wYAAAAAAPn/+f/5/wAA+f/8//z/9f8CAA8ADAAAAAAADAAQAAMAAgD1//X/9v/5/wYAAwD8//n/8v/5/wYA+f/5//z//P8DAAIACQACAAYAAAAGAA0AAwD8//z//P/5//n/+f8GAPn/8f/4//j/9f/7//v/9P/7/wIABgD5/w0ABgAGAAkA/P/8/wMAAwD8//z/9f/1//n/8v/y//X/AwD8//z/AwD8/woACgADABEAHAACAAUA/f8CAAMA/f8CAPX/7v/5//n/+f/4/wAAAAAAAPj/+P/4//7/BQD4//H//v/4//7/9P/q//7//v/4//H/6v/q//T/AgD6//T/+v8FAAUA+P/4/+n//v/+//j/+P/4//H/6v/x//v/+P/4//j//v8FAPH/+P/4/+v//P/1//z/AwD8/woACgAJAAYAAAAGABQAAwD8/wMAAwDu//z/AgDu//n/AADy/wAA+f/9/wMA/P8JAAYA+P8AAA0ABgAGAAAAAwADAPz/9f/5/wYAAAD5/wAAAAD5//n/BgAGAAAAAAAAAAYABgAAAPn/AAD5//n/AAAAAAAA+f/8/wYA+f8GAAYAAAAAAAAAAAD5//n//P8DAPz/AwADAAkABgAAAAAAAAAGAA0ACgD8//z/AwD8/+7/+f/5//n/+f/1/+7/AAAQAAIA/P/9/wIACQAQABMAAAAAAAYAAwADAPz/9f/8//z//P/5//L/+f8AAPn/AgD7//7//v/4//j/+P/4//j/+P/4//H/BgAAAPH/+P/4//7//v/x//7/BQD0//T/9P/0//H/8f/x/+r/+v/0//z/AgACABAAFAD5/wYABgD8/woAAgD8//X//P/8//X/AADy//n/9f/1/wMAAwAJAAMACQAMAAYA+f8AAAYABgADAPz//f/4/wYA+f/5//n/8v/8//z/CgD8/wMACgANAAAA+f/5/wAABgAAAPn/+f8GAAAABgAAAAAABgD5/wYADQD8//z//P/8//n/AAAAAPL/8v8CAPz/9f/8/wIAAwD8/wMAAwAKABEADQANAAMAEQAAAPX//P/8/+7/8v/y//n/9f/1/woAAwADAAMA/P/9/wIADwAGAAAAAAAAAAAA+f/5/wYAAADx/wYABgD5/wAABgANAAMA9f8DAAMACgD8//X//P/8/wIA9f/1//n/AAAAAAAA+f8AAAAAAAAGAPj/BQD4/+r/8f/4/+r/+v/6//T/+v/6//r/+/8FAAUA/v/x/wUACQD0//v/9P/t//T/5v/q//H/6v/t//T/9P/x//7//v8JAAkA/v8FAPj////7//T/+/8DAPz/+//6/+z//f/+//b/+P8AAA4ACAACAAIABQAFAP7//P8CAPP/7//2/+7//P/o//P/AgD1/wcAAAD6/wAABwD8//3/9f/x/wwACADp//7//v/3////AAAAAAAABwAPAAsA/v/3//7/CwADAOf/+P/3//b/7P/s/wQAAQACAPn/AAAWABMAEwAJABYAEgAKAP//7//u/+r/+P/q/+T/5//p//P/9P/9//3/BAAFAAUADAAMAAEAAQAAAPn/AgAFAPf/9v/3//z//f/4//H/+P/w/wAA+f////j/+P8AAPj//v/u//7/AgD6//n/9P/1/wMADAADAAoACgAKAAkABAD8//L/+f/m/+X/7//2//f/7v///wAAFwAgAAwABgANAB0AFQAFAAAA///9//T/8//p/+H/7f/u//L/+/8DAAMABQAEAAUADQAKAAMACwAQAAUA/f/7//n/+P/m//T//P8AAAEA/f8FAP7///8DAAoAAgAAAAIA+f/q/+H/5P/6//v/7v/z/wMAEwADAAsACwAXAA8ABwAJAPP/9P/5/+n/6v/q/+r/4//o/+r/8f/4/xAAEgAQABEAGAAUABIADQAEAPv/8v/w//b/6//c/+f/4v/9//f/+P8PAAkACgAOAAcADgAUAAgABwD4//f/BQDv/+7/9f/n//z//f/w//H/AAD5//r/+v/5/wYA+P/3/+//5//m//D//v/x//P/AgAAAPr//P8EABMADwAOAAwAAAD3//X/8P/u/+7/6v/c//f/8f/0/wUA9/8IABkADQAUAB8ABwAGAPr/8//4//3/9f/n//L/9P/u//n/CwAFAP7/CwATAAQACgAXAP7//f/6//L/6v/m/+b/9P/t/+v/9P/7//z//f8MAAIA+v/0//z/BQD///b/7f/u/+D/BgD1/+P/HAALAPz/PAABABIAGgDm/x4A1//H/wsAyv/q/9r/tv/s//H/9P/y//H/CwAAACcALAAYAEEALgA+AC8A+P8lAPT/+P8HAOb/5//M/9L/8//H/9z/7P/l//7/+/8LAAoAAwARABcAFQAEAAcADwALAP7//v/+/+j/8v/y//P/7//x//D/8P/x//D/9P/p//7/+v/k//7/7//v/wYA9//4/wAADgAPAPr/CQAQAAEACQAIAAcA/v/4//j/9//2//D/7//8////8P8AAAYA8v8IAAAA+f8AAPn/+v/+/wUA9//n/+7//f/2//7/8f/t/wMAAwAFAPr/AQAIAPL/BgD4//f//v/o/+//9v/2//f/+P/4//j/+P8JAP//8f/+//7/IQApADgALAAUAAoA/P/l/+j/0v/B/8n/tf+u/5z/of+5/9r/AAAkAGAAoAC9ANoA9QAEAegAxgCQADoACQDd/2z//P6b/lP+Cf4A/gb+HP5p/qH+6f5c/8r/KAChABgBjQH+AXwC+wJIA1gDSAMIA5ACCAJmAaYA9v9C/4r+6/18/f78ifwt/PH74PvO+9H7EvyI/Bj9oP2m/tj/yADoAQkDEAQOBdAFWAaxBqAGVgbABQEF9gPdArsBQwAE/9L9sfzE+8X6Ffql+VH5OPle+cb5Mvrh+jD72fue/Jn99P6FAK4BQAOwBNgFzgaQB/EHAAi4ByEHVgZQBRgEkAIgAZj/fv5I/Vj8tfsb+7v6xfoC+zz77fvI/G79Kv6+/mf/g/+8/8r/af8//x3/UP+r/zIAkwBrAScCyAJsA+oDQARcBFAEAwSTAxgDWAKHAZ8Ap/8n/4v+5f2Q/S/92PzQ/MP8q/zp/An9Cv0h/Rb9Jv0U/Tv9X/2+/Yn+Sv8mAEYBXAJiA1YEDwWlBdUFxwVzBd0EEwQXA/cBwACO/7D+wP33/H78APy9+7v75PsQ/KT8CP1b/cX9Jv5i/m7+eP5V/nD+kf7s/rT/ZwAyAUECUwNCBBsFygUuBjcGHQajBeUE+APiAqwBZgAo/0b+eP28/Ev83fu5+9T7+Ps1/K/8A/02/XD9lP2p/Z39tf2l/bz9G/6N/mX/UwBaAXkCfgOSBHIFGAZyBoUGlAbmBRsFFATYAo0BMwAP//79Sf14/AL8rvuB+437wPvu+0v8tfz1/Cf9Q/1Q/UP9Of08/az99/25/rr/zQAjAi0DbQRlBWAG+wZVB0YH5AYsBjkFBgSvAkIBBQDE/sn99/w7/Lf7WPsn+yr7Xfu2+yL8dfzI/AX9LP1E/VD9Vf2o/ef9Pv74/uv/8QAkAh8DOQQcBecFdQa6BqcGSwahBbYEqANgAhgB8//a/uX9I/2A/BD8rfue+6f7z/so/Hz8z/wL/T39Uf1O/Sf9//wv/XX9xP2E/nf/rwD3ASADVgRcBUgG2wYiBx0HywYOBhEF6gOEAi0B3v+6/rf9xvwh/Kn7WPte+4T7yfse/JX8A/1U/ZT9sv2//cD9tf3o/S/+lP5S/zEAZAFYAmIDewRIBQcGaAZ1BkIG0gUNBQAExwJ3ASoA+/76/QX9RPzV+4z7YPuQ+977QPyx/EX9p/3n/Sr+Mv4a/vH92/3u/Q/+cP47/ygAKQE7AngDgQRmBSgGfQaXBnEG6gUQBScE7wK9AX0AXP9Y/lL9kvzs+3v7WPto+5L72PtH/Jf88PxH/WT9bv1a/UP9WP15/eD9jf5r/6UA2gEVA0EERQU1BrIG9gbwBo0G2QXoBMoDhAJRASAA//7f/Rj9Vvy1+2b7SPtO+3D70vsh/Gf8vvzy/Bz9Ov0z/UX9dP3O/X3+N/9PAIABlwKtA9AEswVkBrcG2Aa0Bh4GWAVhBDED7QGmAHX/U/5f/af8A/yS+3L7b/uI+9P7Rfyl/PP8Qv1r/Yj9lv14/Yn9zP0n/rH+ff+iAM0BzQLkA+4EpwVIBpEGcwY1BpIFtQSsA3kCOgEgABf/CP5e/aL8GPyr+7D7xvvb+z38s/wX/Vv9oP3C/c39sP2O/aD95P1H/tT+tf/uAB8CAQMrBGwFLAZrBpIGiAbyBTQFKATcAr4BmABh/2b+kf29/BD8uPuS+4z7tvv6+1j8svwU/V79i/2Y/XH9Wv1+/bz9K/7Q/tn/LAEbAhoDYgRwBfkFUQaoBpAGGAZTBYMEYQPkAcgAtv+h/sr99vxA/Lj7eft8+4f7uPsY/Jf8AP1r/cD94/37/b79ff2L/a79Ef5o/tL/gAEJAwgEYQWVBu0GYAdwB0QHcAZyBTMEkAIcAbH/cP5Y/Uj83vt3+2j7pPsE/Hz89vyG/fP93v22/Xr9O/2t/E38rfxq/bz+hf8QASAD/ANiBOAEdQU3BfgE0ASHBOQDMgN4AkoBDwAa/0j+pP3g/Iv8ovzN/EH9sf0q/pb+7P7T/pj+//12/ej8Uvxc+3D7uPy+/qMAMQIGBEEFawV4BaMFgwUBBTIEkwOoAooBbAAw/0j+rP09/Qb9xPzx/Fb9wv1v/hX/gv/l/wsAlP/2/hT+GP3a+7D6Gvnu+Hn6Ev3d/xoCDQQHBr0GXQdOBxMHBAdLBv4E8AKJAVwANP/D/Rj9wvzR/KL8IP3t/dD+qv9hANYABAGfAK//ov6Q/U/87fqt+br4x/il+i/9JABEAggErAVDBoAGGwahBacFHwXHAwkC5QAwAGH/Ov67/bD92P2y/ej9Av8RANMAFgElAQkBjQBm/1j+ZP17/Gb7Vvqv+bX5pvuf/hYC8gOoBCsFbAVrBcMEFATfA50DQAJGAB//9v7W/g3+hv2x/SX+UP56/tX/gAFwAjsCoQH3AFMAPv/R/cD89vsp+yf6X/lU+VD7jP5wAsYE6wTvBPEEKQXHBBoEtQNtAxMCDACG/nT+3v5v/ob9XP0A/mP+l/6I/1gBDQLNAeEAYwAQADX/EP5x/S/9J/y9+qr5nPlT+4L+RAKDBHsEDgQoBNUE8gQoBOEDqAO/ArkAJv/p/kT/5/7b/XT93v00/kn+tf43AGIBqwH4AEAA1/9F/1f+pP2R/dj8avso+lH5K/o//dMAbwTzBH4EEwRoBCgFjgRWBMsD3ALvAC7/Hv+5/w8A5P4f/kH+ef6F/oL+xf8BAVIBvQDs/5//df/R/ur9sv2d/Zv8UPsS+tD5GfyM/1ADRgVOBJYDDwM7BFIEmgMkA2MCswHo/+T+Nv8RABsAgP6k/aH9mf5I/+v/AQGmAYABTAAn/8j+tv5M/rP9c/2d/M/7qPpm+dj6e/4FA/QF7gSGA8gC5wPCBN4DLwNvAj0C8QAW/8b+hP9kAFf/qP0A/eH9Nv/h/4gAMwF9ASwB6P8M/9v++v6M/ij+c/1v/K77Nfoq+tn8tQD1BFMFtgNyArACYAR6BL0DrAIFAkIBeP+H/tb+/v8vANr+df0s/Tb+Nv9KADsBwQG5AbsAiv/j/vT+2P5w/oL9Y/yu+9H68fnL+0H/twOqBSQEkAIpAlgE7ARFBDsClgFVAa4AK/+o/kf/EAB+/7P95/yS/Vv/uQBSAWYBDQGkAMH/A//I/rj+mv7X/dz81ftC+1/6SftO/mYCYAWMBIACYQEtAyUFYgV6A+8BVQFcAX0ALv8S/1z/ff8Q/tT8vvwz/jUAPwGOAfgAsAA6ALr/Xf/8/rf+sv2o/GH7D/u0+r76r/wzACkEUAWtA8IBUgKnBC0GywRSAusA+QD+APz/KP8O/23/FP+o/ej8n/2l/zEBsgHuADEA9//n/6//LP+L/vX9Of1E/C37vPpO+lD8yf/5A1UF/AP6Ae4B5wNxBQEF0QI9AbsA6ABHAFz/EP8p/xj/Gv5B/Zf9iv9gATECeAFUABwAMwAcAFz/cv6Q/RL9SPww+3H6zvll+/z+LwO6BM4D6gH5Aa8DRAUQBT0DuwHpAOAAKQC5/4b/uP9Y/0L+Wf2q/Yv/PAEOAmABVgDI/7b/1P+A/+T+Bf5q/Xf8f/vZ+lD6VfuE/lcCrQQRBFAC0QFOA/kEWAXXAw8C6wDlAJcA6/9s/2P/YP+p/nb9L/2C/l8AmQFwAWcAl/93/7T/q/84/1H+jf3C/PP7RvuW+hv71v2gAZUESATHAuIBNQMxBYIF+AO+AaEAqADUABAAKP/F/tL+uv5q/cr8nv3J/+gBJgINAZf/X/+9/yEAmv+F/nr9w/wW/GD7z/qu+jL92ACdBLcE/wKlAbICrwR/BXgEZQIiAcEA8AArAH7/HP/z/rv+lf3n/Gn9Xf9hAUICYQEiAG7/n//4/9b/BP8H/mf9tPwQ/H/7EPvO+13+HALLBB0EUQLNARsDrATUBIgDtQHOAM0AjADx/4n/N/8b/0v+Vv1G/Y/+UACsAW4BVgCY/6P/QQAbAIT/N/6A/dP8M/yq+wP7IPsN/eQAjwRRBT8D0AFTAk0ECgUYBOABkAC4ABgBvgDz/xz/x/5x/qf9Sf3Q/XX/JgG0AeIAz/8s/7z/EgDe/9j+r/3y/Eb88/sk+6v6APyQ/8IDawWtA30BdAFgA2YFOAVNA1gBrABFASMBYQBA/6D+cP7d/Tf9If1U/kMAvQF6ATMAHv88/9z/EQB2/1H+lP0n/d/8Ofwm+yn7cv1GAa8E2gSPAj8B9QGLBP8FCAW2As8AlQAGAb0A2f/h/nv+D/5h/ef8kP1Q/14BHgL2AKL/Df/P/08A8v+x/rP9Of3K/E78Vvty+pX7fv54AvYEXgSYAhECMAMpBZ8FAQToAYQAhwBdABsAU/+7/l/+6P1i/af9tf6BANwBoAF2AJf/mv8aAA4ASv9A/rv9Sf3Y/MT7f/qA+uX8pQD4A5MEzgK9AZIChwTwBdIEoQLvAKEAEQHGAOb/+f6v/oz+H/6F/bX94/6vAMsBRAEMAF7/s/8IAMf/2P67/Tn98Pyr/Nn72voQ+2797QDOAzkE0AI3AjUDywRPBegDIQIAAeoA8gBJAIv/Ev/d/pD+wf2l/UX+oP8IAYABsgDa/8n/AgDo/xX/0v0Y/Tn9Hv2//Lv7w/qq+wj/8wLzBO4D6gHxAcgDiwUaBdQCGgGFAPMA2ADw/yn/+P79/pz+4P3K/Z3+kQDEAZIBJABu/5//BgDe/wD/2P0k/Qr9qfwq/Bb7q/rB/IkAIwTiBDYDxQGYApQE6QWnBFwCyACEAO8AgQDW/1D/Gv+C/q/9Jf2i/UL/CAGXAb0Aq/+C/7H/AACu/+f++f1z/ez8cfyw+6n6dvsX/voBeQQABDwCzgFnAzYFagV0A4MBwAA9AS0BXwCV/zv/DP9D/m39KP0R/v7/TwE8ARUAjf+7//T/5/9u/7f+E/67/R39kfye+y/7Xvwg/2EC5gNIAxcCegLqAw0FqAQRA5gB4ADfAGQA2f9z/3D/9P4R/nH9oP3U/mEAKgHEAOn/vv/i/9P/Uf+w/vb9mf15/Qr9Q/wQ+9T6n/wIACkD8QMPA4ICwQP+BIcFUQTgAtkBbAEIAer/Qv9G/6P/xv5+/fL8wv2Y/xoBNAFRAO3/NgBmAPT/Cv8z/sL9lP0I/TX8Pful+r77nv7/AZcDIAMwAsUCTgQtBeAEXQM3Ap0BoAHMAK//P/+B/2P/IP4h/SH9h/5QAE4B/wAxANr/6f/s/3H/wf4F/p79Bf1Z/HT70vob+379aQD5Aj8DtALkAiYEJQUHBQ4ErgI4AtoBZQEPAEz/Sv9c/23+IP3U/LX9m//tAAsBPgDx/woAIwDD/y//j/4l/p/9AP3T+/76XPrT+8P+vAFkAwkD/gK3A/MEBAWYBI4D3AKSAuMBzQCr/5//r//5/s39zPwZ/cf9dv+8/yYA1P9IAMn/sP9k/2H/LP90/v/98vw+/Fj7SPs6/eH/IwKyAm8CtgKpA8UEVwTaA8ACUQKxAekA//+Z/wUAkP/S/mP9Lv2O/dj+4P9tAG4AWQAzALL/a/9e/zD/0v7l/Vj9D/27/M/7gPs0/fP/WgIuAwYDVgMtBN4ESAR3A7YCKwKsAaEAHQDb//n/SP8h/k/9QP0i/iP/GQCBAKEAfwAcAKX/Z/81/w3/gf4h/nv9Cf0Z/Fr7PvtK/fz/LgLxAvcCOQPQA04EIQSmAzYDSwKFAWUADgARABEAR/8U/ov9oP16/kr/JwDfAAsBAAF3AOD/i/9b/w//b/7o/S/9z/zT+yP7SvuR/YEAjgK/ApcCMANEBJ0EIQSqA2UDfAJaASIA8P8EANj/4f6//W39qP1v/jn/TAC4AL4AXgA0AAUA7v93//f+9P1o/ej8hvyc+wT7sfso/hcBuAIDA0cD1AMoBOoDbANEA88C5wGKAKD/Yv+P/03/lf7//aj96P1t/n7/gwDxAM8AiwCIACYAwv8//8z+J/7J/fz8U/xh++H61PvF/o4B4QIeA6ADSQR2BEUE9wPmA1QDUgK9AM//if+m/yb/Uv6v/fr8Wv39/dX/owAfAaoAtQCKAPL/gP/e/oj+6v1Y/RD8y/uW+wz8Dv2r/9oBCANMA9UDPAQmBNMDuANQA5cCYQEyALj/sP9l//r+iP4i/rT98/2x/ggAmQC4AIIAmQBhAML/U//2/pj+0/0J/fD7t/tQ+377LP3p/w8C3gKTAxYEbQRQBFAEXQS4A7ECkQGRAOv/kf8q/9D+XP7K/Wz91v3q/ioAzgDtAMYAtAAHAGj/6P6V/jX+kP30/LP7Sful+gn8cP7SADQCBAOnA9EDGQRCBFUEIgQ1A1kCFgFiANv/hP8o/6/+IP6M/b/9j/5w/yoAvQBJARABSQCx/0j/8P6A/i7+pf1o/Cb7tPol+3z92f9+AagCWwPvA+wDZgREBJwE+wNKAxUC7AA2AHH/Bv+A/g7+cP1M/cf9Mf5Q//j/JAFFAdgAQADC/2T/8f6h/jX+0fwd/Jv6wvqu+3X+6P8KAgMD4AMLBEYEaASABHkEuAPXAmQBhQDa/2X/Av8x/oX96/xa/Y79r/6m/7MAVgH6AKAABwC7/zT/Bv+Y/pz9lvz++jj64voU/ef+SQE8AmYDrwNHBDMEjwSYBDsEhQNPAlQBjgDr/3r/Av/m/WP9RP1n/Rr+M/81AAsBAgG9AFIA8f+X/1P/+P4k/ij9oftk+rz6T/wS/icA8gEeA64DwAMRBP4DQAQeBKMDiAJpAagAIwBV/5r/qf45/rr9kP3B/Xz+i/9iALcAkQBjAKD/P//3/rD+Nv6i/Yr8Pftb+/H8+f3u/8IB7gLQAwAEewRXBGkEQQSMA+IC5gEAAfb/bf/U/jH+lP1o/Qr9Vf0s/hv/IwC7AM4AvQAOAH//Lv+9/lD+qP29/Gj7Pfua/KL9aP9SAZMCVQPiA1UEaARwBIgE2AMbA0oCOgENAG7/z/4M/nL9Ov3w/C39Gf6c/hQAlwD2APsAfQB2ABD/P/9t/qj9t/yQ++n7HfzD/Qn/8gA/AjcD4gMgBHkEfwRUBMwDSwN+AloBWwCd/83+4f3Y/Qv92/xK/Yr9Jv6R/+P/hABvALMAGQBG/6L/f/4M/kr9Q/zq+4D8qf3B/h0BCgK7A6sDQwRHBEwEYATsA6cDqwL+AfIA7v8S/wr+x/3L/N388/xU/Q7+SP+q/1oAgQCoAD0AoP+u/7D+Ov6N/VT8kPt2/CL9Sv6iAJUBGgNSA+kDIQQ2BIkEKwS+A94C9wHeADgAVv+R/sr9av0G/dr8KP2x/bX+N//c/xgARwAKAJf/w/8A/5P+t/2A/Nj7QPyG/Z3+kwCKAfsCUgPcA20EbwTDBHgE0wPtAhwCAwFVAGn/rf7F/VD94vy4/Pv8k/2F/gj/sP/9/0oAKADL/5//C/9o/m79qPzY+2z8ef3k/msA2QEIA7EDFwSIBIgEzgQwBOQD6gIoAi0BggCg/7z+/v2O/QX9yvwJ/Z79jv4U/8r/IABPAPr/uv9P/5L+u/3r/P/7v/sN/Wf9eP8TASACeQMUBHYEVATkBIAE9wPTA/0CIAIZAX4AGP+F/u/9d/0b/UP9KP3o/XH+/P6N////5v+H/2f/xP7w/Ub9jfxu+4v85/yb/RYA4wAtAngD6wNdBNIEzAQXBOYDQwNeApoB2gCg/9r+VP6e/R39Wf0A/an9hf6o/mb/4f/r/+f/v/9x/73+G/5//Sr8gPxB/Tj9YP+vAKkBzgLAA/ADmAT4BG8ELwTRA/0CCQJiASYA/P5w/rf9+PwZ/Rj99fw0/lL+If+V//b//P/H/7b/Ef9S/pT9R/wT/ND8wfx2/hkA2ABmAjgDugNwBNEEfgR2BA0ESgOSAtABswDT/8z+O/5W/QL9Cv26/KD92v2Y/j//3f8gAOn/IQBn/+f+8P0a/VL8v/z+/DD+0f+aACYC6wKcA1oEjQSIBHUEFQRzAxYDGAJCAXgARv+n/uz9Q/08/fb8aP3C/U7+yP5a/7r/cP+6/+j+8f6a/fD8I/w5/LH8pv1T//D/6AGOAoADeAS5BNQE1QR2BLgDdQPFAnMBnADm/1z+G/48/ef8zfwj/W79+/2f/g3/q/+F/7L/Mf/8/tX9Gv10/Lz8OP1I/tn/YgACArACUQM2BHEEdQRzBC4EfAPDAlMC3QD8/4j/Mv7k/YD9Gv0V/Yv92/0Q/r7+CP9d/13/Vv8E/37+oP2n/CH8uPwD/V/+2P+FAP8B2wLFA1AE6AQjBfsE9QRJBFwD0wJfASgAif9Y/sL9Uv37/Nn8Uv25/dr9i/4J/zn/Vv9Z/xL/f/7A/bD8L/wo/R39Of9lALMArwL/At8DQwSRBKQEWwRuBG8DHANsAvkAKQCC/xf+n/1I/bz84fxN/YD9wP1u/rD+zv4I/+/+sP4n/ov9b/zg/Cv9zv0IAGQAeQEEA1YDQwSgBJcEkgRMBAMEOAOzAhUC1wAbAID/Qf7J/XL93/wF/Vz9jP3V/Vn+p/7j/gr/rf5//vP9Tv27/Pz8iP0h/vP/jQBtAScDYANLBK8EkQR/BFYE6AMdA7wCmAFcAOr/oP4G/pP9Cv3d/Cf9gP2I/SX+gv7q/jP/CP/6/o/+7v0q/QL9gP3A/T//TgAAAXoCAAPGA1MEUQRTBG0ENgSjA0IDfAI/AYgAnv+Z/ir+if0Z/RL9SP1V/ZT9+P0+/oz+ov6Y/mz+Ff6Q/Qz9Xf2e/S7+cf8fAOsA+QGWAkoD2APCAxAEMQTbA5gDDAMfAkABmADw/z3/1/5a/vj90/3K/cj9r/3S/RH+Nv4w/if+Bf6o/UX95Pzz/Eb90v3D/qT/mADCAaMClgNeBKQEBwVOBTcF2AQwBE4DTAJdAWMAe/+u/vn9eP0d/dv8svyu/OP8AP0M/Q39B/3j/K/8qfzE/FD9Fv4y/zYAIgE6AvoC2gNnBLoECAUuBQgFjwT2AysDIAI8AWIAfP/A/iP+kv0o/bv8k/yN/Ln8E/03/WX9kP16/WD9L/06/aL9Q/4b/wIA4gDQAbMCjQNABLgEFAVQBTYFygQxBEADHgIYAVAAjf/U/lD+wP1V/fD8svyr/MD8/vwh/Ur9cP0t/fD8tvyq/BP9rf2j/qD/iwC1AbsCnwNwBNQEOgVzBVoFPgWmBLgDtgKVAboA3v8V/3D+yf0+/dX8kPx0/JD8zvwI/Uf9g/1R/Rz97vzq/Ev94/3f/ub/5AD5AesCvANpBMgEEwUmBQkF3QQ6BGUDUAIdAUwAa/+r/gD+X/38/I/8XPxW/Hz8zPwM/U/9kP1p/Tn9Ev0C/Wn9CP4S/xYAHgE9Ag0D6QOUBOkEPQVEBR4FywQUBB8DAALcAP7/JP9p/sD9OP3M/IL8Yvx2/Kv86Pwq/Xb9mf18/VL9O/1l/dP9gf5+/3IAYQFgAhoD8gOYBPMERwUzBRcFqgTqA+YCwQGqAL//2v4J/mP93PyJ/F38Tvx1/MP8Gv1w/aH9n/2E/VP9SP2A/Q/+4P7h/9QA0QGcAlYDAgRwBNIE9gT6BMgEGQQ8AzECOAFRAIH/q/72/XT9Bf2x/Jz8rfzY/B39WP2U/Yj9YP1J/Sj9Zf3o/bT+pf+EAIQBUAILA9MDYATDBAgFIAULBXYEnwOrAqcBvgDS/+T+Gf59/fr8nfxm/GX8gvyw/Ov8KP0v/Sj9E/0P/Vv9yf2C/m//XwBdAWACNwPqA3oE6gQUBRoF9wSABKcD2ALYAfQADwAg/1L+i/3+/I78W/xi/Hr8rfzo/Eb9b/15/YT9iP3b/U7+3/6i/4AAYAEgAtcCcwMFBE8EfQSBBHkECARGA5gCsgHrABwANf+B/tj9SP3c/K/8ovy2/Oz8Jf1f/XT9fv13/Yz96f1A/vb+sP+AAFcBDwK1AjIDvwMKBC0ENgQoBLADEwN6AqIBvwD0/zH/gP7f/V39BP3f/Lb8rvzQ/PH8Gf1F/XP9i/3V/TT+pv5a/xgA1wCUATgCxwI1A5cDzAPRA9IDtwNJA70CIAJmAZkA3/8v/4r++v2Q/UD9IP0Q/RP9MP1U/YT9t/3O/cn96P00/pT+S/8jAOEAmwFHAsUCOAOdA+AD0QPVA8IDUAO2AgoCQQFqAKj/AP9c/tD9Y/0n/QD96Pzq/AL9Lv1M/ZP9r/23/ej9Ov6s/mj/PgASAbYBUwLYAjYDhQOQA7QDnAOAAz4DsQIBAksBjgDF/y7/tP4u/rD9Zf1B/Tj9LP08/W39lv3Q/QP+Lv5G/ob+7f5+/zkACAG2AUcCtQISAzwDSgM7Az0D5wKRAgwCkgH5AGEAMACF//j+L/6N/Q79g/yN/I78s/zg/CT9fP2a/RT+qf5b/yAAIwH6AZUCEgMtA1wDTwMxA9EChwJlAtIBWQG2ACYAgP/T/oD+h/5V/v/97/0P/g7+xf0a/j/+Kf4L/j3+bP5B/pj+X//7/5MAXAE6Aq8CygITA0gDLQPkApMCWAIeAn0B/gBgAI//2v4n/uj9tf2f/aL94P0g/hb+VP59/ln+Z/6I/oX+hP7j/p7/OgDMAKsBYAJ4AoYCowLIAoACVwI3AukBbwHyAIAAFQBD/8D+kv4U/rz9vf3Q/cn99f02/lL+Rv5K/oT+dv5z/vb+pf+GAA0BAgKGAuQC1gK8AskCZAIsAvcBsQGMASgBkAAhAHz/pf4+/tX9a/1j/XH91v0g/mX+gf6q/oj+if6s/tr+hP8xAAkBrgFgArwC4ALEAn4CbwIUAuQBewFGAQQBawDx/3T/5/5I/gL+4v2v/bj99P1I/o/+lv7D/tf+3P7c/hD/P/+b/xMAtwAoAZEB+gEiAhwCEALyAcgBkAFkAT8B2wCgAD4A3v9Y//T+q/5o/lH+Sv6I/rT+3/4A/yv/Of8T/zD/O/96/7H/HgCCAPgAOgFfAWcBWQFdATgBOwEiAesA3gC6AIEAIAD4/6n/UP8F//T+5/7A/tj+4P4i/zT/Sf87/1j/WP9B/2L/jf/J/wAAUACNAMgAEgEEAQwBBgH1ANEAuQDYAKgAqABZAEwABADB/3P/Vv9o/zz/S/8w/3f/i/+Y/3v/Zv94/0j/Yf9Z/6D/y/8AAD0AdADFAMkA0gDMANIAqgCbAJUAkQCBAFwALQD6/9j/rP9//2T/T/9H/0T/d/+X/6n/of+1/8n/zP/N/+P/8P8CABwAPQBaAHkAhACMAJQAkgB7AF4AQABFAEgAKAASAPL/7f+7/57/i/96/3f/V/+M/43/n/+o/8H/2//S/9P/0v/y/xgAPgBdAG8AigCBAHQAXwBBAB8ADQAFAAUA+P/j/97/2f/B/7H/pv+i/5b/oP+1/7P/yf/l//T/+P8NABMAHwAlADEAMQA5AEYASgBOAEUASwBFADMAJQD8//b/8P/k/9X/wv+0/7f/uP+y/7r/yv/P/9T/8//z/wYAAQD9/w4AAgAgAA4AHAA4ADQANgAWAB4AFQAAAPD/9//x/9//4P/m/+T/5P/o/+H/4P/y//z//v///wQABgAOABIA9f/y//z/9P/w//3/+v8BAPf/8/8FAAIABwAFAAYACwAiAAkABwAHAAgA+f/2/wQA9v/p/+z/9P/0/+z/9//r//T/8f/1//b/8//7/wIAAwAIAAkA+f8GAAUABQAHAAAAAAD9/woABgD//+3/+P/8/wAA///5//3/BgAPAPn/AAD+/wYA/v/4//L/8P/w//D/4v/m/+//9v/w//b////9/wIACAASAAcADQAYABcABQAHAAgACAD7/+f/5//j/+7/6P/e/+j/6//r/wIA8v/0/wIA//8DABAACAADAPz/BQAAAAMAAQACAP3/AAAAAPH//f8RAAAA9/8BAAAA+v/7/+v/CAD8//D/9v/1/+//AwAMAAEA9/8QAA0AAQAFAPD/7//z//7/9f/4/+v/+f8AAPb///8AAAgACgAAAAkAFAAFAPf/BQD//+T/3f/p//X/7P/j/+3///8NAAEA+/8MAAkA//8CAAgA/v8JAAgA+/8BAP3/BwD+/wcA9P/+//j/+f/j/+z/9//p//z/+P/2//7/BQAIAAAA/P/8//7/+f/1//P/AQDw/+b/+P/0//L/8f/6//b//f8BAPr/AAAJAAYABAD6//L//v/2//7/AwD6//7/9////wEA+P/9/wAAAgD9/wEA8v/o/+3/9f/2//X//f8NAAUADwAIAP//BAD4//v/AQD+/wYAAwD4////+v/4/wMABwAEAAQA+f/y/wAA+P///wAA/v/5//3/CQD9//z/9/8AAPv/DwD7//D/+P/+//j//f8QAPr/AQD2/wgA+v/7////AAD1/wAA/f/3/wQA+P///+//9//7//P/CgACAPP/8f8AAP7/+/8AAPT/6v/z//7/7v/0//b/+//1/wAA+v/1/wAA+P/6/wAA+v/7/wMAAAD//wIABAALAAYA9P/5//3/9v8JAPn//////wAABAAIAAUA9f8AAPj/+f/0//7/9//u//n/8//+//v/8//z//f/AQAGAPf/8v/3//H/+P/w//T////7//r/9/8FAAEA9/8AAP3/9//7//n/+/8BAPn//v///wAAAAAGAAMA+f8AAAAAAAABAPj/AAABAPr/AwACAAUA///7/wAAAQADAP////8AAP/////+//z//f8FAPz/AQAAAPv/AAD4////AQD///3////+/wMAAAAAAAEAAwD7////9/8GAAEAAwD4//n//P/9/wkA7f/v//f/+//6//b/+f/5//z///8CAPf/AwAEAAAAAAD9//z/+v/5/wEA+P/v//z/9v/+/wEAAgAGAAAAAAD4/wMAAQD2//P//P/x//P/CgD7//b/+P/5//P/+/8DAAoA///4//v/AAD0/+v/7P/0//n//f/4////BwAIAAgACAACAAoAAgAHAAgA9f/9//v/7v/3/wAA8v/0//3/8v/z/wEAAgAAAAIAAAAHAP////8BAPr/+v/9//T/+P8AAPn/9P/s//n//P/6//b/9f8KAAMA8f/4//3/9//y/wkA8//v//L/7v/1//j/9//z/wMACAD5/wEABAD9/wsADgD5//f/+f8DAP3/9//6/wAABQD1//j/9v/5/wcA9/8AAAkAAQADAAYACQAQAPn/+v8HAAAA+P/y/wAA/v/z//r/+////wgA/v8CAAAA/f8CAAEABAD4/wAAAAD2/+j/9v/v//D/AAD4//z/+P8CAAsA+f/3/wgA/v/9//z/+/8CAAIA//8KAPv//v8BAPj/CQD8//f/AAD1//j/AwD7/+7/8f8AAP3/9v/u/+f/8//0//f/9P/2//j//P/7//3/+f8CAAgA/f/2//j/7f/y/wIA+//z/+7//f/6//7/AQD9/wQADwAFAAUACQABAP7/+P/4//f/+v/4//P/6P/2//n/8v/0/wIA+v/5//f/AAABAPH///8AAPz/AQAAAPz/AAD//wQA+//2/wEABwD6//j/BAAFAP//9/8GAPv//P8GAPf/AQABAPz/AQABAAcA/P/1//z/AgAAAAEA///+////AAABAPz/CgAAAAQAAgACAAAA+P8HAAQA/f/1/wAAAAD8//f/AwD8//b/AgAFAAIAAQD7//v/BgAAAPv/+v////3/7v/z//j/+//7//L/+v/7//f/7f8BAPb/+f8AAAUA/f8BAAsA//8DAAIACAACAA8ACgD1/wcAFAAIAAcABgD5//b/AQD6//b/8v/1//P/6f/w//j/7v/3//j/+f////f/9f/1//D/8v/5//7////z/+z//v8CAP///f///woABgD3//3////6/wEABwAFAPH//v8DAPf/BAAAAPr/AAAEAAIA/P/8//T/9f8GAPb/6/8AAPb/8v/4//7/8v/4//f/9////+3/9P/4//H/9//5/wIA+v/0//f///8BAPP/+P/8/wAA/P8DAAYABAABAAYAAAD9/wIABgDv/+f//P/4/+b/9P/9//f//P/y//T//P////f/9f/7//j/AAD0//H/+v8BAPn/9//1//z/8v/7//r/+P/2/+//8v/8/wIAAgABAAAA/////wAA+/8CAAAA/v8KAAAA+/8GAAEA/v8BAPr/+v8AAPz/AwD4//j//f8DAAAAAAAEAAEAAAD//wAA+v/8/wYACAD7//7/AgD+////AAAAAAcABQDx/wAA/v/7/woA+f/5/wwABAD///r/+/8IAAQA+P/+/wEABQD+//n/CQAFAAAA/v8AAAEABgD8/wAAAgD8//j//P/8//b/9/8BAAMACgD///j///8KAAAA+/8JAPz/9v8KAP3//v8FAPj/+P/+/wIA8P/+/wMA8v8EAP3/BAD9/wQACAACAAIAAQAIAAcA/P/t/wwA9f/s/wgA9//2//v//v/y//v/9P8IAAEA+v8AAP7//P8AAPn/CgD9//z/8f8EAPn/+P/0/wAABgACAAAA//8AAAwA+//7/w0A/v/+//f/BQAGAPL///8LAP//+v8CAAIAAAAEAAcA9P8AAAIA/f/8/wIA+v/x/wcA///6///////+//z/AQABAAEAAgAJAAEABgD//wUACgD9/wAAAQD9////AAD///b/9//1/woA+f/2/wQA9f/8/wAAAAAIAAAAAAAAAAQA9v///wAAAgD7////CQD8/wQABwD//wUA/f/8/wEA9f/6/wgA8//5/wUA+f8BAPX//v8JAAAA8v8HAAYAAgADAAEACwABAPv/BgADAP//AAD3//j//v/3/wAAAQD7/wAA/////wAAAgD1//7/CAD9//r/AgAIAAIA+f8DAAoA9//7/wQA/f/5/wIABwAJAPr/9v/9/wAA9//9//7/AAAAAAcABgAAAAAABgAAAAYAAwD8/wMA9v/9//n/+P8GAPr/9P/2/wgABAD///n//f8KAAYA+P8LAAQA/v8FAAMABAD9//z/CAABAO///v/+//3//f/q//////8AAPX//v8CAAAAAAABAAMABwABAPn/AQAJAAMAAAABAPr/AAAAAAAAAAAAAPn/DAD//wAADgDz//P/BgD///7///8AAPr/+v/+//3/CQAFAP//BQAFAAAA+v/5/wYAAAD5/wAA//8MAAAA+f8AAAYA+f8AAPj///8FAPn/AAD6//n/EwAFAAAAAAAGAPz/+f8AAPL/+f/1/wMA/f/8/wEADwAMAAAAAAAAAAAABQAEAAEA/P/8/wMAAgD8//3//f/3//L/8/8GAPn/7/8DAPz/AgACAAkACQAAAPz/DAAMAP//BgACAPv/CQACAPX/9v/2//n/AAAAAAAA+f/5/w0ABgD5//n/AAANAPn/+v/6//n/BgD///j//P8DAPb//P8JAAIAAgAJAAAABgAMAP//BgADAPz/AgAJAAMA8P/3//3/+P////n/8//w/+//CgD7////BgADAAIA9f8JABYAAgD8/woABgANAAAAAAAAAAAAAAAAAAUA/P/8//3/+f/5/wAAAAAAAAAABgAGAPn/BgADAPn/+f/5/wYA+f/y//z//P8JAAIA9f8JAAIAAgAGAAAAAAAGAAYAAAAGAAAAAAAAAAYA+f/z//r/+f8CAP//BgD5//b/AwADAPz/AgAJAAIAAAAGAAAAAAAGAPj/AAAAAPL/9v/1//3/AwAJAPv/AgAKAAwADQAAAAcA+f8AAAkAAgD8//z/9f8DAPb/6//y//z//P/8/wkA/P8DAAMAAwAJAAYABQAMAAIA/P8DAPz/AgACAPz/9f8DAPX/8v8AAPn/+f8AAAAAAAAAAAYABgAGAAAA+f8AAPn/+f/5//z/AgD1//z/AgAJAPz/AwAKAAkADQAGAAkACQACAP3//P/1//b//f/5/wAABgD6//L/8/8DAAIAAgACAA0ABgDy/wYABgAAAAAABgAGAPn/BgAAAAAAAAACAPn/+f/y//n/AgACAAAAAAANAAAABgAGAAAAAAAJAAIA9f/9//b/8v8AAAAAAAD5//n/AwAAAAAAAAAAAAAAAAAAAAYABgAAAAAAFAD8//X/AwDy//L/BgD//wAAAADy//b/AwD1//b/CQAPAP3/9f8QAAoAAAD9/wYADQAAAPn/AAAAAAYA+f8AAA0A+f/5/wYAAAAAAAAAAAAGAAAA+f8AAAAA+f8AAAAA+f/5/wAA/P/8/wIAAgAUAAYAAAAAAA0A/P/y/wYAAAAAAAAA+f8AAAAAAAAAAAAAAAAGAPn/+f/5/wAABgAAAAAAAAAGAAAAAAAAAAAA+f/5/wAAAAAGAAAAAAAFAAAAAAAGAAAAAAAGAPr/+f/4/wAABgAAAPn/8v/8/wkAAgAGAA0A+f/y/wYABgAAAAAA+f/5/wAA+f8DAAAABgAAAAYAAAAAAAAA+f8UABAA/P/1/woA9f/1//z/+f8AAPn/+f8AAPn/9f/8/wIACQACAPz//P8DAAkADQAGAAAAAAAGAAAA8v/5/w0AAAD5/wYAAAAAAAAABgAGAPz/AAADAP3/9f/5/wAAAAD4/wAAAAD5//X/7v8DAAkA/P8QAAMAAgANAAAA+f8GAA0AAAAJAAoA9f/1//z/AgD1//n/AAD5//L/9f8JAAIAAgD8/wkABgAAAAYAAAAAAAAA+f8AAAYAAAAAAAAAAADy/wAABgD5/wYABgD5/wYABgAJAAIA/P8DAPX/9f/8//n/+f/y/wAAAAD1/wIACgD9//z/CgAGAPn/AgAAAPz/AgANAAwAAAAAAAAAAAAAAAAA8v/5/wAABgAAAPn/AAD5/wAABgAAAAAABgD5//L/AwAAAAYABgAAAAAA+f/5//n//P8CAAoADQAGAAAAAAAAAAAAAAAAAAAA+f8AAAAAAAAGAAAA+f/5/wAAAAD5//n/BgD5//z//P8JAA0AAAAGAAAABgAAAAAABgADAPX/+f8FAPn/AAAAAAYA+P8AAAwA8v/4/wAABgAGAAYAAgD1//n/BgAGAPn/+f/5/wAA+f8AAAYAAAD5/wYABgD5/wAAAAD5/wAABgAGAPn/+f8GAPL//P8KAPn/AwAGAAAAAAAAAAYAAADy/wAABgAAAAAAAAD5//n/AAAAAAAABgAAAAAABgAAAAAA8v/5/wAAAAAGAA0ABgAAAAMA8f8AAPn/+f8GAAAA+f8AAAAA+f/5/wIA/f/8/xAABgD5//n/AAAGAAYAAAAGAAAAAAAGAAAA+f8AAAAA+f8AAPn/AAAAAPn/BgAGAAYAAAD5/wYAAAAAAAYA+f8AAAAABgD5//n/+f/5/wYA8v/8/wMA/P8DAAkABgAAAAAABgAGAAYAAAD5/wAABgAJAAMA9f/1/wAA+f8GAPn/6//8//z/AwAJAPb/CgAMAAAAAAAGAAAA+P8GAAwA/P8AAPn/8v8GAAAA+f8GAAYA8v/5/wAADQANAAMA9f/5/wAABgD5//n/AAAAAPn/7v8DABEABgAAAAAA+f8AAAAAAAANAAAABgAKAAMAAwD8/wIA9f/1//z/8v8GAPn/8v8AAAAABgD5/wAABgAAAA0ABgD5/wAA8v/5/wAAAAAAAAYADQAGAAMA9f/5/wAA+f8AAAAA8f8AAAwAAAAGAAAABgAGAAIA9f/5//n/+f8AAPL//P8DAPz/AwADAAMACgAGAA0ABgAAAAMAAwD8//X/AAD5/wAAAAD5/wYA+f8AAPn/BgANAPL/+f8AAA0AAAD5/wAABgD5//n/BgAGAPn/+f8GAAAA+f/5/wYAAAAAAAAAAAANAAYAAwD1/wAAAAD5/wAA+f/y/wIABQD5/wAAAAAAAAYA+f/2//3/AwADAAMACQAAAPz/AgAGAAYAAAD5/wAABgAGAPn/+f8AAAYAAAAGAAYA/P/8//n/+f/5/wAABgAAAPL/AAAGAA0ABgDy/wAAAAAAAAAABgAAAAAABgDy//n/AAAGAPn/AAAAAPn/AAAGAA0AAAAAAAYA+f8NAAIA9f/8//n/8v/5//n//P8DAAMACgAGAAUABgAAAAAAAAAAAAAAAAAAAAYAAAD5/wAA+f8GAAYAAAAAAPn/+f8GAAYA+f8AAAYA+f/5/wYAAADy/+7/AwADAAMACgD8//z/9f8QABEA8v8KAA0AAAAGABAA/P/8//z/AgD8//X/CQACAPz/7v/1//n/+f8AAAAA+f/5//z/9f/8/wMACQADAAMA/P8CAAoABgAAAAYABgAGAAAA+f/4//n/BgAGAAYACQAKAPb//f8DAO7/+f8AAPL/8v8DAAMA/P/8//z/9f8KABAAAgD8/wIAFAAGAAAABgAAAAIA/P/8//z/+f8GAAIA/P/8//X/AAD5//L/BgAAAPL//P8DAPz/EAAGAAAA+f8AAAAAAAAGAPn/AAAAAAAAAAD5/wAABgAAAAYAAAAAAAAABgAAAPn/+f/5//n/AAD9/wIADAD5/wAAAAD5//3//P8JAAIAAAD8//z/AwAKAAYA+f8GAAAA+f8NAAAA+f8GAAAABgAAAAAABgD8//z//P/5//n/+f8AAAYAAAD5/wYAAAD5/w0A+f/5/wAABgAAAPn/+f8AAAAA+f8AAAYABgAAAA0AAAAAAAAA+f8GAPn/+f8GAAAA+f/y//z//P8KABQA+f/5//n/AgAGAPn/BgAAAPH/BgAGAAAABgAAAAAABQAAAAAAAAAAAAAAAAAAAAAA+f8AAAAAAAAAAPn/+f/5//z//P8DAAIAAgAJAPX/CgAUAPn/BgANAPz//P/8/wMA9f/y/wYAAAAAAAYA+f8AAAYABgD8//L/8v8AAAAABgD5//X/AgD8//X/9f8QAAMA/P8CAAMACgAJAAYAAAAAAAYAAAD5/wAAAAAAAAAABgD4//n/BgD5//n/BgAAAAUAAAD4/wAABgAAAPn/AAAGAAAAAAD5//n/AADy/woAAAD5/wIAAAAGAAYA+f8AAAYAAAAGAAAABgD5/wAAAADy/wAAAAAAAAAA+f8AAAAABgAAAAAABgAAAAAA+f/5/wAABgAAAAAABgAAAAAADQD8/wMAAwD1//X/+f8AAPn/BgAGAPn/8v8GAAYA+f8AAAAAAAD5//j//f8CAAMACgAFAAAABgAGAAAABgADAPX/AAACAPz//P/y/wAABgD5//n/BgAGAAAA+f8AAAYA8v8AAAAAAAAGAAYA+f/5/wAA+f8AAAYAAAD5/wAA+f8GAAYA8v8AAA0ABgAAAPL/BgAGAAAADQACAPz/AgD8//X/9f/5//n/BgD5//L/AwADAAAA/P8KAAAAAAAAAPn/BgAAAAAABgAMAAIAAgD1//n/AAAAAAAAAAAAAPn/AADy/wAAAAAAAAAA+f8GAAAA8v8CAAIA/P8QAAYAAAAAAPn/BgAAAAAABgAAAAAAAAAAAAAAAAAAAA0AAgD1//z/AAD5/wAABgAAAAAAAAD5//n/AAD5/wAA+f8CAAIAAAAAAPz//P8JAA0ABgAGAAYA/P/8/wMAAwD1//n/BgD8//j/+f8FAAYA+P/y/wAABgAAAPH/AAAGAAYAAADy/wAABgD5//n/AwADAAAAAAANAAYA+f8GAA0AAwADAPz//P8CAAMA9f/8//z//P/1//n/AAAAAPn/8v/1//z/7v8NABAA/P/8/wMACQADAAMAAwADAAYAAAD5/w0ADQD5/wAABgD5/wAAAAAGAAMA9f/5//L/AAAGAAAAAAAAAAAA8f/9/wIA/P8KAAAABgAAAAYABgAAAAYAAwD8//X/AAAGAAMA/P/8//z/AwADAPX/9f8DAAMA9f/5/wYAAAD5/wAAAAD5/wAAAAAAAAAA+f8AAAAAAAAAAPn/AgAGAAYAAAAAAAAABgAAAAAAAAAAAAAADQADAPX/AAADAPz/+f/5/wAADQAAAPL/+f8AAAYAAADy//z/AgD8//z/AwAKAPz//f8QAAUA8v8DAAwAAAAAAAYABQAJAPz/9v/8/wAAAAADAPL/8v8GAAYA+f/r/wMAAgD1/wkAAwD8/wIAAwADAA0AAAAAAAYABgAGAAMAAwD8/wMA/P/1//z/9f/5/wAAAAD5//n/+f8DAA0ABgDy/wAADQAAAPL/8v8DAAkA+f8DAAYAAAAAAAAABgAGAAAA+f8AAAYAAAD5/wYABgAAAPj/AAAAAPn/DAAAAPn/+P/5/wAAAAAAAPn/AAD8/wMAAgADAA0ABgAAAPn/AAAAAAAAAAD5/wYAAAD5/wAA+f8AAAYAAAAAAAAABgAAAAAAAAAAAPn/AAD5//n/BgD5/wAAAAD5/wYA+f8AAPz/DQANAAAA+f/5/w0AAAAAAAAA8v/5/wYAAAAAAAYAAAAAAAYAAAAGAAkA9f/1/wAABgD8//n/AAAAAPj/+f8GAAYA+f/x/wYA+P/8/woA+f8DAAYADQAAAPn/BgAAAAYACgD8//X/+f/5//n/8v/1//z//P8DAAoAAwADAAkABgAAAPn/DQAGAAAAAAAAAAAAAAD5//L/BgAGAPn/AAAGAAAAAAD5//n/BgAAAPn/+f8GAPn//P8GAAAAAAD5//z/CQAGAPn/+f8AAAYABgAGAAYA+P8GAAAAAAAAAAAAAAAGAAoA/P/1//3/AwD1/wAAAADy/wAAAAD5/wYABgAGAPn/+f8GAAAAAAAGAAAAAAAGAAkA/P/1//L/+f8AAPn/AAAAAAAABgAAAAAABgAGAAYA+f8AAPn/AAAGAAYA+f/5/wYAAAD5//n/+f8AAPz//P8DAAIA9f8CAAoA/P8CAPz/CgADAAkADQAAAAYABgDx/wAADQACAPz/9f8CAPX/+P8GAPn/+f/4/wYA+f/y//z/CgADAAMADQAGAAYAAADy/wAAAAD5/wAADQAAAAAAAAAGAAYAAwD8//X/CQADAPX/9f/5//n/AAD5//n/AAD1//X/AwADAPz/AwACAAkACgAGAAYAAAAAAAYADQADAPX//P/8//z/8v/r//z/CQD8//z/CgANAAAAAAAGAAYABgACAPX/AADy//H/AAD1/+7/CgAQAPz//f/8/wMAEAANAAAABgAQAAMA/P/1/wMAAwD8/+T/5//8//X/9f8AAAYAAAAAAAYACQAQABQABgAAAA0A/P8DAAMA7v/y//n/DQAAAPn/6//8/wMAAwAJAAYABgAGAAAAAAAAAPn/+f8GAAAA8v/5//z/CgAAAPz//P8JAAAA/P8NAAAABgAGAAYAAwD9//z/9f8AAAAAAAAAAPn/8f/5/wIABgAGAPn/AAAAAAAAAAD5/wAADQANAAIA9f8AAAIA8v/5/wYAAAD5/wAAAAAGAAYA+f/5/wAAAAANAAYA/P8AAAAAAwD8//n/+f8AAAYA+f8AAAAA8v8AAAYAAAAAAPn/+f/8/wIAAwANAAYA+f8AAA0AAAD5/wAABgAAAAAA+f8GAAYA+f8AAAAAAAD5/wAAAAD5/wAAAAAAAAAA+f8GAAYA8v/5/wYABgD5//n/AAAGAAAA+f8AAAAAAAD5/wAABgAGAAAA+f8AAAYAAAD5/wYAAADy//n/BgAAAPn//P/8/wMADQD5//z/DQAAAPn/AAAGAA0AAwADAAoA/P/1/wMA/P/1//z//P8DAAIA9f/1//n/AAAAAPn/AAAGAPn/+f8AAPX/CQD9//3/CQADAP3/AgACAAkAAAAFAAYAAAAGAPn/AAAGAPn/+f8GAAAA+f8AAPn/+f8AAAAA/P/8//X//P8JAAkAAgD8/woABgAAAAAAAAAAAAAAAAAAAA0AAwD8//n/+f8AAPn/8v/8/wIACQD5/wYABgAAAAAAAAAAAA0ACQD8//z/9f/5//L/+f8AAPn/AgD1//z/AwD8//z/AgAJAAkABgAGAAUABgAGAAIA9f/9//n/8f/5/wAA+f8AAAAA/P8DAAYABgAAAAYABgD5/w0A/P/y//n/AAAGAPn/AAAGAAYA8v/y/w0AAAD5//n/AAANAAYA+f8AAAAA+f8GAAYA+f8AAAAA8v/5//z/AwADAAMADQAAAAAAAAAAAAYABgAAAPn/AAD5//n/BgAAAPn/+f/8/w0ABgD5/wAAAAAAAAYAAAAAAAwA/f/5/wAAAAD5/wAAAAD4//n/BgAGAAYAAAAAAAAA+f8GAAAA+f8AAAAAAAAAAAYA+f/5/wAAAAD5/wAAAAD1/woAAgAAAAYABgAGAAYAAAAAAAAAAAAGAPL/+f/5//n/AwAAAAAABgAGAPL/+f8DAAYABgAGAAYA+f8AAAAAAAD5/wAAAAAAAA0A+f8AAAYA+f/y/wYADQAAAPn/BQAGAAAAAAAAAAAABgD5//n/AAAAAPn/+f8AAAYAAAAAAAYAAAAAAAAAAAAAAAYAAAAAAPn/8v8GAAAA+f8GAAAAAAD5/wYAAAD5/wYAAAAGAAYAAAAAAPn/AAAGAAYAAAD5/wAAAAAAAAAAAAAAAPn/+f/5/wYABgD5/wAABgD5/wAAAADy/wYABgD5//n/AwAGAAYAAAAAAAYAAAAAAPn/BgAPAPX//f8JAPz/9v/1//j/+f8AAPn/BgAGAPn/+f8AAPn/9f8JAAoAAAAAAAYABgAGAAAAAAAAAPn/DQAAAAAAAAADAPz//P/8//L/+f8AAAAA+f8GAAAAAAAGAAAAAAAGAPn/8v/5/wYABgAAAAAABgAGAAAAAAD5//n/+f8AAPn//P8JAAYAAAAAAAYADQAAAPL/AAAAAAAAAADx/wYABgD5/wAA+P/5/wIABgAAAAAAAAAAAAYA+f/5//n/AgAGAAAAAAAGAAAAAAAAAA0AAwD1/wAAAgD1/wAAAAAAAPn/AAAAAAAA+f/5/wAA+f/8/wMAAwAKAAYA+f8AAAYA+f8GAAAA+f/5/wAABgAGAAAA+f8AAPL//P8KAAAABgAGAPn/AAAAAPn/BgANAAYA/P8DAPz/9v8DAP3/AgD8//X/+f8AAPj/+f/x/wIACgAAAA0ADQAAAPn/DQADAPz/AwD1//X/+f8GAAAAAADy//n/BgAAAAAA+f8GAAYA+f8AAA0AAAD5/wYAAAAAAPn/AAAGAAAABgAGAPn/AAAGAAIA9f/5/wYA+f/y//X/AwAJAPz//P8DAAMACQAGAAYAAAAGAA0A/P/8//z/+f8AAAAA+f8GAAAAAAAGAAAA+f/4/wYAAAAAAPn/+P8AAAAA+f/8//z/AwAKAPz/CgD8/wMADQAGAAYACgADAPz/AwD8/wMAAgD1//X/9f8AAPn/8v/y/wMAAwD8/wIAAwAKAA0ABgAAAAYACQD1//L/+f8GAAAA8v/5//z//P/8/wIAAwAJAAIAAwANAAAABgAGAAoAAwD1/wMA9f/1//L/+f8AAAAA+f/8//3/AgAJAAYA+P8GAAwABgAAAPn/BgAAAPn/AAAAAPL/+f8AAAAA/P8GAAYABgAGAAYAAgD8/wMA/P/8/+7/+f/5//n/9f/8/woA/P8DAAMAAwANAAYABgAGAAMAAgD8/wIA/P/1//X/+f/y//n//P/8//X/CgAJAAMACQAGAAAA+f8AAA0ADQACAPz/AwD1//X/AAAAAAAA8v/5//n//P/9/wIAAgAQAAYAAAAGAAYABgD8/wIAAwD9/+//+f8AAAcAAAAAAAAA8v/5/wYAAAD///j/9P8JAAIA9f8CAPz/AgAKAAMABwAHAAcABwAHAAoAAwD9/woAAAD4////+P/0/+3/9P/p//T/9P/u/wAAAAAAAAcADgALAAQAEgAOAAcAAAAOAAMA/P8CAPv/+//0//D/9/////j////x/wIAAwAEAAQABAAOAAcA+v/6/wYAAAD5//f///////f/9P/7/wEAAQACAPX/CQARAPn/AwAOAAAA8/8IAAcABwAHAAMA/P/1/wAA//8IAPT/9/////f////x//j/AgACAAAA/f/9/wQABAAEAA4A+v8AAA4ABgAAAAYAAgACAPv/7f///wgA+//0/wIA/P/x/wAAAAAGAAcA+f/5//r/BwAAAPP/AAAAAAAA+P8CAAwAAAAAAAUA+f/4//j/AAAAAAAABgAGAPn/BgAAAPL/AAD5/wAA/P8DAAMABgANAPn/AAAAAPn/BgAAAOv/AwD8//z/AwD8/wIACQD8//z/AwAJAAYA+f8AAAYABgANAAMA/P8DAPz/9f8DAPz/7v/5/wAA+f/5/wAAAAD5//z/AgADAPz//P8KAAMABgANAAAABgAQAAIA/P/8//3/AgD9//3//P/2//X/AAAGAPz/+f/5//n/AAAGAAAA+f/5/wAABgAGAPn/AAD5/wYA+f/5/wMAAwAAAPz/AwADAAYABgAAAA0AAAD5/wYACgD8//X/AwD8//z/+f/5//n/+f8GAPL//P8DAPz/AwD8/wIACQANAAAA+f8GAAYAAAAAAAYA+f/y/w0ABgD5/wAA+f8AAAAA+P/5/wAABgAAAAYABgAGAAAAAADy//j/DQAGAPL/+f8NAAYA8v/5/w0AAAAAAAYACgAJAAMA9f/8/wMA/P8DAPX/7v/5//L/AAAAAAAA+f/1//z/CgAKAAMABgAAAA0ADQD5//L/BgAGAPn/+f/5/wYAAAD5//X/AgACAA0AAAD5/w0AAAAAAAAABgD5//n/BgD5//L/9f/1/wMA/P8JAAIA9f/8/woACQACABMAAAD5/wwABgD9//n/BgACAAMA9f/y/wYABgD5//n/+f8AAAAA+f8GAAAA+f8NAAYA+f/5/wAAAADy/wAAAAD8/w0ABgD5/wAAAAAGAAAAAAAGAAYAAwD1//n/BgAAAAAAAADy/wYABgDy//n/AAAAAAYAAAAAAPn/+f8AAPX/AwAQAAAAAAANAAAAAAAGAAAAAAAAAAAAAAAGAAAAAAD5//H/+f/8/wkABgD5//n/AwACAAAABgD5//n/AgACAAYAAAD5/wYABgAAAAAABgAAAAAACgD8//X/AAAAAPL/AAAGAAAA+f/5/wYAAAD5/wAA+f8AAPz/AgAGAAAAAAAAAAYAAAAAAAYABgDx//7/+P8AAPH/BgAGAPL/BgAAAPL/8v/8/wMAAwD8/woA/P/8/wkACgAAAAUADAABAO3/8f/+/wIA9P/m//D/+P/4//H/4//0/wIA7f/6/wgA+P/4//H//v/+//j/BQD+//r/AQD0/+3/9P/0//T/9P/0//H/8f/x/+r/9P/t/+3/AQD7//v/AgD8/wMACgAKAAAA+P8FAAUA+//7//T/9P/6//v/9P/0/+3/7f/7/+3/+P/4//H/+P/4/+P/7f8IAPT/9P8JAAMA/f8CAAQABgAAAPL/BgAMAAAAAAD4//n/AAAAAAAABgANAPz/+f8AAPn/AAANAAAA+f8GAPn/8v8AAPn/AAAAAPz/AwACAPz/CQD8//r/DQAGAPn/+P8FAPj//v/0//T/+v/t//L/+P8AAPH/AAD+//j/6v/0/wYA+P8AAPj//v/4//H/8f/+/wAA8f/4//n/+//+//7/8v8AAAYADQAKAPX/AAADAO3/8f/+//j/+P8AAPL/AAAGAPH/+f8AAPn/BAACAPz/CQAGAA0A+f8GAA0A/P8DAPz/8v/5/wAAAAAAAPn/+f/8/wYABgAAAAYABgABAAEA+f8AAAAA+P8AAPL/AgD0//T/AQD0//X/AwAKAPv/+v/9//7//v/4//7/+//q//j/8f/+//j/6v/4/wUAAADx//j/+P/4//H/8P/4/wAA+P/w//X/+v/7//v/+v/8//X/+//6/wEAFAAAAPn/8f/+/w0A/P8DAAMA7f/0//v/9f8EAAgAAQABAAEAAAAAAPn/9f8CAPr/AgD0//r//v/4//j/+P/4//7//v/+//v/9P/x//H/+P/4//j/BQDx//j//v/x//j/8f/+/wAA+f/5//n/AAAAAPz/AwACAAMABgAAAPn/AAAGAAYABgAFAPn/BgACAP3/9f8AAAUA+f8AAAAAAAAGAAoA/P/1/wAAAwD1//L/+f8AAAYABgDy/wAA+f/8/w0A+f8AAAAAAAAGAAAAAAAAAAAADQAGAPn/AAD5/wAABgAAAPn/+f8AAAAAAAAGAPn/AAAAAPn/AAAAAPn/9f8JAAkAAAAAAAYA+f/x//j/+P8FAPH/+P8FAP7/9P/q/wYA/v/w//H/AAAGAAAA+f8AAPj/+f8AAPn//f8DAAQABAALABIACwADAAYA+P/4//j//v/x/+r/+/8DAA0A8f/4//7/8f/5/wYA/v/x/wAABgD+//j/6v/x//j/8f/8//r/+//0//v/+v/0//v/+//7//7/+P/q//v/BQD4//7/BQDs//T/+//0//T/9P/0//T/8f8AAPj/8f8AAPn/+f8AAAEA9v8CAAIABAARABEACgALAA4ADQAVAAgAEAASAAoA/f8BAPn/AAD+/+r/8f/4/+n/8//w//T/7P/z//n/9v/x//T/+//+//7/8f/4//7//v/4//H//v/4//j/BQABAOb/4//+//7//v/q//H//v/4//j/+P8AAAAAAAAAAAYAAAD5/wAABgAAAAYA+f/y/wAADQAAAPn/BgAAAAAA+f8AAAAA8f8AAPj/+P8GAAwABgAAAPH/+P/4//7/9v/0//r/7f/4//H/+P/x/+n/7f/0/wkAAgADAPz/AgAJAPj//P8CAAYAAAD5/wYABgAGAAAABgAAAOr//v8FAPX/+f8AAPn/AAABAPn/AAD8//3/CwALAP3/EQALAAQACgARAAsAEwAWABYADgAIAAgABgD5/wAADQD0/+3/+P/q//H/9v/o/+n/7P/z//P/7f/5//D/7P/y//L/7f/z/+z/7P/y//n/8//2//D/9v/w//j/BQD7//T/7f/4/wAA+//p/+L/+P8AAPj/+P8AAAAA8v/1/xEADgABAA4ACAAIAAEAEAAVABAACAAWABAAFgAaAAQA/P8DAAMA/P/u//z/+f/x//7/BQDt//D/9v/s//D/6f/2//b/8f/q/+n//v/4//H/+P/4//j/5v/t/wEAAQABAPv/9P/8/woADQAAAOv/CgAGAAAABgAGAAYA/P8DAAMA9P/t//T/8f/x//7/+P/q//n/AAAAAAAAAAD+/wYA8f/4//7/+P/+//7/8f/x//H/+P/+//7/+P/x//j/+P/4//j/BQD7//T/+//t//r/+v/l/+r//v/2//H/6v/4//n//P8DAAQAAwARAAgA+v8RAAYABgAUABIACwD9/wIA/f/1//z/AgD1//z//P/5//n/8v/1/wMAAgAJAAMA/P8DAAMAAwAGAA0AAAAAAAYABgD8//n/+f8AAAAA+f/5//n/AwAGAA0A8f/x//7/+P/4//j/+P/x//j/+P/x//H/9P/7//T/+v/7//T/9P8BAPv/+/8CAPH//v/+//j//v/+//H/+P/x//H//v/x//j/8f/4//7/+P/4//j/8f8AAP7/+P/9//n/+P/4//n/AAAAAPj/AAD5/wYABgAGAPn/AAAGAAYAAwD8/wMA9f/8//z/AAACAPz/+f8AAPn/+f8AAPL//P8LAAMAAgDs/+z/AgARAPD/7P/6//3/+P/x//7//v/4//H//v8GAAAAAwD0//n/+f8GAAAAAAAGAAAA8f8AAAAA+v/4/wYA+f/q//z/AgD9//b/CgADAP3/CQAJAPz/BQAAAAYABQD4/wAAAAD5/wYAAAAGAAMA6/8AAAYAAQABAPn/AAAAAPH//v/+//H/8f/+//j/8f/x//r//v/+//j/+P/4/wAABgD4//j/BgD4//j/9v/0//T/6v/q/wUABgDx//j//v8GAPn/+f8AAPH/AAAAAAAAAADx//T//P/8/wIACgADAAMAAgAGAAAAAAAEAPj//v8BAP3/5v/4//j/8P/4//H/8v/l//v/9P/7//v/+v/8//T/AgADAAMACADw//H/BgAGAA0AAAD5//j/DQD8//X/8v/y/wAAAAAAAPn//P/6/wMA9P/7/woA+P/+//j/6f/w//7/8P/x/wAAAAAAAPn/AAAAAAEABAARAA4AAAD+/wAADgD+/wMA/P/r/wAAAAABAAEAAQALAAUACgALAP3/AgAJAAAA/P8CAAYAjgDg//7/BgBg/4j/af8AAAAACgA4ADYAMgAU/1P/U//W/pD/if/W/w4AHgApADgA3v9oABAAsP9QAAIAOAB1AGAAkQD4AOAA8AAQAeAA0ACgAGYAQAABAN7/vv+g/4j/ef+A/4D/iP+Q/0j/Wf8C/w7/Hv8Q/1b/4P9oAC4BcAGGAVACiAI4AisCygFZAdgAOQCw/0b/3v5w/lb+Kf4h/tj9pv22/Yb9YP1m/Yr9NP1T/c39dP6z/4UA8AFYA5IDGATpBMAE6AOIA6UCtQHyAFoAuP8o/0X/5v6i/iD/Ff8G/xz/G/8b/93+Qv4W/uD9Wf0Q/SD90fxS/L78ePxx/Rz//P/5AWMDQgQcBQ4GkgW8BGgEQQNRAYAA1P+z/rn+fv6s/g3/mv/R/xAAWwBNAEEA8P9E/+j+f/7Z/WT9Df2e/Dz8WPwS/P/8L/+wALYB6wJoBAwFQAW/BCcExgOeAtgAAACR/5n+R/5I/rP+D/+B//b/SwBjAFsASwDR/yr/oP4g/qf97/x4/PX70fvj++/7wv1KAGUBHAJ4AxcFgQXxBGsEbgTdAxQCWwDm/1P/Vf6y/fn9if7b/ij/uf9mAIAAYQBYAF8A2v+x/m7+VP7c/RX9vvzi/En86Pv0+8X9IwDcAFUBRAPoBBgFiATBBBQFbASpAicBxQC//0/+lv26/Ub+ef7D/oX/UAB6AF4AYwCGAEgABP90/pv+T/65/TT9av0U/S/84/s7/eL/2wB/ABkCoAQ8BV0EQwQYBfEESgNGAaoAMACc/oz9R/3b/Ub+c/7i/rv/VAA4ABsAMwBIAGj/gP58/lD+If6f/U797/xB/BH89Pyp/yEBjgBSAeADVwWZBN0DZgTPBMADtgFaANj/Qf9Y/lD9O/0i/sv+9/4n/wEAxACdACoANADi/+r+df4o/uD9sP15/Rj9SPzA+6T8I/9jAVgBMgFBA2gFvwWgBBwETwQBBIkCdABi/wD/u/7u/Qz9VP14/mP/fP/w/90AUwELAW0Az//K/o3+cP7L/S/9VP2G/eP8Cfyw+xn9vf+tAVYBfgHNA+AFEAboBBYE0gOdAzUCHQDb/oD+jP7U/RP9av2R/oX/EADOAC0BNgH6AIYAwf+i/hr+yP0y/ej8FP0D/WP80fu5+yD90v/GAY0B6AE3BDMGlgY0BfADZgOfA1gC9v9C/q39MP7a/Q791PxL/t3/0wBoAWABewGAATYBIgCQ/uz9tP3w/FL8Svxs/Cv8zPve+0T9PgA6AlYChQJJBDkG0wbjBVkEQgMYA0UCZwBP/h79a/2o/X/9IP2w/QX/gwCJAZsBcAEoAQ4BeAAd//79b/0//Rz9AP2g/CD8t/ub+4r74P3UAKcCpAKCA4EFAwcqB9AFMAQ9A/oC4AHf/739Bf1u/cH9kf09/cz9NP8DAb4BgQHbAPAA5QDn/2D+Y/0K/Q/95Pw6/GD7SPvt+1T86/11AJQCUgMEBGsFQgamBuAFdAQYA4YChwHh//X99/wS/Vb9cP1Y/cj9//6QAMcBRAKSAR4B/QB2ADj/+P1C/RX9Af3S/GL8TPwQ/Bb8h/yO/lUB1ALDApMDVQWMBq4GhQXjAx8D/QLLAZb/f/3o/GD9hv07/QX9uf2j/2cBQwIfAkwBGQHXAMb/G/7V/Hv8iPyC/DD8ufuI+/D7s/w//s4AtAI2A5ED+wQmBp4G5wVhBBIDjAKTAQAAJf4i/TD9bf1p/VP9sv0n/+4A+AEJAlYB/ADsACIAu/5w/Qj9C/3l/KH8Wvz2+7/73Pvp/Hb/CgLbAvICKATqBfQGsgZPBekDTgN0AqQAgv4q/fj8Cv3f/Lb8Pv21/ogAjwHqAaoBawFPAZYAZf8a/oP9P/30/GX8FPwn/Av8w/v8+xD+FwEMAwEDewMhBbkGHAfxBU0EjgM/A9YBrf+1/Rf9QP0g/ab8mPzn/cL/+QBAAWYBowHDARgBzv+d/vH9nP0c/Wv87vsZ/CH8uvuM+538S//mAYYCigLhAxkG6AZMBu4EOAQCBBgD1wBs/or9eP0q/WT8XPyG/Xf/zwBLAacBHQJnAsMBSgAL/0r+xP0Q/Tj8oPu9+wX8u/tS+6v7nv2lAJACxQKdA9wFOwfFBugF9wRbBEYDnAFm/+H9gP0m/Wv8Lvwx/YH++f/gAJ4BTAKTAiAC8ADB/9/+Af4U/VD80vu8+/H7zvu2+677UPxV/s0A+wFbAh8EVgbwBmMG7wWCBZ4E+gINAVn/Tf6N/br8HvyM/Kz9wP7c/+gA5wFoAjMCgQF0AH//nv6Q/cf8XPwx/Dn8Bfze+8D7A/wQ/Tj/mAGSAvUCuQSaBqIGzAVUBSUFFwQ5AnkAIf8//iv9X/wp/N783/3B/vD/KgEPAjgCCAKOAaAAY/9P/mD9nfwo/On79Pv9+637Vvub+wP9S/80AfoBDwNTBasGMQbdBRMGewXEA/cBnQBj/x/+7fyX/OX8pv1l/lX/zACxAewB0gG/AT0BCAD5/kT+W/2J/Db8LfxI/Ev8DPzO+yX8Q/0T/0UBNwJEA34F4AZHBhEGXAZ+BZwDBALOAFH/9P3l/In8mfzs/KX98f5FAAgBWwEDAuwBKwEoAGD/wP6O/Yb8VfxC/B38IfwX/PT7BPy0/KP+uAA9AX0CpAV8BqkFiwYaB5UF8wMJA2ABu/9+/lz93PyQ/Jj8k/3m/pn/QgAeAb0BUAH2AJoAzv8R/xP+T/0Q/bL8V/xV/C78v/v1+6X8Av4dABYB/gGCBAMGrQUdBt0G8QVnBH4D8AFAABP/5P3w/Gj8Zfwt/Tf+/P7v/+cApQGXAXYBOgFyAKH/pv60/Vn92Pxq/G78UPzn++b7fPzd/cb/gQBwAeQDWgUYBaQFhgZuBV4EpQMhAngAgv9x/kj9tvwY/Xz9Lv7B/ur/pAAaATkBTAGqACAAmP+G/pD9f/0i/Yv8Pfxl/P37yPtN/Pb8vf6aAD0B/QJMBZ4FAwYOB14GDAXZBDwDIAEmAL7+hv3D/JX83fyb/Uj+Kf94ABcBQQGJATEBdwDw/xv/1/1h/Rf9fPwu/C38E/y0+/D7WPyu/ZD/RwAUAkQE2gTNBSkHfgbvBdAFAgRSAlgBTP/h/S39SvxO/AH9Wv1Y/q3/UQATAbABawEkAeIA9f/j/if+fv0L/aX8Qvw6/PT79vuP/CH9K/+QAH4B4gM/BSUFwwbwBpgFkgWLBDwCRQHF/8b9FP1Z/OX7gPwe/cr9Bf8MAKgAWQGIATIB/gCBAHb/hP7Y/Sb9c/wV/OH7kvt0+wb8a/wc/t//yQDRAv4EJQVjBqUHiAY2Bu4FzgNYAjIBDv/U/Rj9PvxX/N/8Vv14/lP/UAAUAZUBrwFWAQsBRABA/3H+uP2c/Fn88Pta+yj7avvI+1j90/6//xgCIgSQBCwGYQeUBrEGTQYfBNcCVwH1/tL9wfyo++r7UPy+/NX9xf7f/7QAcwHMAWkBRAGiAJn/6/4k/hD9sPxN/Kr7cPuT+xr8Ef3X/ub/ZQHlA5EEkAU5B5sGWQZkBlAEDQPjAYj/Tv5u/Rb8F/xU/ID8jv1y/nD/egAWAZoBgAFLAfgAEgAN/1n+iP3G/Ib8Evx7+3D71vs1/Kb9Uf8eAAsCLgR2BGIGPwd9BhMHIwYwBI4DiAFs/7D+E/1G/JP8bPwF/QP+s/7Y/6AAGAF+ATcB8wB+AHH/lP7q/e78bfze+1/7Evsm+6b74Pwu/rf/YwEfA4oE4gXdBusGEAdUBiMFHgRXApkAZf/A/fX8x/xZ/NL8cf0A/iX/1f9wAC4BEAHGALUAuP/q/lj+Yf3Z/E78rfum+0H7Xfs8/B/9t/53AOsBxwMnBUUGWAcqB9wGOgbCBGwD3gEdAL/+hv2p/Ff8SPyz/E/9Ff4e/9r/iAASAQMBDQGbANT/Kf9p/qz9O/3J/FD8uvxD/Cj88vxY/an+PgD5AFMDSAQOBc4GowZOBpQGpASyA5ACYQBl/wT+Ev3K/FD8xfxV/ZH9x/5g/6r/kwBmAEkAWABY/+z+X/6M/WT9xvy//Lb8L/yS/Nj8yv1R/0wALgLyA5IENQbXBqQG+AbQBWkEawNkAfj/c/49/cD8EPxI/MH8AP0N/if/oP+mABUBBgErAZgAzP9j/3P+9/1k/bH8a/wr/Jb7wfvu+/v8ff6J/7QBVAM4BPYFtQYQBzEHgwZdBTkEmALPACP/3P38/C/8S/yE/Mf8tP3a/nD/XwD+AAABIQGlAPP/S/9f/r79G/1L/On7sPs1+2H7ivuY/Gr+IP/UAUkDXARQBu4GYgePB8gGrwVoBMEC1gBM/4z93vwQ/OD7X/yi/I79y/6S/00AGgFVAXgBQQGRAPH/E/86/p796/xd/Bv8+fvG+837s/xY/R//CwAjAnsDQwTPBXQGYgaLBrIFYARiA68BAgDD/qz92PyU/Gv84Pyv/XP+y/+mAN8AngGIAT0B6wAjAE//oP7q/R/9jvwS/N/7W/tx+x385vy6/qb/0wE/Ax0E/gWdBqoGFQcXBvwELAQqAo8APP/A/bv8Qfyb+yr8nvxZ/dT+Z/8zACEBUAEtAUABiwDL/zb/jf6J/WD9aPxw/EP84Pur/CD9RP6o/7sAkQKHA4YE2wX4BUAGKgb6BEgEAAMwAfL/l/5N/bH8A/zi+2n8t/zQ/d7+eP9jABYBGQEyAd8ADwCT/wT/4v2t/Zf8gfwu/IP7+vtC/EX90f7v/4gBggNWBEMGtQb6BlAHKAZIBdgDQAJWACD/qP3A/Dj8w/se/L78cP3G/mz/MgDjAPkACgGyAD0AZf8e/0v+4P1o/QT9Gf2K/Gr8wvwh/Tz+dP+GADUCoAOfBPIFKgbFBnwGtAXQBGgD+QFVADb/3/0g/W/8TfxR/Ob8hv1c/iz/LQCTABwBHwHyAH4A9f9R/3/+z/0X/aT80ftb+2z7ZPuO/FD94P5qACgCrgPKBB0GugYOB5cG9AXYBHgD0QEXAOT+Tv21/CD8APxz/Av9G/4A/7n/qgDUACcB8AB9AN//Tf+b/vX9aP25/L38ovsm/N/7Nvxg/fj91f8AAdgCswMyBfUFmAbPBhkGrQVgBCwDbgEEAJX+a/3c/Dn8cPzQ/Ib9jP4e/xYA3QAFAWsBGwHCAHEAtP/7/kf+n/31/Bj8h/ub+zX7GfyD/IL+g/+CAegCIwTYBUcGAwe5BnwGcQUNBOAC6AC9/xT+Sf2V/Pv7afy7/ET9Af6O/pH/7P9YAMEAeQCLAPH/cv/E/hn+ev2U/FD8y/up+8X7Ofyq/bf+dQDqASsD6ATHBXwGtgaRBhoGBQW4A2ICCAGO/5P+Zf2t/Hr8Y/z9/Dz96v38/nn/QADUAOwAJgHJAGEAvv8B/zD+dv3T/Ef8zPug+237yPwV/b/+SwBWAY0DtAR5BbAGmQa0BkMG8QThA5gC8QDS/z3+GP2O/Fb8N/yc/PD84P2d/mP/RgC1ABgBIAHzAIMA2P8g/1/+s/3l/E/8xvth+zn8HvzF/aT+IAAjAl0DAQUBBsAGVwfDBhIG+wSHA9ABgwDi/sb9y/z1+/j7D/x7/FD9tf3d/oz/FwC9ANwADQHXAGAA1v8p/4j+7v1B/br8a/wp/Dn8F/2m/Sn/UgCvAXIDggTQBW4GhAalBogF1QRWA9gBrgAV/xP+8Pxb/EH8Fvyh/P38ov2n/gn/6v+GALEAAQHBAHgADQBZ/8v+Dv5Q/dL8HvzQ+0L8xPzM/f7+ggB4AoIDMgUrBoMGwAY9BlMFSQSoAnsB5/+o/pX9o/wm/Nv76/tf/EL98P35/sf/egATATkBQAEAAXMA1/8s/0/+jP3w/Dj8tfvS+w/89fz+/Sr/XAFkAkAEtgVEBgwH2AZNBoEF/AO0AkgBgP+t/hP9Zvz3+4374Pt1/AX9/f3a/qP/XQCTABYB7QCsAHsA7P89/8r+8P0+/Zz8Kfwq/HT8SP0I/sD/SAGNAmwEigV/Bh4H7AbEBtIFdARIA5EBGwD6/mf9m/wY/KP72/st/Nv8rP2E/k7/CgBrAMQAxACLAFgAwv8a/6P+tf1C/V/8PPw//GL8bf0A/on/EwFtAicEHQURBoQGXgboBQEFygNeAt8AgP9I/hf9dPwE/NP7LfzE/Gj9UP4r/+3/fQDTABsB+wC9AFgAvP8Q/1v+qf0Q/YP8o/yV/DX9NP7t/sYA7wGYA/MEpQV0Bp8GMAZ9BZEEKQPDAU8A/f7H/cD8JPy7+5j7A/yQ/D79Jv7l/rb/PQCoAOEA1gCoACgAhf/o/hv+c/2o/Hj8c/yV/Jr9MP7a/2EBywJABFcFFAakBoEG2AVABfUDkQJLAcv/kP6j/Uf8MPyM+7j7ovzw/Ov9wv5o/yoAmwDZAOkAtwBNALD/D/+b/qX9//yc/Hv8cvzk/NT9HP9eAMIBUQNYBIYFEgb9Bf4FPgUwBCkDrQF2ABr/wf0V/SH8vPsD/A78wvxx/S7+CP+4/1wAyAD+APkApwBIANL/9P5A/pz9OP37/Br9g/08/nP/mQACAhoDfAQoBdQFAQZyBTkF/gMAA7ABWQAs/xb+GP2C/AH8x/s5/FH8Bf27/WL+O//I/2UAnQCoAJAAEwC4/zH/Yv6w/TL97PwH/Xj9Tv6B/5kA/wFCAz8ETwWtBdgFtAX5BD8ELgP0Ab4Ab/93/oH9mvxg/Dj8OPy4/Bn9u/1i/v7+y//f/z4ASQD4//3/YP/l/kf+0f2S/XT97P1c/mv/cQClAdwCyQPYBFYFjgV2BecEHAQoA+kBtQB5/2P+kf2g/Ej8IvwQ/Gz80vxP/QH+jf46/5H/z/8mANn/3P+T/x//yf4Y/vX93P0S/pf+Uv9vAHQBuQKbA24ERAVdBWIFDAVPBGoDWAIWAfX/xP7a/Rj9VvxR/Df8Vvzf/FL9CP6Q/hj/rv/C/xUABACg/6b/IP/T/mD+Of5g/or+If/r//oA9QHYAvYDZwQTBR4FwwSABIYDpQKeAWgAYP9D/pX9zPxg/Ej8F/yV/PT8cf0k/pv+Pf+w/8f/CADo/6H/Yf/x/oD+Q/4y/lL+yv5t/10AOQEzAmcDwQO+BN0EvAToBPkDmgO3An4BoQA9/2/+lP3F/KX8MfyO/OH8Of3x/UX++v48/3T/pf+b/2L/GP/O/hP+Hf66/UL+o/5M/5UANQGoAmwDLQQRBeEEJwXPBAMEmANIAkABJwC8/hH+Gf2o/Eb8+/tr/Kn8J/2T/SL+iP7b/j3/Yf+I/17/cP8A/7z+A/+F/mz/kf9rAHgB0gE2A34DHQSbBFcENgQUBDQD7AL2AfcAPQD0/n/+pv0n/dz8g/zC/A/9X/2+/Tj+Q/6p/rz+0P76/p/+1/5Y/qD+df6h/pf/tf8gAXkBjgI6A58DagQQBEoEBwR3AxQDMAJNAWQAVf+j/gP+ff0c/ej8DP1K/Yj9y/1Y/mr+2P4N/0P/bv8c/0//p/4I/4L+3v6a/6r/EQFIAVEC+AJlA8sD2APnA5wDXQO5AugBFAEXAGv/rv7t/Zf9Gv04/VT9K/3O/bD9Cv5V/lX+2f6e/sn+uP4+/rD+MP5A/2j/QQBZAaUB4AJAA9ADHgQvBEIE+wOYAwYDOAKCAWsAgP98/qr9Q/3A/Pn8pvwO/Wf9mP0C/jz+pf61/tD+4v6F/sX+g/7//ob/nP/xAAAB7AGiAtgCqgNoA9wDnANWAyQDcgIIAhgBXwB4/6n+Kf6I/Xn9Kf0b/Wn9bf3G/fj9J/5e/mX+iP5l/o3+hv4A/1f/nP+RANcAmAE4AoUCLQMlA2EDVwMLA+QCUwLtATABggDI//7+if77/dL9if17/a39q/0C/jr+cv6c/rD+0f68/sT+3/4W/1T/w/9oAPAAngFKAqACOANUA3YDYAMiA8QCNQLnARwBcQC+/xT/qv7+/dr9kf1h/af9mP3X/Qf+Nf55/nz+n/6W/pr+r/7o/in/fv8bAJUANQHhATcCqgL6AgkDKwPmAsYCTwLvAXUBwQAiAGf/7v5W/v/9wP2A/aX9pv2+/fH9F/5Z/nP+iP67/rr+7P4h/1j/uP9AAM8AVQH4AW8CwAIpA0EDUgMwA/gC5AIbAu0BKgFaAMD/2P57/tr9oP1j/U79fP18/af91/3u/RT+U/5y/p3+v/4Z/0f/i/8+AIcAVQGsATMCoALgAiADHgMLA+gCwwIFArwBFgFNALL/zv6H/tz9sf1w/Uv9lf2K/bD93v35/ST+Pv55/rT+3/4S/3z/ov8vAKsAEAGmARoCcQK8Au4C6AL3ArACtgJGArsBZAG6ADcAmf/4/rX+YP4j/gf+3P0N/vr9+v0t/i/+Uf5l/pz+wP4K/z3/i/8hAH0ACwGlAfUBbQKKAqkCjgJeAj4C8gF0ATcBmwAdAK//MP/e/qH+Z/5E/jD+OP5W/mL+e/6Y/sL+zP7R/uf+6f4x/zv/gP/Y/0cAywAlAbwB+gFoAmICigK2AiQCQAKvAV0B/gA/APD/VP/q/pn+WP4P/vz94v3f/f39Ef5u/nT+xv72/iL/Xf+A/8z/+/9iAI0AEwFeAawBFAIQAkkCOwICAgkCpAFnARcBlgBRAO7/gP9D//3+q/6I/mD+Sf5H/jn+Z/6K/pb+0f7l/hD/Tv9m/43/4/8eAGcAwADzAFABZAGMAZgBdwFxASMBFQHUAJYAXwAGAMn/g/9N/zn/H//3/v3+/P4M/yD/IP9W/2P/gP+p/5n/x//e/9//BQAnAFEAiwCwAM4A5gDiAPsA1QDUAMEAoACRAFcAPwAMAOD/uf+i/4z/cP9u/1n/WP9X/13/cf+A/4r/lv+d/7D/uf/D/9X/8P8eAE0AdwCYAJ0AoQC1AK8ArgCXAIYAgwBYAD0AEADo/7r/mf+T/3r/dP+A/27/fv+C/5b/qP/E/+L/7v8IAAcAHQAWACUAOABDAFoAaABvAHEAcQBlAGAAUgBBAD0AJQAFAPH/zv+t/6X/lf+I/4f/iv+Q/5X/mv+f/7r/xf/e//L/BAAOAA0AHwAfABcAIwAnAB8AGQAUABgAIgAgABgAHQAUABgAEAAHAPz/8P/r/+r/4f/g/9f/1P/Y/97/1v/c/+D/6P/m//n/AQD+/w0AEwAMAAkAFQAaAAQA9v8CAP3/BgACAP3/BgD7//L/8v////L/6P/5////+/8BAAkACwAHAAgAEAACAA8AGAAOABgAFgAPABEAHAAHAPL/6v/O/9n/zP/T/+j/3//t/+f/6P/n/9b/7v/6/wUADQAIAAsACgAOAP7/EAAHAA4AKAAmACcAIwArACIAIgAIAPL////f/9j/3P/Q/8//0//Y/9D/2P/b/9f/3//o//j/+/8IAAgADAAMABEAAQABABcADwAOABEAEwAOAAYABwAOABUACwAIABIAEAAFAAgAAwDy/+//9/////j/9f/4//H/9f/6//D/9//4//H/8//5//j/+f////T/9P/9/wIA/f/x//7//v/y/+j/5f/0//n/9f8BAAgA9f/z/wYAAwD6////CAAGAP3/+/////z/AQD8//T/+//v//b/9//y//j/7//v//D/8//r//X/+P/4//j/+P/3//7/+v/7//3/DAALAAAA/f/7//r/9/8DAAwACwABAAgACQABAAwADQAKAAoA/P/9//n//f8GAAQA//8AAAQA+v/8/wAA+/////v/+P/v//v/8//6//v/+v/6//X/AQADAPz//P/+/woA///8/wAA9v///wYA9v/5//b/7v/4//L/7//o//D/+f/r/+3/8f///wAA8f/6/wYAAADu//z//f///wkABAAAAP3//v8JAAAAAAAAAAQACQAVAAcABgAGAPv/AwD2//v/AgACAPf/+f/t/+7/+v/p/+//9P/u/+b/+v/8//j/AAD2//n/+v/8//7/9v8CAP7//P/7/wAAAQAAAAAAAwD6//X/AAACAPv/+v/w//j/AAD//wYABAD7//f/9P/+//b/+/8JAAEAAAAAAAMAAAD+/wQABQAAAP3/AAD3//b////+/wAA/f/+/wMACAAIAPr/9/8FAAcABAD//wAA//8BAPv/9f/w//T/8v/x/+n///8AAPn//f8AAAYA/P/+/wEACQAFAAAAAwD+//z/AQDw//D/7//z//j/7//5/wMA/v/7/wQA+v/1//b/+P/4//r/9v/4/////f/5//f/9P/6//j/8P8AAAIAAAD8//3/AAD7/wAAAwD6//f/AAD3//X/8v/1//r/+P/8/wUADAD6/+z/9P8AAP7/AQD+/wMAAwADAPv/+/8CAP3/+f8AAPb/AwAIAPv//P/5/wAABQD1//j/AwAAAPX/+f/1//D/+/8AAAEAAAAKAP7//f8IAAQAAAD+/wAACAAAAAEAAADy//3/AgD8///////4//b/BAD2//r/AAD6////AAABAPj/8f/1//X//P/4/wMACAD4//P/9f/9//7///8CAPz/+v/3//f/AwADAP7/CAAGAP7/BQACAP//AwAAAA0ACwAFAP//AQD7/wgAAQD7//n/AgD9//r/6f/t//j/+//7//D/7v/7//r/9f/7/+7/+P/8//T/6v/4//f/9//4/+7/8//2//n////5//j//v/4/wUAAgD8//b//f8GAAMA+/////v/AwAGAP//BgD+/wAABwD//wUACAD+//r//f/+/wEA+f/7//T/7v////r/+P/6/wAA9//4/+7/7P/1//3//P8CAO7/7P/5/wAA+P/2//n/+v8AAPr/9v/4//j/DgAGAAYADAAIAA4ABgD8//j/AAD4/wAA///6//7/6v/1//z/9//5//7//v8JAAAA9/8HAAUAAwABAAAAAAD7//v/7v/9//P/9v/5//X/9P8AAPj/8f8DAPj/+f/3//r/AAD6/+7/9f/4//n/+//+//b/AgAEAAAA+P/9/wUABgD9//j/9f/1//z/+P/s//D/9f/s//X/+//9//j/8v/z//H/7f/v//P/9v/w//r//f8AAP//AAAIAAgAAAD0//3/AAD8//7//P8DAPr/8f/v/wQADwACAPP/+P8CAPT/AAD6//n/CwD3//v/AgAAAPf/+P8HAAAA/f/7/wMAAgD//wQAAwD9////+f8AAAIAAQD4////AwD+/wMA7//3//3/7/////j/+v8EAPj/+f/6//X/AwD9//b/AgDz/wIAAwD9/wAAAwD///v//f/0/wEA/P/6//r/BAADAPf/+P/+//7/AQD8//r//P8MAPr/9f8GAP//+v/7//r//f/9/wEABwABAPz////3/+///f8CAO3/9f////b//v8EAP//AAD5//f/AQADAPf/BQAAAAAAAwAAAP3/+P/8//z/9f/2//T/7f/3//X/7//4//X/+P/+//n/+P8EAPj/+P/4/wAA+P/+/wQA9//3//b/AgDv//H/AAD6//v/9f/4//n/8//4//r/+P/1////BAAAAP3/BQAIAAEA/f/9/wIA+v/3/wMA/f/7//n/DgAQAP7/9v////7/9v8NAAEA/f/7//X/CAACAPr/AwAHAAAABgD3//X/AgACAPn/+//0//j/+f////j/+P////j////w//L/CAACAPH/AgAAAAAAAwD+/wIAAQD//wQA+//5//P/+f8DAAAA+P/3////8//3//P/9//8//v/+v/5//X/+//4/wAA///5//f//P/2//////////j/AAAAAAcABAD+//P/+f/6/wEA+v/9/+r/6f/4/+z/9P/7//j/8P/8/wQA+v8EAPb//P/8////9f/v/wcABAD///3/AQAAAAYACQD9/wwACAD8/wEA///v//r/+f/z//f/+P/4//X/+v/9//T/9f/w/wAA8f8BAAAA///+/wAACgD8/wYADQAJAPf/BAAFAPj////y//D/8P/w/+v/6//4////+P/s/+//9f8IAPT/+f8GAPX/+P////7/+//0/wAAAAANAAMA/f/4//r/CAD0/wAAAgACAP3/9v/5//j//v/5//X/BwD4//3///8BAPj/EgD///r/EgD///n//v8AAPz/CAD6//j/9//6/wgA9//8/wUA9v/8//H/9P8BAPj/9f/1//j/7f/0//f//P/6/wUACQADAPz/AgD+//r//P8DAPv//P/w//3/AgD+//7/BwABAAAAAAD5//j/+P/v//b/CAADAOz/9/8JAP3/8v/8/wAA/v8HAAIACgD8//L/AAAGAP3/9P/8//z/7//6/+//7P/6/wYABgABAPr/BgAFAAcABgDx//r/AAAAAAAA6P/7//3/8f/4/wAAAAAAAAAAAQAAAPn/+P8GAPD/8v/9/wkABAD8/wUA+P/z//L//f/3//D//v/y//P/8v8DAAQA/v8FAAAA8//z/+//+f////z/AADz/wcABgAAAAAABQAIAAEABgAAAPr/+//5/wUA/v/q//j/DQAGAOP/8v/+/+//7//i//j/+P/x//P/7P8BAPz//P/9//H/6f/4//j/+P/x/wAABQD8/wsACQD2//7//v/3//L/6f/1//D/+P/y//r/9v/0/wEA9P/2//3/AgAQAAcADgAFAAgA/v/4/wUA+f/4/wEAAgD//wcA//8IAAcADQAEAAEACAAIAAIAAgD4//n/BQD5//z/AgD9//3/9f/6/wAA+f/0//P/+//6//f//f8AAAEABgAAAAYAAAANAA0AEgAFAP7/CAD7//n/+P/w//7/+P/x//L/+//1/+3/+v8BAPT/9P/z//n/+v/9//X/7v/x//f/BAD3//n/CAAAAPj//v/3//f//f/z/+//6//y//7/8P/1//j/6v8IAAgACQALABAAEAAWABUAFQAcAAUA/f8LAAEAAAAFAP3/+P/x//D/9v/y/+n/8P/w//D/6f/w//b/6f/p//b/9v/x/+n/8P/+/+n/4v/9//j/+P/4//j//v8AAAAAAAAAAAAA+f/5/wYABgD4/wUABgD5//r/AADy/wIAEwD//wAA+f8AAAAA+f/5//z/AgACAAIABgAGAAAAAAAAAAYA+f/5//n/BQAGAPr/+f8FAAQA/v/q//j//f/4//j/+P/4//7/6v/4//j/+P/4//j/+P/x//H/9P/+//j/DQAAAPn/DQD5//L//v/+//H/+P/4//7//v/x//j/+P/4//j/+P8AAAAAAAAAAPn/AAAMAAYA8v/5/wYAAAD5/wAABgD5/wAAAAAAAAAAAAAGAAAA8v8AAAAABgAGAPn/AAANAAYA8v8GAAAA8v/4/wYAAAD5//n//f8DAAIA/f8CAAIACQAAAPn/AwAAAAYABgAAAAAABgAGAAMA9f8AAAMA9f8GAPn/AAAAAAAA8v/5/w0AAADy//n/AgD6//j//P8DAAMA/P8JAAYAAAANAAAA8v/5/wAABgD4//n/AAD8/wIADQAAAAAADQAAAAAAAAAAAAAA8v8GAAAA+f/5//n/BgAAAAAAAAD4/wYAAADy//3/AgACAAYAAAD2/wIADAAGAAAABgAAAPn/AAAGAAAAAAAAAAYA+f8AAA0A9f/y//n/AAD5/wAABgD5/wAAAAAAAPn//P8CAAkABgD5/wAABgAAAPn/+f8GAAAA+f8AAAAABgAGAAAABgAAAPn/AAAGAPn/8v8AAPn/AAAGAAAABgAAAAAABgANAPX/CQD8//b/+f/y/wAADAAMAPX/AAADAP3/+f8GAAAA+P8AAAAAAAAAAAAAAAAGAPn/+f8AAPn/BgAAAAYABgD5//n/AAAAAAAAAAD5/wAABgAAAPn/AAAAAAAAAAAGAAAAAAAAAAAABgAGAAkA/P/1//z/AADy//n/BgAAAAAABgAAAPL/AAAAAA0A+f/y/wYAAAAAAAYAAAAAAAYA+f8GAAAA+f8GAPn/+f/x/wMABgAAAAAAAAAGAAAA+f/5/wAAAAAAAPn/AwD1/wMACQD8/wkA/P/8/wkAAAAAAPz//P8QAAYAAAAGAA0AAgD8//z/9f/5//n/BgD5//n/AAD5//n/9f8DAAkAAgD8/wIACQANAAAA+f/5/wAADQD5//n/AAAAAAAAAAAAAPn/BgD5/wAADQAAAPn/+f/5//z/9f8JAA0ABgDy//X/CQAAAPz/CQAAAAYA+f8GAAwAAwAJAP3/AgACAAMA9f/8//z/7v/5/wAA8v/u/wkA/P8DAAMA/P8QAAYABgAGAAAAAAAGAAIA/P/8//z//P/5/wAAAAAAAAAA+f8AAAYAAAD5/wYABgAAAAAABgAAAPn/+f/5/+7/CQACAAIAAgD8/wkAAAD8//z/AwADAA0ABgD5/w0ADQD1/wIA/P8DAPz/7v8AAPj/+f8AAAYAAAAAAPn/+f8AAAAAAAAAAAYAAADy/wAADQAAAPL/BgAAAPL/AwADAA0A+f/5/w0AAAAAAPn/AAANAAAA+f8GAPL/AAAGAPn/BgAAAAYA+f/y/wAABgD5//X//P8KAAMAAgAGAAAA8v/8/woABgD5//z/AwACAAIAAAAGAAYAAAAGAAYA+f8GAAAAAAADAPX/+f/5/wYA+f/4/wAAAAAAAAAAAAAAAAAA+f8AAAAABgAGAAAAAAAAAAYABgD8//z/AwACAPz/9f/8//n/AAAAAPn/AAD5/wAA+f8AAA0AAAAGAPn/+f8GAAAAAAD5/wAABgAAAPn/AAAAAAYABgAGAAMA/P8DAPX/+f8AAAAAAADy//n/AAAAAAYAAAD5//n/BgD5/wMAAAD1/wIAAgAJAAAABgAAAAAADAAGAPj/AAAGAPj/BgACAPz//f/5//n/+f8AAAAA+f/u//X/EAD8/wMAEAAGAAYA+f/y/wYAFAAGAPz//P/8//z/AAD5/wAAAAD5//n/AAD5/wAADQDy//X/CQAGAAYAAAD5/wYADQD5/wAAAAAAAAYAAAAAAPn/8v8AAAAAAAAAAPn/BgAGAA0A+f/5/wYABgD5//n/BgAAAPn/8v8GAAUA+f/x/wIADAAGAAYA+f/5/wAAAAAAAAAA8v/8/woA/P/8/wkAAgAGAAYAAAAAAA0AAAAAAAAA+f8AAPn/AAAAAAYAAAAAAAYA+f8AAAAAAAD5//n/DQAGAPn/AAAAAAAA+f8AAPn/+f8DAAAABgAGAPL/9f8JAAYABgAGAAAA+f8AAAYAAAANAPn/AAAGAPn/+f8AAAAAAAD5/wAA8v/8/wMA9f8JABAA9f8KAAUABgAMAAAAAADy/wAAAAAGAAYA8v/5/wYABgAGAAMA+f/5/wYAAAD5//n/FAADAPX/AwD8//z/+f/5/wAAAAD5/wAA+f/1/wkABgAAAPn/AAAGAA0AAAD5//n/BgAGAAYACgD8//z//P/1/wAAAAD5//n/8v8CAAMAAAAAAPz//P8CAAoAAAAAAAAAAAAGAAAAAAAAAAYADAD9/wMA/P/2/wAAAgD8/wMAAgDu//n/BgAAAPL/+f8AAAYABgAGAPn/BgAGAPn/+f8GAAYA+f8GAAAA+f/y//n/BgAAAAAABgD5/wAABgAAAPn/+f8NAAYAAAAGAPn/+f/5/wAAAAAAAPn/BgAGAPn/BgAGAAAAAAAAAAYA+f8AAAAAAAD5//n/AAAAAAYABgD5//n/+P/9/wkA+f8DAAYA+f8AAAAA/P/9/xAAAAAAAAYA+f/5/w0ABgDy/wAAAAAAAAAAAAD5/wAAAAD5//n/AgADAAAAAAAAAAYAAADy/wMABgD5/wAABgAAAAYAAAD5/wAAAAD5/wYABgAAAAAAAAAAAAAA+f8AAAAABgAAAAAAAAAAAA0A/P/5/wAABgAAAPn/BgAAAPn/AAAAAAAA+f/5//j/AgAFAAAAAAD5/wAA/f/8/wIACQD9//z/CQAGAAAABgAGAAAAAAAAAA0A8v/5/wAA+f8AAPn//P/8//z/7v8KAAMA9f8KAAoAAgAQAAYAAAANAPn/8v8AAAAAAAD5/wAABgAGAAYAAwD1//L/BgANAAMA9f/8//z/AAAAAAAA+f/y//L//P8DAAMAAgD8/wMA/P8KAA0ABgAAAPn/+f8AAAAAAAAMAAAA+f8AAAYAAAAAAAAAAAAAAOv//P8NAAYA+f/5/wAA+f8AAAYA+f8AAAYAAADy/wYADQAGAAMA/P/5/wAAAAAAAAAAAAAAAAAABgAAAAMAAgD1//L/BgAGAPL/8v8GAA0A+f/5/wAA+f8GAAAA+f8AAAAA+f8GAAYAAAAGAPn/AAD5/wAABgD5/wAAAAAGAA0AAAAAAAAAAAAGAPj/+f8GAAYA+f/r//z/BQAAAPj//P8CAPz/AwAKAPz/AwAJAAAAAAAAAAAAAAAAAAYA+f/5/wYAAAAAAAAAAAAGAAYA+f8AAAAA8v8AAAYA+f/5/wAA+f/8//z/CgD8//z/CQADAAIABgAGAAYABgD5/wAADQD8//n/AAAGAPz//P8AAPn/+f8AAAAA+f8GAPn/8v/8/woAAwD8/wMAAgAFAAYAAAAAAPL/BgAMAPn/+f/4/wAABgAAAPL/AAAGAAAAAAAAAPn/BgAGAPn/AAD5//n/BgAGAPn/AAAGAPn/AAAGAAYAAAAAAAAAAAAKAPX/AAD5//n/BgAAAAAABgAGAPz/+f/5//n/BgAAAAYAAADy//n/AAAAAPz//P8CAAMAAwAKAPn/AgACAA0ABgD5/wAA+f8AAA0ABgD4/wYAAAD5/wAABgACAAMA9f/5/wYAAAAAAPn/+f/5//n//P/8/xAAAAD5/wMA/P8CAAkAAAD5/wIADQAAAAAAAAAAAAAABgAGAAAA+f8GAAMA+f8AAAYAAwD1/wAAAADy/wAADQD5//L/+f/8//z/CQAKAAAA+f8DAAAABgAAAAAABgAAAAYAAAAAAAYAAwD1//n/BgAAAAAAAAAAAAYAAAD5/wAAAAAAAPn/AAAAAPL/AgANAAAA8f8AAAAAAAD1/wMAAwACAAoABgAAAPn/BgAAAAAABgAAAAYAAADy/wYAAAD5//L//P/8/wkAAwD8/wIAAwD8//z/AwAJAAYAAAAAAPn/BgAGAPn/AAAGAAYAAAD5/wAABgAAAPn/AAAAAAAABgAGAPz/+f8AAPL/+f/8/wIA/P/u/wIAAwADAAMA/f8YAAwA+P8GAAYA+P8AAAUAAAAAAPn/AAAGAPn/AAAAAAYA+f/5/wAA+f8AAAYABgD5/wAA+f8AAAAA8v/8/wMA/P8DAAMA/P8DAAMACQADAAAABgAGAAYAAAAAAAYAAwD8//X/AAAAAPn/BgAAAPn/BgAAAPL/AAD5/wAA9f/8/wkA/P/8//z/CQAJAAMABgAAAPn/BgAGAAAAAAAGAPn/DAADAP3//f/9//X/8v/x/wYA+P/2/wkA9f8DAAMA/P/8/woAAwAJAAAAAAAGAAAADQD5/wYAAAAGAPz/AwADAPz/7v/5/wAABgAAAPn/BgD5/wAAAAAAAPn/AAAAAAYA+f/5//X/AwAJAPz/AwD1/wMAAwAJAAYABgAGAAYABgADAAMAAgD1//X/CQD8//z/9f/8//n/AAAAAPn/AAAAAPH/AAAAAP3/AgD9/wMAAgAJAAAA+f8GAAYA+f8AAA0ABgAAAAAAAAD5/wYABgD5//n/+f/5/wAA+f/8//z/AgADAAoAAAAGAAAAAAAAAPn/AAAAAAYA+f/5/wYA+f/5/w0ABgAGAAkA7v8GAAkA5//5/w0AAADy/wAA+f8AAA0AAAAAAPn/8v/8/wIA/P/8/wMACgD8/wMADQAAAAAAAAAFAAAA+P/5/wAAAAAGAAAA+f8GAAYAAAAAAAAAAAAAAPn/+f/y//z/AwADAAoABgAAAPn/+f8GAAAA8v/8/woAAgANAAYABgAAAPn/BgADAPz/+f/5/wAA+f/5/wYAAAAAAAAAAAD5//L/CQAGAPL/AwACAAAAAAAAAAYA8v8DAAYA+f/8//z/EAAGAPL/AAD8/wYAAAAAAAYAAAAAAAAABQD5/wYABgAAAAMAAwD2//n/BgD8/wAA+f8AAAYAAAD5//n/AAAAAAAAAAAAAAAA+f/5/wYABgAAAAAAAAAGAAYA+f/y/wYABgD5//L//P8UAAYA6//8/wYAAAD1/woABgAAAAYA+f/5/w0AAAD5/wYAAAAAAAAAAAD5/wYABgD5//n/AAAGAPn/+f8GAAYAAAAAAAYAAAD5//H/AAAGAAAAAAD4//n/AAAAAAAA+f/9/wMADQD5/wAABgAAAAYABgAGAAIA/P/1/wMA/P/8/wMA/P/1/wAAAAAAAAYA/P8AAAAAAAD5//n/AAD5//n//P8JAAAAAAAAAA0ADQAAAAAAAAD5//n/BgAGAAAAAAAGAAAAAAACAAMA/P/8//X/+f/5//n/+f/8//z//P/8/woAAwD1/wkAAwD8/xAAAgD8/woADAAMAAIAAwADAPz//P8CAPz/AwD8/+7/9f/5//L/+f8DAAAAAAD8/wMA9f8CAAoAAwD8/wIACQD8/woABgAAAAYADQADAPX/AAAAAAAAAAACAAMA/P/8//z//P/8//n/AADy//L/AwD8/wMA/P/8/wkAAgD8//z/CQAQAAYADQD5/wAADQD8//z//P/y/wAABgD5/wAAAAAGAAYA+P8AAAAA+f8AAAAAAAAAAAYA8v/x/wkAAAAAAO7/AwARAAAAAAAGAAYABgAAAPL/AAAGAAAABgAGAPz/AAAAAAAAAAD5/wAAAAD5//n/+f8AAAAAAAAAAPn/AwADAAAAAAAGAAAABgAAAAAAAAAGAAAA8v/5/wAABgAAAPn/BgAAAPn/BgAAAAAAAAAGAA0A/P/5//n/+f8AAPn/AAAGAPj/+f8AAAYA8v8DAAYAAAD5/wAABgAGAA0AAAD5/wAAEAD8//z/9f8CAAoA7v/8//n/+f8GAPL/8v8DAAMABgAAAPn/AgAGAAAAAAAAAAYAAAAAAAYAAAAGAAAAAAD5/wYABgD8/wMA/P/1/wAA+f/5/wYAAAD5/wYAAADy/wAA+f8DAAMAAAAAAPz/AwAGAA0ABgAAAAAAAAAAAAAABgAAAAAAAwACAP3/9f8DAPz//P/y/wAABgD5/wYAAAD5//L/AAAAAAAABgD5/wYABgAGAAAA+f8NAAAAAwD8//n/AAAAAAYAAAAAAAAAAAAAAAAA+f8AAAYAAAAAAAAABgAGAPz/+f/5//n/AAAGAAYA8v/5/wAA/P8JAAYAAAAAAPn/AAAAAAAABgAGAAAAAAANAPz/+f8GAPL/+f8GAAAAAAAAAAAAAAD5/wAADAAAAAAAAAAAAPn/BgD5//n/+f8AAAAA/P8DAAMABgAAAAAAAAAGAAAAAAAAAAAAAAAAAA0AAAADAPz/+f8AAAAA8v/5/wAAAAAAAAYA+f/5/wYABgAAAPn/AAAGAAAA+f8GAAYAAAD5/wAABgAAAAAABgACAPn/AAAGAPn/AAAAAAAA+f/5/wYAAAAAAPn/+P/8/wIABgAAAAAABgD4/wAABQAGAAAAAAAGAPn/AAAGAPn/AAD5/wAABgAGAAAA+f8AAAYAAAD5//n/BgDy/wAAAAD5/wYA+f8GAAYA+f8AAAAAAAAAAAYADQAAAPn/+f8AAAYA+f/5/wAABgAGAAYAAgD8//n/AAAJAPz/9f/5//L/+f8GAAAABgD5/wAA+f/8/wYAFADy//L/BgAGAAAAAAAAAAAADAAAAAAABgADAPb/+f8AAAYAAAD5//n/BgD5//L/BgAAAPn/BgANAPn/BgAAAAAAAAAAAAYA8v8AAAAA+f8GAAAA+f8GAAAABgANAAIA9f/5/wAAAAAGAAAA+f/5/wYA+f8AAAYA+f/y//z/AwACAAkAAAAAAAAAAAAAAAAABgD5/wAAAAAGAPn/+f8AAAYABgAAAAAAAAD4/wAABQD5//H/AAD9//3/AwAJAAYAAAD5//n/BgAGAAYAAAAAAAYA8v8GAAYA+f8GAPn/+f8AAA0A+f8AAAAA+f8GAA0AAwD1/wAAAwD8//n/+f/5/wAAAAAAAAAA+f8AAPn/AwAGAPL/AgANAAAABgANAAIA9f/5/wAADQD8//z/AwD1/wAA+f8AAPn/+f/5//X/AwAKAA0AAAD5/wAAAADy/wIAAwADAAYAAAAAAAAA+P8AAAYABgAAAAAAAAAGAAAAAAAGAPz/AAAAAPn/AAD5/wAAAAD5//n/9f/8//z/CgD8/wMACQAJAAAABgAGAAYAAAAGAAIA9f8AAAIAAwD8/+7/+f8GAPn/+f8AAPn/+f8CAAMAAAD8//z/EQAUAPn/AAANAPz/AAADAPX/AwD8//L/AAAAAPn/6/8DAAMAAgAJAAAADAAGAAYACQADAPz//f8CAPz/9f/1/wAA8v/y//z//P8CAPz/9f8JAAMAAgAJAAkAAAAAAAYAAAAGAA0AAwD1//n/BgAAAAAAAAD5/wAABgD5/wYABgD5//L/+f8GAAAA+f8AAAYAAAD5/wAAAAAAAPn/BgD5//X/AwACAPz/AwAKAAMABgAAAAYABgAGAAMA/P/8/wIA/P/1//j/+P/4/+7/AQACAPX//P/8/wMABAAEAAwADAAPAAgA+v/y/w0ADAD//wEA8//2//3/9v/2//7/9/8GAAAA+v8IAAkAAgADAAoAAgATAAsA9v8DAPv/8//y//X/9f/1//X/9v/z//v/AgD9/wQAEwAQABEAAwAKABQADAABAPb//P8JAPf/8//5/+T/5//9//b/8//0//z/AwALAAYABgAUABAAAwAJAA8AAwAJAPr/8f/4//f/5f/0//z/7//7/wIA/v///wcADwAPAAUAEwAZAA0A/v/2//v/+f/4//f/5P/r//b/8P/4/+////8AAAkAEQAPABcAFAANAAwADgAGAAQACQD6//H/9//v/+j/8v/s//D/AAD6//X/CwAGAA4ACAAMAAwADAD9/xEADAADAPv/8//5/+b/7P/6//D/+P/5//v/CgAEABYADQANABwACgAQABYACQD5//f/7v/6/+r/5v/f/+L/4//o//z/9/8AABAABQAUAB0AGgAdABYAEQAWABAAAAD+//T/+f/i/+z/5P/e/+P/7//4//v/AAADABMAEQASABMADwAVAA0ADgAFAPz/+v/x//b/8f/q//H/8f/v////8v8CABkAAgAAABoAEwAQAAkACQANAPv/9f/6//D/9//n/+T/5v/k/wEA/P/3/wAAAwALABsAHwASAA4AFAATAA0ACwAFAP3/8//q/+z/7P/s/+n/6//p/+z/AwAGAAEACgAaABsAEAAPABUACAAGAAMA8//w//X/9//v/+H/8//7/+//+P8BAAQABgAQAAoADwAdABkAGAAMAAMAAQDx/+T/8P/2/+r/8f/g/+7/9//4//7/+f8PABEAEAAYABQAEwAPAA4ADAAHAP//7v/p//f/7//o//P/7f/1//r/+//9/wUADgABAAkACgAQAAkACwAXAAcAAgAAAPH/9v/8/+7/4//r//7////+//X/EgAKAP7/DQAVABgACgAJAAAA///9//v/+f/w/+//8v/q/+f//f///+v/AQAKAAwABgAIAAgAEAATABkABwD//wsACgD//+//8f/x/+n/7P/0//b/+v/7//b//v8LAA0A/////w0ABQAFAAQAAwAJAP7/9v/9//z/9P/4/wAABgD+//j/AwAIAAIAAwAEAAsAEgAHAPn////+/wAA///2//z/9P/7/+z/6f/q/wIA/v/x/wAADwAQAA4AFgAIAAsACwAKABAACwADAPv/+f/4//H/6f/t/+3/+P/y//r/AgADAP7/BQAVAAAADgAKAAIABwAAAAQA9//2//b//f/9//b///////j/AwAAAAcACAABAA8ADAD3//7/BAD2/+v/AAAMAAUA9//w//b//v/2//P/+v8BAPv/AgAKAAQAEgAPAAEAAQABAAEACAALAP3//f8CAPv/9P/w/wQABAD3//7/9//w//T//P8CAP3//f/2/wgAEgAEAP7/CwALAAAABwAUAAkA/P/0//v/BwD6//v/9P/8/wIA/P/1/wAAAAAAAAAA+f8AAAAAAAAAAAAA8v/8/wYAAAD4//z/AgACAAkADQAAAPn/+f/5/w0AAAAHABUA/f/9/wMAAwADAPX/9f/1////+P/4//j/+P8CAPz/9f/8/wMAAwADAAMAAwADAAoAFQAGAAAABgD8//z/AgACAPz/9f8CAAIA9f/1//j/BgAGAP3/AAAAAPn/+f8AAAAA+f8AAAAA+f8AAAAAAAAAAAAAAAAGAAYAAAD5/wAAAAAAAPn/BgANAAAA8v8GAAYAAAAGAAkAAwD1//z/9f/5//n/8v/8/wMAAwD1/wkA/P/8/wkA/P8JAAoA+f8CAAIABgAUAAAA+f8GAAoA/P/u//n/AAAAAAAAAAD5/wAABgAAAAAABgAGAAMA8v/5/wYABgD4//L/+f/8/wMAAgD9//3/AwAJAAIADAAAAPn/BgAAAPn/AAANAA0A/P/1/wAA8v/5/wAAAAAAAAAAAADy/wIADQAAAAAABgAAAAAABgAGAAMA/P8DAPX//P8JAPX/9f8DAPn/+f/y//X/AgAJAAAA9f8KAA0ABgAGAPn/AAD5//n/AAD5/wYAAAAAAPL//P8DAAMA9f8DAAIA9f8QAAkAAAAGAAUA+f8AAAYABgAGAPz/+f/5/wYA+f8AAAAABgD5//n/AAD5//n//P8DAPz/CgADAAAABgAGAAYADQADAPX/AwADAPz/9f/1/wAAAAAAAPL/+f8GAPn/AAANAAYA+f8AAAAABgAAAPn/+f/5//n/AwADAPz/7v8DAPz/AwADAAMAEAADAAYAAAAGAAYADQD8//z/CQD8//X/4//5/wQA+f/p//X/9f8JAO3/AQD0//T/CAD7//r/9P8CAA0ABgAAAPj//v/0//n/6v8AAPH/+P/4/+r/7f/0/wEA+v8CAAYA/v8NAPj/DgD8//z/9P/8//z/8v/y//n/+/8CAPT//P8DAAkA/v8AAP7/+P8AAAYABgD7//T/9P/x//j/8f/4//H/6v/0//r/+//6//7/8f/6//7/AAAAAAAABgD4/wYA+P/5/wYAAAD5/wYABgD5//L/AAAGAPn/+f8DAAAABgANAAAA8v8GAA0A+f/y//n/+f8GAA0A+f/q//j/+P/+//H/8f/6//7/+f8GAAYA+f8AAAYABgAAAPn/BgAAAPj//v/7//T/9P/0/+P/+P8FAPn/8f/5//n//v/5/+b/+/8JAAIA9P/0/wEAAgD+//7/+P/4//7//v/4/wMA/f/9//z/8v8AAAAAAAD2//7/9P/w//j/+f/p//7/BgD5/wAAAAAAAAAA+f/5/wAA+f8DABMACAAIAPT/CgALAA0ABQAIAAAADgACAPv/9P/t/+T/9P/s//H/8f/4//b/6f/x/wAA+P/4//j/+P/x//7/AADy/wQAEQACAAgAAAAGAAAAAAAGAAYA+P/+//v/9P/0//r/7f/0/wAA8v/4//j/6v/4//j/7f/1//X/+//0//r/+v8KAPz/AgAJAPT/AwADAPz/CgAGAAYAAAAGAAoA/P/1//n/BgD5/wAAAAD5/wAA+f/5//z/AwADAPX/9f8DABAACQAGAAYAAADy/wYADQAAAPL/AAANAPn/+f8AAAYABgD5//n/AAAGAA0A/P/r/wAAFAAKAPX/9f8DAPT/9P/0/+r/6v/0//X/9f8QAP3/9P8CAPP/AQDy//P//v/4//j/BAAGAAMAAgD8/wMAAwAEAAsA9v/9//n/8v/5//z/CgD1//X/+f8NAAkAAwAJAPT/+v8JAPj/8f/+//7/BQDx//H//v/+//j/8P/p/+n/9v/2//j/+P8AAPH/8f8AAPn/8f/0/w0ABgDr/wMAAwAGAPn/AAAAAAEADgAAAAAAFQAGAAEABgAJAAMA7v8AAPr/7f/4//H/+P/+//H/+P/4//j/8f/x//r/9P/0//v/9P8BAPv/AgD6//v/+//8/wkABgAAAAgACAAAAPj/+f/5/wYAAAAAAAUA+P/4/wIA9P/t//v/7f/q//H/+P/4//j/8f/0//v/+//t//T/AgACAPT/AwABAP7//v/4//7/CAADAPz//P/1/wMA9f/8/wMA9f/5//n/AAAGAPj/+f/4/wAA/f/9/wIA/f8DAAIAAgAQAAYAAAD5/wAABgAAAPn/AAANAAAA8v8AAAYABgAAAAYAAAACAPz/8v8NAAIA9f/5//L/+f8AAAAAAAD1//z/EAANAAAABgAGAAMACgD1//z/9f8AAAAA+f/5/wAA+f8GAAYA+f8GAAAABgD4//j//f/t//v/9P/x//H/8f/x//H/AwDt//r/+//6//r/CQAGAPn/AAAAAAAA+f8FAA0ABgD5/wAABgAAAPn/+f8GAA0AAwD1//L/+f8AAAAA8v/8/wkA/P/8/wkAAwADAPz/AgANAPn/AAANABQABADt//z/AwADAPz/AgAEAPz//P/1//n/+f/y//X/BAADAAIA/P/8/xEAAgD0//r/DAAFAPv/9P/7/wIA7f/t/+3/8f/4//H/6v/+/wUA8P/4/wQA/v/1//X/+v/7//T/9P/1/+3/+P/4//H/6v/t/wgA/v/x//H/9P/0//T/9P/0/wIA+//7/wEAAQD+//7//v/+//T/+//6//T/9f/y//n/+f/5//z/9f/8/wIAAwACAAMACgD6//D/AAD+//7/+P8AAAYAAAD5//L/BgAAAAAABgABAAAABgAAAPn/AAD5//n/BgD4//j/+P/4//j/+P/9//j/8P/4//j/8P/4//D/9P8MAPn/+f8DAAAAAAAAAAAA+f8DAAAAAAAGAA0AAAAAAAYAAAACAPX/8v8AAAAAAAD5//n/AAD5/wYAAAAAAAYAAAAAAA0AAwAJAO7/8f8GAPn/+f/5/wYAAAAAAAAA+P8GAPn/+P/+/wAA8f8AAP7/AAD5//n/8v/8/wkA/P/7/wMA+/8JAA0ABgD4/wYA8P/5/wAABgD4/wwA7f/x//7/+P8AAAAAAAAAAAAABgDx/+P/BgD5//z/AwADAPz/+v/8/wIAEAD+//n/8f8NAP7/8f8GAAYACwABAPz/7f8LAO3/8v8GAAYA9P/x//j/AADx/wAA+P8IAOr/9P8BAO3/7f8CAAEA7f8DAAIAAgD7/wMADQAOAPj/AAD+/wsA9P/x//b/+v/0/+7/+P8NAPL/9f8DAPX/8v8AAAYAAAD5/+j/BgAOAPD/9v8GAPv//P/l//n/CADx//L/BgCeAG7/eP+eAGEAbP8bAHv/jABF/+3/qf/J//b/6P+xAJ0AoP8iALL/3P8JAPb/QAAAAOb/FgABAMoAFACi/0YAcf/O//j/AACmANj/9v9BAOL/5P8MABMACgDF/93/BADV/1kAAgD1/wwA3P/y/+r/9f8YAPb/YACIAIQA5v/x/5j/mf+q/7j/+P/F/8H/5v/W/3YABgATAEwA5P9k/9n/6P/u//D+8P8gACn/gf84AEkAFQAdAIEAVADU/+z/egATAOv/4f81APj/yP8tAIMAAgBSACUAbAAVANn/eABJAND/8f+h/9b/sP9m/ysAEQDb/1gA/P/7/w0A6P8YAP7/7v8QANn/9f8BANX/8f8gABAAOQArAEYARgAGAD8APgAMAAgAwP+5/6L/pf/D/47/iv/l/7j/ev/Z/9f/zf+w/+n/0P/Y/3v/7P/o/+D/jwCDAKkA3QDFAMAAxwCqAJYA1QDDAGgAbwAeANj/fv9L/0j/6P6l/rH+8P5h/qj+oP6I/oP+i/6S/qH+WP7K/gj/xP7k/0wAyQCIAjcDuANiBJgERAQKBC8DkQIkAvsAZQAtAE//IP/Y/pr+Y/4z/gb+LP73/cT9/f3g/dH91/2r/ez93v3L/ej9D/5s/iX/nv/cAEYCogJ1AxwECATRA2kDvAI9AoUBnQAyAOz/a/8C/0//A//s/h3/D/96/2H/YP/H/1z/OP8v/9n+qv6p/mP+bf6L/mj+e/5o/n3+ev5q/nn+Vf9J/woANgF7AQ8CGAMdAzkDVwPtAnECAwKsAfoApQBlANr/s/+//3D/dP9j/3T/q/+D/6b/9f+u/5v/of8Z/wD/2f5s/mz+H/5e/vr9sP5o/on+z/4x/3X/Nf8uAJgApwA6AcgBzgEwAooCJgIuAhcCewEfATwBnAD9/yIAy/9e/47/gv9f/4L/ov+J/63/vv+j/5n/dP80/x//PP++/q/+3/51/pn+L/79/sj+FP6A/vf+Rf+P/7wABwHfAY8CnAJDA0EDxQJ6AmECbwETAcYAKwD2/5X/Lv8Q/27/Kv8b/3n/nf+F/5T/x/+o/4D/U/+g/pn+z/5X/rL9D/4W/uD9Vv0d/hD+l/0b/jb/rACDASQCSAMIBHAEdwToA5gDMQMfAlABEAE0AKj/bv9f/wT/Nv+R/4H/pP/4/xQA5P/+//D/JP/9/sf+1P3J/Rn+Df0A/dr9hf2g/e79tP3Z/Zr9hv0B/iIAwAF/Am4DrwRgBZAFCgUMBIIDtwJQAfL/Q/9H/wH/tf7k/m//DwAnADoAngDoALEAOQAcAH7/Dv9Y/nL9YP3A/TD91fx1/aX9uf37/dH94/18/Rr9f/1p/3oBWAIKA1wElwUHBkwFZgTlA+MCugEyABP/Cf/b/nj+Xf6+/nT/1f8qAIEA1gDkALEASACi/7/+Pv6K/bv80fxe/Qj96fyQ/fH9JP4r/sn9s/2l/Vj9tv3z/5sCsQP4AyoFbwbNBsgFiQTwA/YCvAETAEb/Nv/c/nb+SP6o/kT/6P+GAPcADwFMARMBeQDV/wP/SP6L/cn8r/w7/f38qvwi/X/9pv2W/Xb9aP00/Z/8oPyy/vABhQOvA7sEgwZlB3YGBwURBBoD7QEsAPP+yv6o/oP+iP69/kP/EwDVAEkBUgF5AUEBwQANAA//Qf5//cb8kvz4/Bf93/wc/XH9xP3C/Yb9LP0U/dL89/zE/q8BhwMQBNwEKQYgB3sGCQW/A8QC4AFyAOv+UP5q/nD+ff6j/kH/PgDxAFwBYwGIATABXQCP/5/+yf0K/WX8FPxy/Ov84PwJ/Wz92f0M/vH9ff1J/T39Wv08/psAEAMqBLcEpAXdBtkGuAVWBGgDcgIvAcj/yv6e/ov+bf6N/gP/ov9JAMQAUAGLAZQBFAERAHX/wv4A/hb9Zvxj/K/80PzN/B39qP0S/jj+Fv7G/aD9T/3t/Lj9VAB/AqEDXAQpBmEHBAd2BRoEXwNLAtIAL/+g/tf+2P5Y/nb+X/9eAMcA7QB0AR4CEwLmALj/Yv/X/s793vxb/KD81fzg/Mz8Q/3o/Tv+P/7//a79b/3E/Gj8FP2S//gBdQPUBLwGzAc0BwYG0gTNA1kCtQBc/8j+zv6a/j3+d/5i/xAAVgC+AEwB4gG7AbQAr/9Y/73+rP0h/eH8Av0e/TD9Tv2r/Qf+Cf4X/kH+Hf7O/VD9Fv13/fn+jAF1A40E/QV7B1wHOwYpBdwDYgLQAIj/nf5Q/lT+JP4s/vH+1/9IAIoAGAGvAaQB6QDI/1T/H//k/Qn97fy7/Ij8mPze/Bf9Z/2u/dP9W/5t/jj+1/18/X/98P3w/5AC3AOvBFcG1QdMBysGMwX/A2QCpQBh/5v+U/7q/a79M/4f/7r/HQDqAI8BzAF7AaAAhf8p/4n+Mf22/MP8lvx7/M/8Lv1o/cr9GP6E/uj+sf5r/iL+zP2o/W/+1gD6AtAD5wSsBm0HZQaKBd0EgQOUAQoAOf+d/jH+2/0+/gX/j/85ACEB7gHeAbsBZQFyABz/Yf5//bf8Y/wV/B38ePy//Pb8c/3n/ez9PP6o/pn+EP6Z/YD9zP0f/4sBMAMgBMAFJwfrBhgGpAWiBNMCYgFEAE3/qP5J/hL+S/63/iT/0P+wAEIBXwEsAe8AMABI/7z+Ef5f/dT8mPy+/MH87/x2/Qr+Uv6G/hf/af9B/6v+Fv7m/eP9uf6DAJgCqQP4BI4G6gYwBpkF1QRLA5IBWQBU/4z+JP7s/Q3+lv4l/6b/PQDiACkB8QCdACQAR/+P/gr+Xv3E/I/8fPyG/Kb8Jf2k/TH+lP66/iH/OP+I/iT+D/7N/YP+ggBZAiADigRRBoIGCQbWBSgFdQMYAiUB2f/c/rf+gP5X/vj+m//A/yEAxgDiAJUAgAAiAE7/1v5x/rD9Kf0G/dX8rPzV/CD9af3+/X7+mf4F/2v/3P6V/qT+NP5e/gcAywGQAq4DpQUZBsgF5gWvBVQE/QIlAswAfP8I/5v+Iv5M/t3+Ff9M/xAAgAB0AGAASQCb//7+lf6X/R/93/x2/Gb8sfzp/Cv96f2H/pL+Vf8GAFn/xf79/jj+uv0t/8gAXwGQAtgESgVYBS4GEAahBOsDTAOWAT4A9/8y/0z+Rv7D/vr+IP/7/8QAogCxANYAJwBF/w//VP5U/Qj94fx2/JL8+fwe/Xj9Dv6L/rr+N/+0/y7/z/7L/jj+Ov6V/9gAdQHsAokE0AQoBbAFKAXXAzoDggLNANz/iv/H/jb+OP6S/vr+O/8IAMMAxADTAPcAUgCB/0j/k/6h/TT99PyZ/IP8gvz3/GH9v/2A/vv+av+//27/Uf8Q/4r+BP/F/5sAyAEdAxME1QRYBZMFIgWBBLwDzAKXAa8A2v8f/7v+Sv5F/rH+4v50/zAAcgCgAMAAXQDA/1r/nv4B/ov9Gv0B/eD8s/wQ/Wj90P2A/gL/jP/l//H/w/+F//T+PP+Q/1sAewFAArwDnwQPBbgFnwULBW4EaAMoAioB/v/3/nf+wv19/cb90f1Y/gz/Uf+4/wQAsf9a/0r/VP4C/qj9qvyq/F/8YPzD/Bn9tf2W/hL/qf89AFAAMgAIAHf/J/+A/9n/4AC7AbAC/gOvBGEFlwVoBegEIgQwAxYCDwEQAFL/rv4V/hr+Df4+/tD+NP+L/+X///+o/5//Pv9//jj+jf0M/e78q/y1/BD9b/0Z/sH+I/++/wsAFgAJAML/ZP+J/8X/cgBfAQACFwPlA5AECwUNBc8EMwRbA2gCagFvAGH/v/4P/rn91f3L/Tn+8/5m//D/KwBAAA4Amf9A/7T+7v1q/Qv9rPyK/Mj8Cv2C/UH+0P5K/+X/KQA/ADAA3/+N/5n/4v+qAHcBKAJwA9YDgwQkBdsEzARTBE8DcAJbAVgASf+N/hj+i/21/dD9F/7k/kT/s/8XABwA+P+g/0H/2P47/tP9gf0u/Qr9NP1o/Z79Zv7V/j3/6f8gAFAAYQAcAOn/8/8mAKMAPgELAuwCIAPbA2sENwQmBOcDCgNMAnMBQQCN/47+KP7N/bj9GP5I/rn+lP+6/yQAYAALAOj/hP/v/mH+0v15/Rf9vPz7/Aj9Lv0T/nP++P6///r/RABLADgAFgApAJgA+QCIAXgCGgNiA0AEeASQBEEEuQMtAx8CQAE3AD//hv4V/pL9kP3b/eT9ZP4l/4j/yv9AACAA0/+l/xj/eP4a/k39KP0H/cP8Mv1n/QH+hP7z/qH/4P8WAGUAPgAmAIsAqwACAcYBgQIHA6EDHwR4BJ8E9gPUAyEDHAJ+AWwAn/8E/17+Af7x/QT+Ff54/vj+Tv+c/+D/u/+I/03/yP5o/u79S/1Q/Rb9Nv2Q/c/9mP74/nj/FwD6/zcAQAAKACMAIwCQANIAeAE5AogCdQO+A/YDVASxA4ADDAP8AXIBbgB5/wL/Qf7b/dj91P3+/Vn+u/4v/2D/xP+h/3v/bf/R/pr+LP6O/b79UP1h/cX9yf2I/sP+OP8DAMT/PwBWABYAVQBYAMEA9ACgAV4CqAKSA7cD7gMyBHcDNAO9AqkBOAFIAGf/Gf9m/iX++f0g/jD+bv4j/1z/w/8qANL/9f+q/yr/Cv9D/un92P1b/bX9uv3z/Zb+tf49/6z/xP8eADcA/v8JAAkAkwCVAD8BRAJBArQDmAPFA1MEdwNTA7ICswFEAS8AYv/t/kT+AP68/ez95f1T/s3+Df+P/+3/xP/E/57/PP8F/17++v3g/Wr9rf3U/RD+n/7s/nv/4/8WAEYAWQA5AC4AKQCHAIgAKQH1AQ4CUwNKA40DEgRxA48D/wI2AtIBnADw/3H/cf5I/uP98/0O/kD+zf77/nL/x//J/7T/m/9V//P+dP7u/aX9Yf1c/Xn9rP0s/oP+8/5g/6L/3f/z//b///8fAJUAsgBvASQCSQJPA2cDuAMYBNEDggM/A3ECvQHyAAsAbP+p/j3+Cv7t/fj9WP6v/vP+V/+b/7P/hf94/0L/yv6i/hj+8f3X/Zj99P0G/jf+uP7u/l7/jP+8//L/6P/w/ygAmQDAAHIBAwIyAhgDWgNxA/IDkgN5AyMDUgK/AeYAEgB7/8b+Q/4C/uT95/0o/n3+s/43/4H/n//L/3j/ev8g/9j+hf46/vb9+P0I/hL+av68/gr/dP+4//z/IwAIAEAARwCpALgATQHpAdMB5QIJAykDwANYA3sD8gJdAtEB2QBfAIr/Df+Q/iv+PP4y/jX+pv6e/vr+K/8a/0n/E/8F/77+Xf6e/uz9Hf4u/gb+ef6K/ub+Mf9s/7v/3f/a/wgAEQCAAKcADAHMAfABlgIVAzQDsAN9A3kDDwNuAgsCCAGYAL//MP/S/jj+OP4J/gn+j/6A/uD+eP8v/7P/hf9A/z7/i/5V/v79q/2q/ZD9vP3y/UT+pv72/iv/gf+y/y4AUgC7AKABqQGGAhgDdwPoA+MD+wN+AzADogLlAXEBmwBFALL/RP8Q/3/+Zf5V/iz+O/54/mr+8/7u/uP+NP/f/un+vP5l/nb+If4r/hP+FP5O/k/+zf77/j3/ov+y/0EAogDnANgBIALOAmoD9QMeBAsE7AM4A98CBgJLAeIAAgCy/1D/3P6v/hj+6/3c/bn9Bf5Q/mf++f4X/w//Tv8H/w//3P6e/p3+Rv5H/kP+HP5U/kv+pf7p/gP/fP+Q/y0AtgAdATgCtwJ1AxMEaQR5BA0EjQP+AjYCtQEqAX8AKADR/0P/5P6B/iD+PP4v/mf+zP64/jb/N/8J/1D/yf7A/pf+Kf4w/tn9yf3T/cr9MP5O/sr+K/9H/9D/3f9HAAQBVAGTAhcDlwOEBAUECASgA+oCpALmAZwBAwGDAE4Afv9A/8r+SP6F/ir+a/6q/or+Gf/q/gL/HP+w/rX+Yv4M/tT9gP1a/WL9if34/Ur+rv4i/1f/vP/Z/xwA+ABEAVsCPANjA5EEOQQWBAIEKAMYA1UC7wGCAaoAjgC6/0n/8P5o/mz+Kf4k/lH+OP6Y/oL+uv7G/qn+uP5u/mj+Hv7Y/dH9uP3g/RD+Sf6s/uT+CP+G/5L/SAD+AGIBtQI0A8ADeATYAwgEkwPuAtYCzgGvAf8AXQBHAGD/QP/Q/nn+mP5G/ob+f/6X/uz+yP4b//r+Hv8I/8z+rv4x/hf+xP3L/en9DP5c/p/+8f5Y/6f/9f/LAC8B2AHdAgkDywPEA1IDcwOxAp0CFwJlAWABiQBoAPX/Vv9c/9L+1P6t/oj+1v61/vT+6P7s/ur+yv7N/p7+T/4U/vD9xv3V/fT9QP6R/r/+OP92//P/OwDPAFQBowFNAqUC3QIcA88C0AKrAjcCEQKNATgBugBWACEAkP9f/x3/6v7r/sD+2P7t/uL+Av8E/w7//f7x/tD+pP5s/lz+W/5C/nL+lf7F/ib/T/+t/wwAUADyAEgBsAETAowCpQLQAroCgQKPAhAC2gFzAfIAngAuANX/Y/8n/xT/zv7G/sz+rv7B/rv+yP7P/sT+y/64/pz+if56/pj+gP54/pX+uv7F/mb/ff8cAIkAugCQAakB8QFqAn8CoAKKAnwCSAIpAq8BXgEKAYoATQC8/13/O/8D/9f+rf6p/qH+lv6a/pL+oP6g/qD+qP6x/qX+rv6//tH+wv71/gj/Kv+w/+r/WwDLAAsBkQG+AQcCGwIdAikCFALgAbsBXwEhAeoAgABGAOX/r/+L/13/Vf83/0T/OP9D/0D/Jf8x/xH/Cv/m/t3+6f7O/uD+z/7P/vX+8/5I/5j/zP8vAHwAvQAKASYBUAFSAV4BWAFNATUBFwHtAMQAqgBuAGYAMAAbABoA9v8LAO//9v/n/9T/1/+q/6T/Zv9D/zP/+P7x/t3+4/7W/uf+7/4B/0L/eP/J/wIAWQB6AKkA4QDJAPoA4ADYANgAqgCYAHgAQAAsABEA8P///87/9P/6//D/IwAQAD0AKAArACkADAAOAM7/uv+A/3H/Xf9B/0X/Ov86/zv/ff+4/+j/EABGAHIAdwCKAJEAhABtAFgARQAoAAMA9P/e/8z/0f/Q//f/+v8RACQANABAAEkAWQBeAEsARwA2ABQA8v/i/83/xv+x/7T/sf+//8X/z//c/9P/1f/l//P/+v/r/w8A/P8HAO3/2P/J/7H/v/+n/6//x//g/wAABQAWACIALgA1AB0AJgA7ACEALgAXABQA/f/u/+j/z//i/+L/8v8AAAUAJwAbACwAMAAzAEAAHgAdAPv/+P/n/9P/2P/B/8v/xv/L/8X/v//X/+L/9f/7/xMAFgAlACYAKgAgAB8AIAAUABEAFQAKAAMA/v8AAP3/AAD0/wkABQAQABYACAARAAUABQAHAO//7v/i/+r/4P/Y/9v/2f/Y/9j/1P/h/+3/9f/1/wIADgD2//P/CwAPAAkABgAHAAwACwD7//r///8FAAUA//8GAP///v/3//7/DwAJAAMACQACAAUA8v/z//L/5//2//D/4v/n/+f/7P/m/9r/3f/o//L/7//z/wEADQANABgADQAIAAwAEAAGAAgAAQD6/wUAAAD5//D/AwD9//r//v///wYAAAAGAAEAEAAVAAkAFwAgABgAAADx//b/9v/s/+v/6f/d/+P/5v/0//r/8P8CAP3/AAAJAP7/8//4/wIA9/////3/9f/5//P//P8EAPb/8v8DAAMA8//4/woAAQAEAPr/AAD8//3/AAD+/wkABgADAAIABwAEAPP//v/4//r//v8BAAUAAADy//j/+//w//j/6v/m/+z/8P/3//H/6f/8/wMA9/8CAAYACQAFAAoA/v/3/wEA/v///wAA9P////D/BQD5/wUABgD6/xAACgAHAAwAAQD8/wYA/v///+7/7//0/+z/8f/x//L/8//v//T/+P/4//j/+P/1//v/7//y//j/9/8JAAAA/P8GAAIACAAAAAcADAAOAAMABwAGAAkA+f/v/wEABAAAAAIA+v/8//X////4//X/+v/7//7/8P/z//f/8v/s//f/5v/t//H/7P/s//D/+P/7//n//P8IAAgABwAAAPn//v/7/wAAAgAKAAIACAACAP7///8CAPr/8f8FAAEA/f/z//r//f/9//P//f8IAPf/7//4//j/8//6//f/8f/4//z//v/5/wAACQAFAP//BwAAAAQA/v/6////AgAAAP3//P/7//j/AwD7//3//v/1//D/5//q/+v/7//+//D/9f/0//X/+//6////BgAAAPn//f8IAAYADQAMABQABwADAAUABgAFAAAA9//4/wMA+P////7/BAD7//z/+P/t//n/7f/7//3/9v/0//f//f/+//r/9/8BAAAA+P/8/wMABgACAAkABwAIAAsAAwD8//n/BgD//wMA/f/5/+7/9f/8//7/8P/x//j//f/4//T/8P/1//n/9//z//j/+P/7//X/8v/1//f/9P/6//z/9f/5//b/9P8HAAAAAwAGAAIA/P8AAAYAAAABAAIA/v/+//X/+f8DAPv/9f/3/////v/+/wIABQAEAPr///8NAAwA+/8AAAIA//8AAPv/+P8AAP//+v/7/wMAAAD8//7/AAADAA4AEAD8//f/BQAIAAEA/v/7/wAA+//5////+f/w//z////7/wYA+//9/wwA+/8IAAkA//8NAAkAAQD4/wIAAgD5//r//f/6//7//P/6//3/AwAAAAAABAAAAAAAAQD5/wgA///z/wAABgADAP7//f8AAAQA/f/9//3//v8GAPv//f8AAAMACQAAAPv/BAAJAPz/9/8CAPj/8v/+//j/+v8AAPz//f8DAAAA/v8HAAkADAAAAP//CAAJAAkAAwACAPL/+P/7//T//P/9//T/9//7//7/AAAFAAAAAgAJAAgACgAGAAEACwADAP7/+//9//f/8v/5//j/AAD7//v///8DAAEABgAKAAYAAwD9//z/AgACAP3/+//0//n/AAD8//j/AAAEAP3///8GAAIACwAEAP3/BQAIAAoAAAD7//b//P/6//n//P/4//3/AAD+//v/AQAIAAEAAgAKAAgA/v8AAAAABAAFAAkAAQD8//T/+v8DAPv/9P/2//r/AAD5/wEAAgABAAMABwALAAAA/v8FAAAAAQD///7/+//8//z/+v/2//3/AwACAAYA/v/7/wQAAwACAAcABAD9/wYAAwD+/wMA+P8AAAIA/P/2/wAACAD6//z/BQAAAAIABAAJAAcAAgAEAAMA+/////3//v/7/+r/+v8DAPD//P8GAP3/AAD+/wIABQADAAUACwABAAAA/f///wkAAgD8/wMA+P/3/wIA///6//v////5//z//v/4/wAAAAACAAAAAAABAAgABwD3/wQACwABAAMAAQACAAUA///6//3/+f8BAAAA/P8DAPn//P8BAPX/+P8IAPr/+P8FAAUA/v8IAAIA9P8EAAIA+f8HAAIABwAAAP//CgAAAPX/AAADAAAAAADz/wIAAQD5//3//f/5/wMA8v/w/wMACQD+////CAAAAAAACQADAAIACwD9//f/+f/6/wUADAD7//v///8BAAIABgD2//z/AAAEAAQA8v/5/wwA/P8BAAUA9f8CAPv//P/8//z/9P8BAAMA/v/9/wAABgD9/wsABQAFAAMA/v8FAAkABgDy/wAACgD+//f/AwAAAPP/+P/7//v/+f8BAP7/AQD0/wAABgAGAAAAAwAEAPn/BwABAPv////6/wEABgD6//n/AAAGAAwA///9/wMAAAD9//7/AQD+//z/9//6//z//v/8//r/AQADAPf//f8BAAcA/P/7/w4ABwAIAAsAAgD9/wAABAD3/wkAAgD3////9/8AAPj/9v8AAP7/+P/7/wMAAQD+//r/BwAAAPj///8AAP3//f8AAAEA+f8CAAcABAD+/wAAAwAKAP7/AwD6//7/BQD///7////x//H/AQD7//D/AAD9/wEAAAD2/wQA/f/4/wkAAAAAAAUACQABAAEACwAKAAYAAwD+//7/BQD5//j/+f/0/wAA+//5////AAAAAAEA/f8AAP3/AQALAP7/CAAFAPT/AQADAPr//f/+//v////8//z/9/8GAAIA/f8AAAQAEAD+/wAACgAEAAMA/P/8//z/9v/s//n////4//z/9v/8/wMA/f/9/wgADgAFAAYACAAIAAYA+/8GAAAA9v////n/+//4//b/AwD4//T/CAAGAPL/AwAEAP//BgAMAP///v8FAAMA+P/0/wAA+P/w/wEAAwD3//3/CQAIAAIABgAHAAAABQAFAAMA9/8AAAYA+//7//z/AAD6//P/AAD///H//f/9//3/CQAIAPv/AgACAAMA/v8EAAoA/P8EAAMABAAAAAEA+/8AAAQA/v///wYAAAD6/wYABgD8//n/BgD8//j/+P8GAPT/9P/8/wAAAAD9//7/AgAIAPz/AgD8/wMAAwAJAA0AAAAGAA4A9v8AAAkA/P/2//n/+f8AAPn/8//9/wIAAQACAP3/AwADAAIAAgAGAAAAAAAGAAUABgD5/wAABgD5/wAAAAD5/wAAAAAAAAAAAAAAAAAAAAAAAPr/AAAAAP//BQAAAPn/AAAGAPr/+f///wQABQDz//v/AAAFAP7///8GAPr/+/8AAP//BQAEAAAA+v8AAPr/+f8EAAUAAAAAAAYABQD//wAAAwDy//n/BgD4//j/BgAAAPn/AAAFAAUA+P8GAPr/+v8AAAYA//8FAAUAAgADAPf/+v8GAP////8CAPn/+f8AAAYA8v/z/wMAAgD7/wIACgD9//z/EAAGAPr/AAAGAAUA//8FAAIA8//6//r/AAD4//v/CQAAAPn/BwAGAAAAAAANAAAAAAAGAPn/BgADAPL/+f8AAAAA6f/2/wkAAQACAP3//f8DAAkADAAGAAAA+f8TAAEA+/8DAPb/8/8AAPn/+P8EAAUA+f/6//r//f8BAAsABQD6//r/BgD//wAAAAD5/wAAAAD//wYA+f8AAPn/AAAAAPn/AAAGAAAAAAAFAAwAAgD9//z/AgD8//b/8//5//j///8GAPL//P8JAP3/9f8KAAIACQAGAAYABQALAAIA/f/9//3//P/1////AgD5//P/8/8DAPz/AgAJAAYAAAAAAAYAAAAAAAAA+f/z/wMA/P8CAAkABQAAAAAAAAAAAAAAAAD//wUADAD8//3//f/8/wIA+//8//z/8v/y//n//P/8//b/9v8AAA0AAgADAAkAEAANAAYAAAAGAAIAAgACAPX//P/8/+//+v/z//n/+/8IAAwA7P/+/wMAAwACAAgADAAGAPn/+f8AAAAA+f/5//z//P8CAPz//P8DAAIACQAJAAYAAAAAAA0AAgD1/wAAAAD4/wAAAAD5//L//P8DAPX/AgACAAIACQADAAAABgAGAA0ACQD8/wMA/f/1//z//P/1//L/AAD5//n//P8CAAIA/P8KAAYAAAAGABQAAgAJAAIAAwD2//b//f/t/wAA8v/y//X//f8DAPX/+v8NAAIACQAJABAADQAAAA0AAwD1//n/AADy//n/9f/1/wkA/P8JAAIAAwAGAAAAAAAGABQA/P/9//n/AAD4/wAA+f/y//X//P/8//z/AgACABAAAgADAPz/DQAGAAAADQAJAPz/AwD8//z/AgD1/+7/8v/r//z/AgDu//L/BgAGAAYACgD8/woAEAAGAAwAAAAFAAkA/P/8//T/9/8FAAEA8f///wwA9f/y//r/AAAAAAAABwAAAAAAAAAAAAAAAAD4//j//v/+//7/+P/q//v/CQACAP3/AwALABIADgABAAgABAAEAP3//P8CAPv/+//t//7/BAD3/+r/+P8FAAAA+f8GAAcA+v/z/wsABwAAAPr/BwAGAAAAAAD4////BQD4//H/+/8BAAgABgAAAPn/BgAAAA0ACgD9/wMA/P/9//X/+P8AAAAAAAD5//n/8v8DAPz/9f8JAAMA/P8DAAkACQAGAAAABgAGAAYAAgD8//z//P/8//n/+f/5//L/AgAGAPn//P8JAAYA+f/5/wIADQAGAPn/+f8AAPn/BgAGAPL/+f8DAAAAAAD8/wYADQAAAAAAAAAGAAYA/P8CAAIA9f/8//n/8v8AAAAA+P/1/wIAAwD9//3//f8JAAoABQAGAAYADQD8/wMAAwD8//z/9f/8/wIA/P/y/wAAAAD5/wAA+f8AAPn//P/8//z/AgACAAkABgD5/wMABgAGAPn/+f8GAAAA+f/1/wIACQAGAPn/+f8DAPz//P8JAAIA/P8JAAYABgDy/wYABgDy/wAA+f/1/wIAAgD8/wIA/P/8/wMAAgADAAoAAAAGAAwABgAAAPn/+P8AAAAA+P8AAAUAAAD4/wYAAAD5/wAADQAAAPn/AAAAAAAAAAD5//n/BgAAAPL//P8DAAYA+f/8/wMAAwACAAMABgAGAAYAAAAAAAYAAAADAAMA9f/8//z/+f8AAPL/8v8CAAYA+f/1//z//P8JAAkACQAAAAAADQANAAIA/P/8//z//P/1/wAA+f/5//n/+f/8//z/CQAGAAYA+P8AAAYAAAAAAAAABgAAAAYA+P8AAAYAAAD5/+v/9f8DAPz/CgADAPX//P8DAAoAEQAAAAAAAAD5/w0ABgAGAPz/8v8AAAYABgD5//L/+f8AAAAAAAAAAA0ABgAAAAAABgD8/wMACQD1/wkAAwD1//z//P/8/wMA/P/u//n/AAAAAPn/AAD5/wAA+f8GAAYA+f8AAAYABgAAAAAABgAAAPH/AAAGAPL/7v8QAAMA/P8JAAYAAAAAAAYABgAGAPn/AAAGAAIA9f8AAAYA/P/5//n/+f/y//z/AwD8/wMAAgADAAkAAAAGABQAAAD5/wYA+f8AAAYA+f/y/wAA8v/8/wMA/P8DAAMACgAGAAAAAAAGAAAAFAAJAAMA/P/1/wMA9f/1//n/BgAAAPn/8v/y/woAAAD1//z//P8DABAAAgAFABMAAAAAAAkA/f8DAAIA9f/9//z/9f8JAPX/+f8AAPL/+f/1//z/EAAGAAAA+f8GAAAA+f8AAAAAAAAGAAAA+f8AAPn//P8DAAMAAwD8/wMACgANAAYAAAAGAAoAAgD1//X/AgADAPX/8v/5//n/+f/8//z/AgDu//z/GAAKAAMA/P8NABQAAwD1/wAAAwD1/wAA8v8AAAYA+f/4/wAAAAD5/wAAAAAAAAYAAAAAAAAABgAGAPL/+f8GAAAAAAD5/wAAAAAAAA0AAADr//n/BgAAAAAAAAAGAAYA+f8AAAAAAAANAAAA+f8GAPn/+f/y//z/CQAAAAAA+f8DAAAA9f/1/woACQADAAIABgAGAPn/BgAGAAAA+f8AAPn/AAAAAAAABgD5/wAABgAAAAAAAAD5//L//P8NAAAA6//1/w8ACgD4/wIAAAAAAAAAAAAGAAAA+f8GAAAA+f8GAAYABgACAPz//P8CAPX/+f/5/wAA8v/5/wMA/P/8/wMA/P/8/woACQAGAAAAAAAGAAAA+f8AAA0ACgD8//L/AAAAAAAAAAAAAAAA+f8AAAYA+f8AAAAAAADy//z/CgD1//z/EAAAAAAAAAAAAAYABgAGAAAAAAD5/wAABgAGAPj/8v/q/woADAAGAAAA+P8GAAUACQD9//z/9f8AAPn/8v8GAAAA8v8AAAAA/P/8/wMAEQAAAPn/AAAAAAYABgD5/wYABgD5/wAAAAANAAMA9f8CAAMAAwD8//X/AwD8//X/+f/5/wAA8v/8/wIA/P/8//z/AwAKAAMA/P8JAAoABgAAAPn/DQAAAAAABgAAAAAABgAKAAMA9f/1//z/+f8AAAAA+P/5/wYAAAD5//n//P8JAAAAAAAAAPn/AAAAAPX/AgAJAAMAAAAAAAAA+f8DAAYAAAANAAYAAAACAAIA9f/8//z/+f/5/wAA+f/5//n//P/8/wMA/P/8/wkAEQAAAPn/DQANAAkAAgACAAMA/P/1/+7/AAD5/wAA+f/y/wAAAAD8/woABgAAAAYABgAGAAIAAwD8/wMAAwD1/+7/8v/5/wAA9f8JAAwA+f8GAAYABQAGAPj/+f/5/w0AAAD5//n/BgAAAPn/+f8AAPn/AgAGAAAABgAAAAYAAAAAAAYAAAD5/wYA+f/y//n/AwAAAO7//P8KAAoACgAGAAAABgAGAAYAAwD1/wkAAwD8//z//P/1//L/AADy//X/9f8DAAMA/P8RAAkA/P8GAAAA+f8AAAAADQDy//X/AgACAAMAAgACAAYABgAAAAYABgAKAPz//f/9//b/+f/y/wAABgD5//L/BgAAAPX//P/u/wMACgADAAoACgAGAA0ADQD8//X/AwADAPX/+f8AAAYA+f/5/wYABgADAAMA/P/8/wMACQD8//z/7v/8//n/6//1//X/AwD8/wIAAwADAAMAAgAQABcACgD8/wIA/P/8//z//P/8//X/8v/5/wAA+f/9/wIAAgAGAAAAAAAGAPj/7v/8/wkACgAAAAYABgAAAAAABgAGAAAAAAAAAAAA8v8AAAYA+f8AAAAAAAAAAAAABgAAAPL/BgANAPn/+f/5//n//P8KAAAA+f8DAPz//P8KAAYAAAD1/wIACQAAAA0AAAD5//n/AAANAAAAAAAGAAAAAwACAPz//P/y/wAABgDy//n/AAD5//X//P8JAAIA/f8CAA8ABgDx/wAABgAGAAAA8f8AAAYAAAD5/wAADQAGAAAA+f/5//n/AAAGAAYABgDr//n/BgAAAAAAAAAAAAAA+f/1//z/AgADAPX/AgAQAAYAAAAGAA0AAgD8/wMAAgD8//z/9f/1/wAA8v/5/wAAAAAAAAYAAAAAAAAAAAAAAPn/AAAGAAYAAAD5/wAAAAAAAPn/AAAAAPn/AAAAAAYABgD4//n/AAAMAAwA/f/8//z/+f8GAAIA8v/5/wAA+f/5//z/AwD8//X/AwADAPz/CQAKAAMABgAGAAYAAAAAAAYAAAD5//n/BgAGAAMA/P/8/wMA9f/5//n/AAAGAAAA+f8AAAYA+f8AAAAAAAAGAAYA+f/y/wAABgAAAPn/AAAAAAAABgANAAIA+f8GAAMA9f8AAAoA9f/y//L/+f8DAP3/9v/8/wMA/f8CAAkAAwD8/wIAEAAGAAAABgAAAAYABgD8//L/8v8AAAAAAAAAAAYAAAD5/wAAAADy//z/AwAJAAYAAAAAAAYAAAAAAAYA+f8AAPn/8v8AAAAAAAAAAAAAAAAGAAAA+f8NABEAAwD1//z//P/8//z/+f8AAAYA/P8AAAMA+f8AAPn/+f/5//X/CgAGAPn//P8JAAYA+P8GAAUAAAAAAPn/AAAMAAAA+f8GAAYA+f8AAAYAAwD5//L/+f8GAAYABgDy/wAABgD5//L//P8DAAMA9f8DAAkA/P8DAAoADQAGAAAADQD8//z/AwD1/wIAAgD1//n/BgD8//n/+f8AAPL/9f/8/wMAAwADAAMAAwAJAAYABgD5/wAAAAAAAAAA8v8GAAYA+f8AAAAA+f8AAAAA+f8AAAYA+f8AAAwABgAAAPn/BgAKAPb/+f8AAAAAAADr//z/9f8JABAA8v/8/wkAAwD8//z/CgACAPz/AwAJAAAABgANAAAA+f/y/wYA+f8AAPn/BgD5//n/BgAAAPn//P8GAAAA+f8GAAAA+f/5/wIAAAD8//z/9f8JAAoABgANAAYAAwD8/wMAAgD8//z//P/1//L/AAD5//n/7v/8/woA9v8DAAkAAgADAAMACQAAAAwAEwD2/wIACgD2//X//P/8//L/+f8AAPL//P8CAAkA/P/8/woADQANAAYA/P8DAAMA/P/8//z/9f/y/wAAAADy/wAAAAAAAPn//P8KAAYA+f8AAAYAAAAGAPn/+f8GAAAABgAAAAYACQD8//z/AwADAO7/+f8NAPz/9f/5/wYAAADr//X//P8DAAMAAwADAAMAAwACAAwABgAGAPn/AAAMAAMAAgD9//3//P8DAAMA9f/1//L/AAD5//L//P/8/wMA/P8KAAkABgAGAAYAAAAGAPn/+f8GAAAABgAAAPL/+f8AAAAA+f8AAAYADQANAPX/+f8GAAAA8v8AAAYA8v/5/wAAAAAAAAAABgAGAAAA+f8GAAAA+f8AAAAA+f8AAAYA+f/5//z//P8JAAYAAAAAAAwAAAAAAAAABgAAAPn/AAAGAPj/+f8GAPn/AAAGAPn/+f8AAAAAAAAAAAAADQD5/wAADQD5/wYAAwDy//n/BgD5//n/AAD5//X/AgADAPz/CQAKAAAAAAANAAYAAAD5/wAABgDy/wAAAAAGAAAA+f8GAPn/AAAAAAAAAAAGAPn/8v8AAAYA+f/5/wIAAwAAAAAAAAD1/wIADQAGAAAA+f/4/w0AAAD5/wAA+f/5//X/AwAJAAYAAAD5/wYA8v/8/woABgAAAAAADQAGAPz/AwD8//X/AAAAAAAAAAAGAPz/+f/y/wAAAAD5/wAABgAGAPn/AADy//z/AwACAAYABgD5/wAABgAAAA0ACQADAPz/9f/1/wAAAAAAAAAA+f/5//n/+f/8//z/AgAJAAMAAgAGAAAA+f8GAAAA+f8AAAAABgAAAAUADAADAP3/9f8DAPz/9v/5/wAAAAD5//n/AAD5//X/AgAKAAYADQDy/wAABgD5/wAABgAAAPL/BgAAAAAAAADy/wIADQAGAAAA+f/y//z/CQAAAAAABgD5//n/BgANAAAAAAD5//n/+f8AAAAA9f8CAPz//P8DAAkAAwADAAMAAAAAAAAAAAAAAPn/AAAGAAAAAAAGAAYA+f8AAAYA+f8FAAYA8f8AAAYABgD8//n/+f8AAAYAAADy//n/AAD5//z/AwACAPz/CQAGAPX/AwAJAAYAAAAGAA0A/P/8//z/AAADAPz//P/8//L/+f8AAPn/+f8DAAAA/P/8/wkAAwADAAAAAAAAAAAAAAAAAAAAAAAAAAAABgDy/wAADQD5//n/AAAGAAYA+f8GAAAAAAAGAPn/+f8AAAAA+f/4//3//P8DAAkAAAAGAAAAAAAAAAAA+P8AAAYAAAD5/wYADQD5//L/BgAGAAAAAAD5/wAADQACAPX/+f/5/wYA+f/5/wYA+f/5/wAA9f8DAAkAAgD8//z/EAAGAAAABgAGAAYAAwD1//z/+f/5/w0AAAD5/wAADQD8//n/+f8AAPn/+f/5/wMAAwD8//z/AgAKAPz/AgAKAAYADQAAAPn/BgAGAAAA+f8AAAYAAAD4//L/BQAGAPj/+f/y//z/AgAQAPn/BgAGAAAAAAD5/wAA+f8AAAYA+f/5/wYAAAD5/wAAAAAAAPn/AAAGAA0AAAD5/wYABgADAAoA/P/1//z/9f/5//n/+f8AAPn//P/1/wMACQD8//z/AwADAAkADQAAAAAA+f8AABQAAgD1/wAABgD8//n/AAAGAAMA/P/1//j/+f8MAAAA8f/y//3//f8DAPz//f8CAAIAAgAKAAMA/P8JAAAABgANAAYAAAAAAAoAAwD8//z//P/8//X/+f8GAPn/8v8GAPn/+f8AAAAAAAAAAAAAAAD5//z/CQD8/wMA/P8CAAMAAwAGAPn/AAAGAAYA+f8AAAYABgD5/wAABgD5/wAAAAAAAPn/AAAAAPn/+f/8/wMA/P8CAPz/CQADAAIA/P8DAAwAAAAGAPj/AAAAAAAAAADx/wAABgAGAPn/+f8GAAAABgAGAAMA/P/5/wAA+f/5//L/AgAAAPz/CQAAAPn/DQAGAPn/AAAGAAYABgD8//n/+f8AAAYABgAAAAAAAAAAAAAAAAAAAPn/8v8GAAAA+f8GAAYABgD5//n/BgAAAPL/+f8DAPz//P/1/woACgAJAAAAAAAAAAYAAAAAAAAA+f8GAAYAAAAAAAAABQAJAP3/7v/y/wYA+f/5/wAA9f8KAAAA/P8CAPz/9f8DAAoA/P8DAAIAAwAJAAAABgANAAAAAAAAAAYAAgAKAPz//P8DAPX/7v/y/wAA5//u/wMA/P8AAAYAAgD5/wAAFwAKAAIADQAAAAAABgAGAAAABgACAPz//P8CAAMAAgD8//z/9f/u/wAA8v/5/wAA+f8CAAMA/f8CAAIAAwADAAIADQAAAPn/BgAAAAAAAAANAAkA/P8DAAIA9f/8/wMA/P/8/+7/+f8NAPz/8v8GAAYA+f8AAAAAAAAAAAAABgAAAPn/+f8AAAYABgAAAAAAAAAAAAAAAAAAAAYAAAAGAAIA8v8AAAYAAAAAAAYAAAAAAAAA+f8GAAAAAADy/wAA+f/8/wYABgD5/wAABgD4//n//P8DAAMABgAGAAAA+f8AAPn/AAAGAAAAAAAGAA0ACgACAPz//P/1/wIA/P/u//n/8v/u//z//P8DAAMAAwAKAPz/AwAJAAYAAAAAAAYABgAGAAMA/P8CAPz//P8JAPz/9f/1/wIA/P/y//L/8v8DAPX/9f8CAAMAAgAJAAoAAwAGAAYAAAAAAAYAAAD5/wAABgAAAAAAAAAAAAAAAAAAAAAABgD4/wYAAAD4/wAAAAD5//j/BgD5//n/AAAAAAAA9f/8/wMA/P8JAAMA/P8JAAYA+f8GAAYABgAGAAAAAwACAAMAAwADAO7/7v8GAPz/8v8AAAAA8v/8//X//P/8/woACQD8/wkACQAAAAAABgAGAAAABgAQAAkAAgD5//z/9f/u//z//P/5//n/6//1//z/AwADAAMACgAJAAYABgAFAAYAAAAQAAkA9f/8//z//P/u//H/+f/5//z//P8DAAIA9f/8//z/AgAKAAoAEAAAAAYADQAJAAkAAwD8//X/AgD8/+7/9f/5/wYA+f/y/wAAAAD5//X//P8KAPz/CQAKAAYADQAGAAAAAAACAAoA/P/8//z//P8DAPX/AwD8//X/AAAAAPn/8v/1/wIAAgADAAoABgD5/wAABgD4/wAABQAAAAAA+f8AAAAAAAAMAAYAAAADAAMA/P8DAPz/AwADAO7//P/8/wIAAgD1/wIA/P/1/wAA+f/5/wAABgAAAAAAAAAAAAAA+f8AAAYABgAAAAAADQD8//n/AAD5//n/AAAAAAYAAAAGAAYAAAD5//n/+f/5/wYAAAD5/wAABgAGAAAAAAD5//n/AAAAAAYAAAD5/wAADQAGAAAAAAAJAPb/+f8MAAkA9f/1//n/AAAGAPL/AAD5//n//P8DAAMA/P8JAAIAAAAGAAAAAAAGAAYAAAAAAAAADQAKAPX/9f/8/wMAAgD8//X/+f8GAPn/+f/5//n//P/8/wMACgAGAAYA+f/y/wkAAAAAAAYABgAGAAAAAAD5/wAABgAAAPn/+f/5//n/AwD8//z/EAAAAAAAAAAAAAYABgAAAAYAAgD4//n/+P8GAPn/AAAAAPH/9f8DAAkA9f/8/wMACQAJAAAAAAANAAYABgD8/wkACgD1//z//P/8//z/9f/8//L/+f8AAPn//P/u//z/AwD8/wMAAgADAAoAEAAGAAYABgAAAAAABgADAPX/AwAKAPX/7v8GAAIA9f/y//n/+f/8/wIA/P8DAPz/9f8KAAkA/P/8/wMAEAAAAPn/BgAMAAYA+P/y/wAAAAAAAAwAAAAAAA0AAwACAAoAAAD5/+f/9f8AAAAA+f8AAPn/8v8DAAMA/P/1/wIAAwADAAkACgAGAAYADQADAAMAAwD1//z/AwD8//X/+f/y/wAA+f/5//z//P8KAAMABgD5//z/CgAGAPn//P8GAA0A+f/5/wAABgD5//n/AAAAAAYAAAD5/wYAAAD5/wAABgAGAAYAAAAAAAIAAwD1//L/AAAGAAAA+f8AAAAA8f8GAAAA+f/5//z//P8JAAkAAAAGAAYAAAAAAA0AAwD8/wMA7v/5/wYABgD8//z/AAAAAPn/BgD5/+v/BgAAAPL//P8DAAoAAwADAAYA+f/1/xAABgD5/wAA+f8AAAAA+f8NAA0A+f/5/wAABgAAAPn/AAAAAAYABgD5//n/+f/5/wAA/P/2/wMACQACAAMABgAAAAwABgAAAAAAAgADAPz/9f/5/wAABgD5//n/AAD5//n/AAAAAAAABgAAAPL/BgANAAAABgAGAPz//P8AAPn/8v8GAPn/7v/8/wIA/P8DAAMAAwAJAAIADQANAAYAAwD8//z/AwACAPz/9f/8//X/8v8AAPL/9f/1/wMA/P/8/wMA/P8QAAoACgANAAAA+f8GAA0A/P/9//n/AAAQAPX/9f8AAPj/AAAAAPn/BgAGAPn/+f8AAAAAAAAGAAAA+f8GAAAA+f/5//n/AwAAAAAA9f8JAAMAAwAAAAYAFAACAAkACgD8//z//P/8/wIA9f/1//z/AwD8//X/AAD5//n/+f8AAPn/AwANAAYA+f8AAAYABgAAAAYAAAAAAAAABgADAPL/AAAGAPn/BgAGAPn/8v/5/wYA+P/9/wUAAAAGAPn/AAAMAAYABQD5/wAABgD5/wAABgD5//n/AAAAAAAABgAAAPn/+f8GAAAA+f8AAAYABgD5/wYA+f8AAAYA+f/5//L//P8JAAYA+f/8/wIAAgACAAMA/P8CAAoAAAAAAAAAAAAGAAYADQADAO7/AAD5//n/BgAAAAAABgAAAPn/AAAGAAkA9f/5//n/+f8GAAAADQADAP3/+f8AAAAA+P8AAAAAAAD5//n/AAAAAAAA+f8CAA0ABgANAAMA/P/8//z//P/8//z/+f/y//n/BgAAAPn/9f/1//z/EAADAPz/CQAJAAAAAAAGAAAABgAAAAAABgAAAAYAAwADAAMA/P/8/wMA/P/u//z/AwD1//n/+f/y//z/CQAAAPz/CgD1//z/EQAAAPz/AgAGAA0AAAAAAPn/BgAGAPn/+P8AAAYAAAD5/wYADAACAP3//f/8//z/+f/5/wYA+f/5/wAA+f8AAPn/AwD8//z/CQAKAPX/AwANAAAADQAAAPL/+f8NAA0A+f8GAAoA/P/8//z//P/8//X/+f8GAAAA+f/5//n/+f/8/wkAAAD1/wMAAwACAAkAAAAGAAAAAAAGAPn/AAAGAAYABgD8//n/AAAGAAAA8v/5/wYA8v/9/wUAAAD4//3//f8DAAMAAgACAPz/CQANAPn/AAAGAAYABgD5//n/BgAAAAAAAAAAAPL/7v8DAPz/CQAKAAAAAAAAAAYAAAAAAAAAAAD5//n/BgAAAAAAAAAAAAAA+f8AAPn//P/1//z/EQADAAYABgD5/wAAAAAAAAYABgAAAPn/BgAAAPL/+f8NAAAA8v/5/wYABgD5//L//P8DAAoA/f8CAAYAAAAAAPn/AAAGAAUABgAQAAMA6P8AAAoA/P/1/wMA/P/y//n/+f/u//z/AwADAPz//P8JAAMACQAUAPn/+f8AAAYAAAAGAAAA+f/y/wAAAAD5/wMA/P8KAAYABgAGAAAAAAAAAAAABgAAAPL/+f8AAA0AAAD5//n/AAD5//X/AwD8//X/CQAKAPz/EAAGAAYABgAJAPz//P8KAP3//P/8//3//f/1//3//P8AAPn/+P8AAAAA+f/1/wMAAwADAAYAAAAAAAAA+f/8//z/AwACAAoAAAAGAAYAAAAGAAYAAwADAPz//P8DAAMA9f/u/wYAAwD1//n/+f8AAPn/8v/8/wMACQACAAYAAAD5/wAABgANAAAAAAAGAPn/AAAGAPn/AAAAAAAAAAAAAAAA+f/y/wMABgD5//z/AgAGAPj/AwAAAAAAAAAAAAwA+f/5/wAA+f8AAPz//P8CAA0ABgAAAAAA+f8GAAAADQD8//n/DQACAPX/+f8GAPz//P8DAPz/9f/n//z/AwD1//z/AgAKAAMACQAAAPz/AwAGAAAAAAAGAAYAAAAAAAAABgAKAAMA/P/8/wIA9f/1/wkA/P/1//z/8v/y/wAA+f/8/wMAAwAKAPX/AwADAAoABgD4/wAABgAGAAYACQD8//b/AgADAAIA/P/1//z/+f8AAAkA9f/5/wAABgAGAPz/+f/5//n/+f8AAPz/9f8DAAkAAgADAAYAAAAGAAAAAAAGAA0AAwD8/wIAAwADAPX/7v8AAAAABgADAPX/+f8AAAAA8v/5/wYAAAD5/wYAAAD5/wYAAAAAAAYA+f/5//X//P8DAPz/CgAQAA0ABgAGAAIA+/8DAP3/AgACAPX/9f/x//n/8v/8//z//P/8//z//P8AAAkACgD8/xcAFAAKAAMACgAGAPn/AADy//z//P/u//L/6//8/wMA9f/1//z/CgD8/wkAFwANAAAAAAAUAAoA/P/8//X/9f8DAPX/8v8AAPL//P8DAAIAAgD8/xEADQAAAAAAAAAAAAAABgAAAPn/AAAGAAAA8v/5//n//P/1//z/AwADAP3/CQAJAAoAAAAAAAwADQACAPz//P/1//n/BgAAAPn/+f/y//z/CgAAAPX/AwAJAAYA+f/5/wYADQANAPn/+f/+/wAAAAD5/wAAAAD5/wAAAAAAAAAAAAAAAPn/+f8GAPn/AAANAAAAAAAAAAYAAAD4/wAA+f/4/wAA+f/p//j/AAAGAAAA+f/4/wYA+f/2//z/7P/5/wgA+f8CAAYA/v/x/wYADgAOAAIA9f/y//T/7f/0//H/+f/5//n/AAD5/wIAAwAAAA4ABgAQAAEACAAOAA0A8v8AAA4ABgD4//H//v/x//H/8f/4/wYA/v/q/+n//v/4//j/+f/+//7/8f/x//7/BQACAPP/7P/7/+3//P/8//L/AADx//H/7f8CAPX/9P8QAPz/AQD6//P/FAAOABYAAQD4/wEA+v/8/xEA/f/1//X/6/8AAOr/7f/u//z/AgAKAAEA8v/q/wAADgAWAAAA9v+W/3H/iP9OAMgAIAESAfkAVgDK/hX+vf7UACECSADt/Xr8Ev6jANEBNQEg/oD+ZP7g/5z+rf2M/oQBxgWyBVAEkQAQ/3v/VQB0AUICnAL4AbH+OfyR+wj+MAEtAv4Aq/7c/Wb+cv8lAA0AfAAFAYL/+/w1/N79TQGNAsoBrv2R/Az+hf/Z/fD6xvuo/fMDpgWJB5oIugLX/Bj48P2IB5MM6AUU/CD2ZfxzBIAHqgMh/c77GP23/0QAwP8OADsBWAJuAFf+/P2B/7UAEgDN/hv+o/6f/3P/vv4i/ZL9uf2n/S79DP0r/8kBjwbhB5wCe/sv+PD9gAS8B44Etv8i/Yb9DgFEAscCDAHg/r/9Vf0H/xwBXwFwAK3/TP8f/r/9VP45AJgB2gAz/2D8zPyT/qH/6v5o/cD9J//uAKYBDgSoA04D/v/F/UP/QQFIBVgEzgGw/iD9qf8rAXACTgFB/13+8v0W/0YAUAFoAdP/7P/Z/gD/Uf+k/97/K/9c/8P+Av5k/nT+Nv5B/WP9mP7R/jX/2QEGBUQG5wOs/vv83v5jA44GmwP5/179Nf6XAAMBLAF8APP/Pv/x/aP9H/9hAUYC/QB4/0n+tv4mABMBrgBv/17+p/1j/T3+x/5O/mb9o/wt/dj9aP/fAocFVwaqA1L/9P1V/zYDkAW4AwcA7f10/mQABAF4ACgAEwDR/73+4P1z/nUA5wFRAe7/9f7h/isAsQBcAFP/a/4W/oj9fv3r/VL+JP6//TP92PwG/WP/dwPiBuUGpwL3/cf8nv9pBOwFYQPO/1n+P/9UAMUAfQCxAH8Aav+b/l3+PwDMAYAB/v/W/rj+mf+DAGUAmP+q/lT+/P2W/cv9a/6c/jj+qv2Z/JD8lv15AD8EQAavBfcBP/6d/UIA5gPIBY8DGwAY/oH+AACCAcQBVgFDAJf+LP6k/oQAOAKPAdL/XP40/hf/PwCmABUAp/6S/RD9MP2p/XD+P/4O/pb9YP1X/V79SP66ADQE4gZ0BhAD+v46/tUAMwSmBUQD2f+D/u7+HwAnAWsBRwEtAG/+AP7g/v4AIwLsAEf/mv4G/7j/8P/8/87/1P6q/eL8t/xT/fj9Cv7o/Zz9V/0e/WP9gf6KAJIDZwbLBqsDSP95/kABnAS1BSsDAwDz/lb/tv9EAEIB1wHQAHv+Hf0Y/ncA1wHLAFT/C/9R/4b/d//I/z0AA/9D/Tv8fvyH/fH90v0r/mf+W/6F/af8lf0dAHcDmgZRB68EEgCJ/aD/gQNBBucEagHA/nX+//7y/4oBZQLBAUv/eP3i/R4AoQF4AQkAif/r/rj+yP57/2cAWP9o/SX8KPxL/eb9+P1i/tH9bf29++n7wPyA/4ADiwayCEUFFgFE/lX/sAMCBqYFOwNKAJP/5v6g/3QBdAJDAo7/ef2O/Uf//AAhAVUAZ/+Z/v/9Q/4x/xUAcP8h/jP91/yw/Kj8yfwa/gL/oP5T/A37UPsM/ogCbAYECWQGJwIu/+n+RwJhBAMFQQTnAW8AtP5c/l8AAwKIAiQBHP/w/dT9a/4jAGgBdwFbAJP+4P1W/iL/+f8FAA//gv2t+/D6kPtk/cT+Uf44/GD7ifuD/boAfQR7CM8HxAMOAOz+rgEKBM0E2wRqA64B4f9p/lX/RgFmAt0B/f9s/qz9o/5F/3MA8wA7AFb/Cf7t/df+k/7a/m7+nf3T/I/7gvvM+5n8Xv4r/oH9ef1p/PH+4AJ7Bi4JIge4A1EBiAASAoQDOQQ6BBcDeAFi/2T+mv8MAYABWADs/lL+9f7o/nj/EgDz/9T/LP8l/4H/Wv4C/sn9/f0Z/v78UvyH+5b7av0r/g7+J/0l+1j9QQKBBSYISAfvBMYBwv8cACECsgMwBLYDxgI8AH3+pv6+/xMBBgGRAP7/cv++/qX+Z//c/xMAAgAJAJ3/Jf6L/Zf9DP5C/rL9Qf1O/O77KPyA/Ln8tfyK/Ab+rwGwBDkGswa4BeUCDgFuAI0BxALsAn0DTANNAaD/Dv9b/wEAFgB0AIgAGQD5/7r/gP9C/xf/Zv/F/7r/c/+G/v79xP2F/XX9c/1t/Bj8/PsK/P78uPxV/kv/6AArBPYEtwV0BRwDEAIAAU8B3AEJAtMC+AK4AWAAnv92/5r/wP8hAE0AKQAmAPv/mP8x//n+Pv+S/7H/uv/x/nj+u/3Z/MD8zfw1/IH8T/zu/B39dfwE/hj/2gEQBakFrAbZBDgCHAFKAJoAGwFkAq8DZwMQAtAAEwA4/yj/kv8JAFwAYAD5ANEANgBR/z3/Sv9h/8r/kv80/3/+Tf3Y/K78M/wF/CX8C/yM/I78Fv35/v0AtwMVBbgFRAXbAq8B7wBmAIwAGAEnAq4CIQLEAU8BOACM/1z/Y/+4/wYABgGAAQcBDgA9/+j+e/7P/g7/ov9Z/6b+Gv6I/e78M/xc/Fj8ffwK/Sv9mv5sAMECtgSfBdYFGgRTAjQB7P+4//D/6gAYAjgCPwL7AcoAsP9j/3X+vP5U/2MAfQGWAccAQgCN/9T+vf6y/kj/8P4+/gH+X/2i/MH7vvuT+5D7Kfxy/Gj+yQCbA0oGeAZ7Bh0EnAGSADP/cv9dAKIAbgJoAr0CxgIQAaUAzv+Z/ij/ZP84AFsBDQGaAD4AMf/Q/n7+b/7q/l7+JP4R/vv8MPx2+0v7RfvA+/P8lv18AIAC/gSQBk8FHAUQA9MAIADo/l3/+v8zAWICHwOHA5oCqQGDAN7+Qv5K/uL+//93AIwAygA8AH3/5P5u/lT+S/5C/ir+F/5c/cr8KPxP+3j7sPs4/J//uAJlBTcH3QZgBj4EUQHL/1L+Uv0Y/gr/rwAYAkUCuwIfAroA8P81/yL/h/+O////mQCfAGQAAACK/xH/if4B/qv9hv0b/dn8Yvzr+zr8FvzI/OP/vQKFBEAG7AZHBpgEbALsACL/1v0R/p/+zv8hAcMBUwJVApUB8AD4/2r/Fv99/pX+EP89/4L/uf+7/5n/Qv+a/jL+rf0Y/Xn8Ifze+xj8Ofys/doAsAJgBEUGfAavBUcEmAKzALv+9P24/Qf+yP7Q/yQBDAJgAmgC0AEiATwASf+p/pX+Yf6F/uD+Hv9h/1r/BP/H/kv+jP3d/Gv8Dfw//Ir8aP4hAakCcQQeBo4GMwZDBdwDxgHy/4L+lP05/VT9Mv5x/60AlAETAjsC1QEDAQAAMv+D/q79t/34/Uz+zv4Z/zv/Qv+8/uj9If1g/NL70Pv1/GD/cgEkA9wEWAa/BlQGlwUKBE8ClgAK//b9QP3k/D39Kv4+/0MANwENAiQCqwEJAT4A/v4f/qj9a/1//bT91/0o/lT+AP7d/Z39Qv0k/aj9Mf+7AOAB3QITBNsE5wSmBBQEHwP7AcMAvP/h/jH+6v0d/of+Nf/j/6cALwE2ARUBtQD3/0D/xf5l/iP+Fv4a/gn+If4P/vf9/f3W/cj9I/4R/08APgH7AfACwAMoBBoExAMoA2ICZwF0AML/G/+w/qT+4P4X/2b///9nAHMAXwBpAA8Al/8t/9P+dv44/hH+7/3y/eD9xP3B/cv97/1N/hz/HgDxANYBqwJeA60D4AOlAzYDlgK+AQUBPwCU/yj/AP/+/uX+Mf+j/9P/5f8CABIA1f+M/0j/+v63/n7+Rv4o/hz+Cf7u/dv92/32/WD+NP8AAM0AmgFOAt8CWQORA3MDQAO/AiECZQG0ABMAkv8+//z+3v7x/iL/Rv97/7T/zP/J/7j/mP9l/zX/8v61/ob+Vv4Z/uL92f3c/ff9fv4m/9n/twBjAf8BogIxA20DVAMVA4sC6wFGAaYA+/+G/yv/9v7s/v/+Hf8z/3n/sP/D/8X/xf+Z/2f/PP/9/r7+kf5U/hj+7v3D/bj9CP62/mj/OAAAAdMBogItA4YDiQM/A8cCMAKLAekASADA/1//Ff/q/uv+//4b/1D/eP+F/5D/kf99/1H/KP/q/rD+ef4n/uj9oP14/Zf9K/4I//z/2ACOAUUCGQOOA8gDrwNfA98CJAKDAb0A7P9f/+/+pv6Z/rD+2P4k/3j/oP+6/9j/xf9Z/yD/1P6N/kb+/v26/Xv9Sf1a/dH9uf62/8cAygHCAqIDdwSxBJ4EPgS1A8ICqAGcAGz/kf7w/Yj9b/2p/Rn+rP5f//T/UwCZAKAAbwDh/0z/fP7h/b380vsu+/j6vfpE+6j8sP7JAOMCAAWXBo8HVgiPCMIHcwbxBA4D4wAB/2H9CPxq+2P7r/tQ/GT9bf5I/xkArwDlAKQAMQCO/7v+nv2F/Mf7ZfsT+zT7PPz0/fP/4AG/AwwFJQYEBxkHVQZFBfEDXwK6ACD/2P3O/Ez8RvyL/CD9Dv7//uX/igACATQBBQF9ALz/9/4H/vb8/fuM+2f7b/sI/Hn9WP9kAU8DrASrBZAG+AZ4BmMFMATMAi4Bq/9D/kz9gPw5/Gj89vyf/Xv+X/8tAKoA2gDuAJ8A+P9O/7T+zv3i/C/8APwS/Cj86Px3/kQAPgLSAxIF0wV+BpAGwAWPBFcD9wFkADb/Hv4k/aD8s/wj/aj9bf5V/wsApwDTAMAAhAD2/xj/WP7X/RD9PvzN+/z7OPxm/IL9Zv8wAeUCggSdBQ4GjAZ0BlUFCATQAloBtP+U/rL94vxY/J38A/1m/R7++P7X/1QAsgC/AJkADQBe/8j+C/4e/Vz8KPzX+9z7qvxJ/u7/vwGwAw8FzwWDBsoGAAYIBQEEhgLFAGz/Yv6I/dX8yfw9/bD9Q/4Y//f/YQCWAM4AkgD1/x7/eP6Y/b/8Hfz1+8T77/u4/Fb+7v+hAWoDuASBBQAGBwZZBXcEZgP3AZgAVP9o/rX9KP0m/ab9Bv55/jX/0v8NACoAUgAYAIj/4/5g/rL9D/1m/B38Evz/+4b8+f1v/+AAzAJUBDwF+gWHBioGUAV4BCMDjQEZAOz++v1A/fj8LP2F/Qb+vf5q/+v/MABSAE0A3f9B/6D+Af44/XX8Gvz2+/j7iPwJ/nn/0ACrAnUEUgXSBXUGWAZWBXMEWAOwASEAE/8g/if9t/zo/Av9uP1y/jz/1f9gAJ4AswBpALr/Cf86/of9ufwb/M373/td/JP9Bf9dABcCxgPPBGkF6wXaBQ8FMwQdA6ABHwAG/yv+U/3N/NH8JP2z/Vj+H//A/zIAfQCMAD0AuP8o/23+zP0S/YX8Sfx1/Aj9QP64/wYBnwIfBAUFcQXXBY0FoQSvA3gCFAHB/9L+8v0t/dz8Av1F/bv9X/4F/5L/+f8vADgA8/93/9D+Mf6o/fD8gPyC/NL8kP3Y/kwArQFLA5IEPwWoBdYFRwVcBF0DBQK0AHj/tP7u/Vn9Mf1k/cD9Pv7G/jL/pP/h/+T/xP9j/+H+Sf7X/WT9//z0/CD9rv2l/uz/OgGAApcDngQiBS0FBAVsBIwDdAJpATgALP+I/un9dP1W/YT9vf0k/oz+8v5O/4D/kv+N/1r/7f6D/jH+8/27/af90P1o/i//OwBQAUUCQAMXBF0EVAQyBKMD2wIBAhIBDAAt/5f+Fv7L/az9zP34/U3+qf7x/jf/Zv9+/4X/Xv8c/97+p/6W/nf+eP6j/gf/l/8/AOcAcAEFAocCsAK2ArECewIGApoBOgGzAD8A3P+Q/0z/Gv8A/wb/Dv8Y/yj/Q/9K/1v/Yv9L/0P/MP8Y/x7/H/8l/z7/d/+g/+X/NgBoAJEAwADOAOUA5ADDAJ0AngCKAGAATwBIADcAMgAcAB8AJwAsADAAMAA1ABoACwDw/8P/kP9T/yv/CP/u/ub+8/4S/0P/gP/E//v/LQBmAJsAqACWAIgAggB4AEcAMQAdAP//7f/y/+//8/8bACwARgBcAGYAdQBuAGgAQwAXAOj/wv+g/37/bP93/37/if+q/9D/6f8EAC0APQBBAEUAKAANAAAA7//X/83/wP+8/7v/0f/o/wEAEAApAEkAVQBPAEwASwArAAEA4f/I/7H/ov+M/5j/pf+u/9H/8P8EAB4AMwBOAE8AQAA4ACUAFgAAAPT/3v/O/8P/zv/Q/+L//v8QAB8APgBIAEIATwA3ABEA9//d/8f/q/+a/5D/mv+m/8f/5f/z/w0AJAA/AEUASgBVADAAKAAUAAoA8//k/+T/6v/o//H/AgAIACcAMQAyADAAJQAiAAgA6f/U/7v/qP+a/4n/jf+X/6n/xP/i/w4AKAA6AE8AYQBWAEUAQAAgAP3/8P/U/8P/yP+7/8r/4P/w/woAJABAADgASgBGAC4AHwAGAPT/4P+4/6f/n/+g/6L/rP/R/+b/+v8gADgARABRAEEARgA7AB0ACwALAPP/2//R/9H/1P/Y/+v///8eADMAOwA0ADcAPAAkAA0A5v/W/8j/sf+v/6z/uf/J/97/9v8HABsAMgA8AD0ANgAjABsACADq/+H/1//W/9D/1v/j/+L/7//7/xAAIQAoACcAJwAhABMA/v/2/+b/2f/D/8v/wf/D/9X/4P/o//X/AwAOABcAHQARABQADgD5//X//P/o/+L/7f/t/+b/8P////n/BwASAA4AGAAPABAAFAD7//v/+P/p/+f/4v/W/83/4f/w/+z/+v8KABEAHAAkACUALAAmABYACgAJAPr/7v/s/9//6//v/+j//v/4/wgABgAQABAACQAQAAsAAAD9//n/8P/u/+D/4f/k/+7/8/8AAAIAEwALAAUACgALAAoACwAIAAAA7v/3/+3/9P/q//P/+P/w//H/8P8EAAUACAD7/wEAFQD+//3/+P/5//X/4f/z/+3/6//1//z///8HAAoADQAMABYAFQAIAAMA+//+//D/5v/t//f/6//o//H/9P/8//r/BAD//wgAFAAEAAMAAAD4//X/+v8BAOz/5//4//T/+P/7//7//f8LABIAAAAMAAgABAAEAP//7f/2//X/7f/s//r/9P/3//j/+////wAA//8AAAUAAAAAAPv/8P/7//f//f/t//b/+//1/wIAEgANAAYADQAFAAMAAQD9//L/7P/0//3/9f/4//T/8v/4//n/AAACAPr//f/2//v/+//8//b//f8CAAYA/v/5/w4ADgABAAoACgD9//j/AwD3//j/5//w//X/8P/3//T/8P/q//v/9f/+//7///8IAP//+f8GAAAABgACAAIAAAADAAAA/v/4//b/+//5//v/+f/3//H/8v8FAPD/+P/v//H/8f/4/wgAAAAEAPP/BAD+//r/8v8FAAYA//8BAP3/+P8DAP7//P8BAP//AQAGAPz/8f////H/7//7//T/+P/v/+////8DAAAA/v8DAAUAAgD3//n/AAD+//v/9/8AAAIA+v/+/wIABwAAAAEA+v/2/wEA7f8CAOH/7//8/+n/9f/4/wEA/f8CAPn/AgAHAAsA+//8////BQD4//7/+f/z/wMA/P/+/wYA/f8RABsAHAD3//v/BwD4/+3//P/z//H/7v8OAPH/yf////3/8P/3/wIA/f/9/wAA+f8CAAAACAD5//r/FgAYANb//v8sAPf/xf///wgAu//5/xAA+P/f/wsA3/8AACYA4//z/xMACgDm/zAAAQDY/yAA4v8UAEMAx//g/0MABQCp/wkAKADV/+H/GAD9/wkAIACm/wgAfQD2/5//HACIAKT/vf9TANf/0/84AAIA3P///x4A3f/v/9j/9/+k/93/ZwDN/7j/MAAwANj/5/9JAPf/0v8lAAsAEgDX/wcAEwDT//b//P/5/+z/8v/y//z/CgC1/+7/QQD//93/IAD4//D/MQAJANr/KAA5AMv/EAAIAOX/AADS/wQA+P/x/+f/CAAeAMn/DQA1APT/1f8WADUAqv/9/ykA4P/p/xQAGADi//z/FADm/yEA+v/c//z/+//2/zIAl/8BAD8Aw//g/y0Awf/R/zoA6P/U/ycAGADf/wMAHADo/+f/IQCm//v/LQCR/+D/cgBZ/z4AtwCL/+b/iwDX/9z/XQDI/8P/HgDi/9v/8v8eAOP/4P8yAOj/6/8wAOP/5/8xAPP/3v8nAPv/6v8UAAYA7//V/xEA9P/7/xgAJADo//b/HACY/wMAGQD//yUAEADp/wkA/f/o//7/9//n/wMA+v/P/xkAwP/4/yUAvf8/ABMA0f8uAOL/0f/6/x0AAQD2/yAA9v/w/wcA8v/q//j/AQDY/wIADADt/87/FwCo/z0AFwDG/1AA/f8CAFQA//8mADcA1f8BAOf/rP8fAMj/0P8sAND/1/8bANv/xv8qAOT/3/8pAPf/+f8IANL/AwDr/+v/EgDU/xkAMAD4/z0A8P8cACsA5/8gAPD/2/8OAAAA6f8GAPL/6/8EAO7/4P8AALH/8f/1/87/BwDN//L/HADQ/0cADgDJ/zwAHQDK/0MADgAWACUABgAtAPz/IwAwABMAJwDt/wcAw//H/8//ov/F/4P/zf/B/4j//P+3/6L/GADg/+X/XgAfAE8AfABFAHgAjgBvAJgAfABQAEMAIQDS/9X/r/+D/13/Ov9D/z7/EP9U/zT/Jv+U/3n/rv9cAAwAmwDnAL4AOgE4AUABbwFEATwB6gC8AG0A4//I/1f/4P7G/pr+Wv5B/pL+P/5R/uj+vv40/+f/xP/GAPMAaQEXAukBjQJyAl8CaAK4AZkB3gAiANz/9P6j/if+n/21/Qf9b/0+/R/9Bv6//bj+T/+B/+oA/ADfAZsCfAKSAysDmQM/A7cCjwI/AcUA7f/j/mj+o/0Y/ez8C/zA/HD8hfyV/Y79m/5v/0cADAHbAZoCCQN4A8gDwAM3BCoDDQNzAg8BqwB2/3f+8/0F/af8bvwI/Dv8w/y4/Gj9GP4+/mb/FgB3AMEBUgLOAtoDqQMgBFkEnQM6A2gCeQGMAIP/dP7F/QD9V/w8/NP77fuB/KP8CP3n/Sz+Fv8bAHMAsgFuAukC8gPrAxQEZgS1A3EDxgKgAQEB6P/m/k7+X/27/LX8N/xE/OP8qfxA/cH99f27/oT/4P/mANMBRwJdA8ID8wNxBPEDtQNYAx8CUwFZAB//W/6Q/bH8ofxY/B78ufzH/P38vf3x/XL++f7F/yMAegH1AdQC5QPPA3gEkQQFBPUDDwMxAikBuf+Q/sn9v/w4/Cj8tvsV/Jn8tfxt/b39X/7p/mn/XwDGABoCTQIoA9wD3gNABPQDqgMuA10CeAFPACj/Nf6C/cX8aPwx/EX8ivzu/Fn9qv03/t7+CP/t/4gALwEpAo4CYwP1AxgEXwQoBMgDNAMvAi0B9P+A/oL9wfwh/Lv72fso/HH8L/2w/Rb+mP4b/2D/+v+2ADkB4QFuAuoCsQPaAxMEPwTOA4wDnwJ7AYAA9/7W/dv8HPyp+5z7/fs//Pf8m/3f/Yn+0P4///v/mQBHAfcBfgIaA7IDzQMSBBAEowMpA0UCUQFFAPL+6v33/FD81vvM+xf8TPwA/ZD9+v2R/uL+UP/L/1AA5QB6AQQCpwJGA4wDDgQnBBAEwgP4AigCIwHN/8D+if2e/Eb8zfv++3L8uPyG/QD+WP7I/uj+Uf+n/zIA6wA9AQsCvAIlA88DEAQuBC0EiwPNAuEBkgCQ/z3+Lf13/B387/sh/MD8I/0H/or+8P4v/0D/g/+r/ygAtQDqAK0BQwK6AmQDpQPCA9gDQwOsAt0BvgDD/1z+eP3Q/Ef8NPw//Lr8Zv0f/rv+Hv85/1j/Rv81/3v/yv9aAKkAXAEYAsMCXgO9A98D1gNRA7ECxQG7AKr/Xf6v/f/8dPx3/Gr88vyZ/Sf+2v5T/33/Zv94/1z/iP+q/yMAZwD4AIEBIALaAlcDuAPSA8YDTwOSAq4BpACy/2v+vv0n/Zz8zvzF/E399P1W/g//Wv9Q/07/8P7b/gb/C/+w/wgAlwBMAYUBwgILA3gD1gOxA34DsALPAd4At//w/tD9Qv3K/IP8vvzt/JP9R/6g/mP/x/+x/7j/U/80/07/Rf/W/xEApwBAAYsBiQLqAkMDwwOcA4ED1AL0AQwB8/8o/+H9R/2i/HL8h/y3/GT9C/65/j7/r//R/53/Sv/e/sz+qP7O/jH/mP9kAPgAAwLsAnUDcgSnBMkEkQSaA8QCiAFuACT/Bf4v/ZH8a/xr/MD8TP3o/Yn+/v5j/8X/Yv89/8j+dv5U/in+nP7g/rT/hwBNAXcCUgNJBPgEQgWbBQIFQwRdAwUCpwA8/+X99fws/L/7CPz/+8z8Vv3h/az+8P5A/1D/MP/I/nD+Lv4N/in+s/5B/ysADQEMAvwCLQToBI8FuwWbBSUF7wPhAogB6P+Z/mj9Jfyr+yz7cPur+0H8Lv23/ZX+OP92/7n/o/8//+j+iP5d/jj+g/75/qj/fgCYAWcCYAMRBKkEPgUyBfsEhQSCA24C+ACa/3v+Jv1v/Mv7Vvt1+677c/wl/Qf+Ef+p/00AqgCmANAAfwAIAI//6f6z/lb+e/7V/kr/GAAOAd8B4wKkA08EAwX1BMUEUgRKA0EC0wCY/2n+RP2H/Pn7q/v5+0b8G/3m/a3+sP8uALQA9ADPAOUAdADe/1n/q/5Z/uP9xv30/Vz+F/+w/+oAzwG8Aq0DSATOBDUF7gR0BN4DvQKMAT0AK//9/f78e/wM/Pf7D/yC/Cj9wP1k/h//gP/j/yEABwAkAOr/gP9O//v+t/6C/mT+hv7g/mP/EAAXAaMBwAKlAyoE5ARLBTEFCAU7BJkDTALxAAgAYv5R/Wn8kPuA+077x/t4/BD99/3S/lb/6v9AAEIAcAAmAOv/jf85/xP/0/6u/oP+nv6//j3/sv9AADABygHAAnED2QNwBKIElwRaBKADBwPlAbMA9P+K/qf9Cf0f/DP8B/xJ/AD9af1A/vH+d/8BAIQAqADEAK8AaAA6ALf/Pv/q/pL+W/4b/t79Pf4q/gP/lf8OAHQBBgIzAwEETQQsBf4EBgWEBJcD+gKTAV8AOf/j/eD8L/xw+1T7Y/ub+2X8+PzS/cj+iv9gAMwAMQFgAUQBHAGgAEQAv/8f/8z+aP5F/vj99/1T/lj+Gv+8/zoAjAEYAhgD4wMjBMsEsgSwBFkEpQPhAtYBrgCT/2j+fP3V/DX8BPw2/Gj87fzA/U7+9/6v/yYAnwDwAPwACQHLAGAABgB8//j+h/4i/vj98v3w/RP+kP7A/qn/YAALAUYC5QKeA3EEhATLBN4EZgQDBEMDWQJjASYAIP8L/i39gPwV/OX79/sz/Mz8dP0Y/hT/a/8UAHgAlADYAMYAoQB9AAkAtv9I//f+l/5B/jD+Gv4+/o3+0f5w/7L/iwCCAdEBQAN5AzMEAgW4BPMEmwTXA1gDGAL/AAcApP6w/cz8IvyU+1n7Sfu6+1n83vzy/Xb+Vf8qAH0A4QAtARgBAAGpAEUA8P95/xv/t/6Q/nP+ef6+/uT+VP///0YAYgHFAZkCbwOOA3AEdARrBKME9gN4A+ACrQHnAMD/mv6z/dj8Xvz8+6j7DfxY/Lb8iP0c/tf+n/8jAKgAywAQAf8AqgB7AA0Ap/9P/9P+n/5v/mD+hv6Q/sb+Iv+a/9n/uQB2AeQB9AJLA/4DYQReBHgERgSlAxYDJAIVASwA9P70/Sv9fvwF/Of7Evw9/ML8hv0U/uT+pP8IAKMAvQDZAM4AfQBEANz/Yv8N/6L+W/5J/jT+P/5b/rT+DP9n/18A8ACtAbgCQwPkA1YEawSPBEAEqAMIAxYCGQEeAAL/8P1B/Yj8EfwR/Bn8Wvz//Jf9Vv4J/8L/PAB+ANsAzgC6AIcALgDV/3z/Kf/r/rz+lf6E/sD+5P4f/7//MgDHAJgBJALJAp0DlAMgBDUE2gOsAx4DXwKAAasAif/D/in+Vf30/Nr8nvyv/A79cv36/YP+Bv+T/+T/JABOAFsAXwA3AAUA0f+i/5P/T/9G/1L/VP95/6f/AAAkAJ0A5AAZAYwB2AHWARQCLQIcAhEC4gGwAVAB/ACHABQAzf9i/wH/u/6W/mb+UP5f/n/+mv7P/vL+Gv9A/23/lP+m/8v/2//i//L/BgD5/+z/7f/o/+b/3v/u//j/CAAgADgAaQCLAJAArgDUAOAA0gDoAOwA0wDEAK4AiABdADQAFADT/7v/s/+G/3L/Y/9W/0X/Tv9X/0f/Vv9k/2//gP9+/5L/nv+4/8n/3f/r////AgAJACQAJgAoAEYARgBDAEQAaABdAFQAYwBYAFoAUABYAFUARQA/ADkANAAgABgAEgADAAIA5//m/9T/x//D/6L/rP+q/6j/s/+y/7P/tP/F/9j/2//5/wEACwAfACcAIAAjACIAPAA0ACwAIAAcACAADQAQAAUABwD9//n//P/8//f/9v8CAPD/AQADAP3/+P/4/wMA///6/+//6v/t/+b/6P/u/+D/3//X/93/3//d//L/7//0//r//P///w8ADAALAA0ABQAIAAIAAAD5/+X/6f/x/+T/8v/x/+H/+P8LAAAAEAAIABUAHgAWABQAGwAaAPv/AgAEAPH/4P/n/9z/4P/q/+D/5f/z//H/+f8CAAkAEAANABYAIQAiACsAJwAYACAAGQAJAPz//P/w/+P/5//g/+D/5P/i/+H/4v/o/+z/+P8HAPr/DAALABMAHQAXABoABQD+/wkA7//m/97/4f/T/9n/1v/X/+D/3P/s//j//P/7/wYADgAUABYAFQASABUACQAAAPP/9//z/93/4//r/+f/6P/q//H///8AAAcAEAAUABUAIAAgABYADAAWAAgAAgAAAPj/8f/x/+z/6v/x/+//8/8BAPn/9//4//n/8v8DAAAA/P8EAAEADAAJAAAAAADz/+//8f/r/+f/8v/5//f//P8FAPn/+P/8//b//f8DAAEABQACABQAGAAFAAoADAD5//T//P/z//L/6f/n//b/6//t/+3/8f8AAPD/+v8LAAUAEQAFAPv/AQAEAAYA/P/5/wAA5P/u//D//P/1/+n/+f/x//X/BAD5/wcAEgANAAgADQAIAAAAAQADAPz/9P/8//b/9//z/+v/8P/+//r/9v/3/wQABQD5////BgAHAAYAAAD8/wUACAD+//T/CAD3//j/9P8EAPX/9v/w//D/9P/5//P/8P/5//z//f/8//n/EAD+/wYAAgADAAAA9/8BAOr/8v/1//T/AgD1//j////w//j//v/8//z/+P/y/wAAAgADAA4A8//7//z/9v8CAPj/CgD0//3/+f8AAP7/CQAAAP3/AgDy//T/+v/9//T/AAADAPj/AgD9//7/+v////P//v8BAAUAAQD7//n///8JAAIA9////wcA/f///wUAAAD9//7/1/8AAO7/GwAFAAYACQBKACgAxf9WALD/s/+//9v/hP/a/wcAyv/9/xEAEwArAC0ALgBAAA0AEwAMABAA9/8KAP//5//q//b/9f/5//D/8//+//b/BgD//wIAAAAbAAQA+P8SAB4A+P8AAPL/5f/v//f/8//v//n/6//y//j/4f/4/wAACgACABIADQBcAFYAHgA1ALb/sf+u/9D/0P/W/8j/y//h/w8ABQAlAPn/IAAbABQACgAXAOL/6//l/9D/2P/q//H/DwANAAIADgARABUABgAEAAIACgD//wcA9f/w//v/+/8EAAUA/P8AAAIA9v/6/woA6v/y//f/9P/6/xIAEgAJAP//CwADAP3/CQAAAPT/7//q/+b/8v/u/9//6//1//f///8CAPb/7//4/xIACQAHAOj/AwAAAAQA+v/u/wAA+P8HAAEABAD8////AAAPAAYA9f/y/wcAAAACAAoA9P/y//T/9//8/+T/9//+//r/CQD0//b/BQAWAPr/7f8UAOP//P/8/+3//v/2//T/+P///wQA9f8OAAcA/f/7//H/9v8CAO//+f/t/wYA9//r//P/+/8EAPb//v8PAPf/9v/v/wEA9//u/wIA8v8ZAPn/AQAAAA0AAwDs////7//5//f/9f8DAPb/+v/+/wEAAAARAAIA7f8PAP//9v/2/wQA///4/wgA7f/9//3/AQDy/xoABwDs//v/+P8OAPT/CAAKAPb/CADJ/woA/P////X/8P8DAO3//P/4/////P/4/xgACQD3/wYA9f8nAN//AQD7/wAA8v/l/xQA4//4//b//v/2//P/BAD8//j/8P8AABIA/f/t//r/7P8aAOf/AgDx//n/+f/v/wEA7f8HAPj/DgAIAPL/AAD7/wEABwD4/wgA5P/y/xkA6f/v/wYA9f/i//v/CAD9/+X/BQAvAPr/+P8BAA0ACADl/0EA5f/O/yUA+P/n//D/5v8ZAOj////z//f/EADz/+//FAD1/xcA7//9/wQA5v8yAOP/DwD+//n/BwAPAA8Azv8IAAAA5P8AAPz/MwDP/+r/KgDp//H/6/8MAOr/zf86APD/8P8DAAwABwDW////QQC3/wAAAAAHAPb/wf81AP3/BwDz/wcAKgDV//v/BQD2/+//8f8dAOr/7P8XABgA2//v/wYACADM/wgA6v/8/wYABQAPAO7/8P8QAA4A6P/3/wsA+P/s//T/BAATAOv//P8EAAMA7f8HAAMA5f/m/xgA8v/2/wsAAAD0/wgA///j//n/DAD2/wAA+f////X/BAABAOT//f/t////EwDy/wIA9/8BAOj/BAABAOT//P8DAPn/+P/x/xgA8v/w//b////6/+j/DQAHAOb/8f8VAAEA8/8HACQA6P/i/w8AGwDm//z/CAARAOP/9v8GAO3/8P/0/wIAAAD9//7/BQD4//7/CAD4//L/+f8UAPz/4P8BAAMA8P/4//f/+P8GAAIACwDz//X/BgD8/wIA6//5/wUA+/8CAPD/+P/w/wIAEAD+//z/AAD+/+//AQAYAPH/7v8AAAcAAADv//r/8//+//f///8DAPb/CQD4/wAA+P/1//j/9f/1/wYA/P///wIA+f8GAAEA/P/2//D/9//1//7/6v/2/woAAQDz//r/CAD5//7/8f/4/+///f/3/+r//P/5/wUA9//5//f/BQAFAPL/BAD+//X//P/+/wAA///1//b/AQD0//X/AAD4/wQA+//4//7/BwD+//z/BwDp/////f/0/wAA///3/wIAAADv//v//f/6//7/AAALAPz/9/8SAPj/8P8FAPz/9v/2//3/+v/3////+P/6/wEAAQD7//z/AwAEAPL///8IAAEA9P8GAA0A7////wUA9///////AwAFAP3//f/9//v/9f/+//f/AQDw//r/+v/w//j/+v/6//T////7/wMA7/8AAAAACAD//wQADQD5//v/+f8AAAAA+P/4//v/AQDy/wAABQD5/wAA+P/9//f/9v/8//7/8v/x/wUA/f/4//j/+f/7//T/AgD8/wAA+v8AAP3//P8AAPr/+//5/woAAwD//wAAAAAAAP//7P/6/wAA9////wAAAAD5////CwAFAPL/+P8AAAAA6//7/wAA/P8DAPz/AgACAAMA9v8JAAgA+v8EAAUAAAD6/wAABQD//wUABgD5/wAAAQD0/wEA+v/3/wMA/P8CAAIAAgACAAEACgAEAP//+f8AAAYA///4/wUABgD6//v/AQD6//n/BQAGAOv/BwD6//3/CAD9/woAAwD//wAAAAAAAAAA//8LAAIA9v8EAPD/+f8GAPn/8/8AAAUA///9/wUAAAD5/wAAAAD/////AAD6//P/CQAFAAAA+f8AAAUABQDy/wAAAAAFAAUA//8GAAAAAAAGAP3/8v8AAAcA8//0/wMABgAAAPf//f8CAAIAAgD2/wMACAAAAAsACwD//wYAAgD8/wkAAgD1//3/CgD3/+//AwACAPX/+v8AAPr/+f/4/wYAAAD5/wAAAAD//wUADAD//wAABQAIAAIA/P/8/wIAAgD9//b/AwACAPz//f/+//D/+v8AAPn/+f/9/wMA/P8CAAkA9f8CAAkAAQACAAUAAAAGAAUA//8FAAYA/P/5/wAABgD5//n/DQAAAPn/AAAGAAAA+v/z//r//f/8/wIAAgD8/wkAAgD8/wkAAgD//wsABAAFAAIAAwD9//3//f/9//b/AAAAAPn/AAD6//L/BgAAAPn//f/8/wIACQAGAPn//P8MAAUA+f8AAPn/+f8FAAYA+v/z//3/EAAFAPn/AAAAAAYAAAAAAPn///8MAAUA/P8AAPn/AAAGAAAAAAAAAAAA8/8AAPL//P8DAPb/AwACAAgACAD//wYABgD5/wAADAAFAAIA/f8DAPb//P8DAO7/AAAAAAAA+v/5//j//P8DAPz//P8CAAkA/P8DAAIAAgAJAAAA9f8DAA0A+P8AAAYABQANAPz//P8JAAIA/P/8//3//P/1/wIA9f/5//L/+f8AAPz//f/1/wkAAgACAPz//P8DAAIAAgACAAkAAgAMAAYA8v8AABQAAAD4/w0ACQD8//3//f/8//z//P/2//r/8v/5/wAAAAD2/+///f8JAPz/AwAIAAkAAgD9/xEA//8MAAUAAgADAPX/AwADAPz/9f8DAPb/8v8AAPL/+f8DAO7//P8QAPz//P8CAAkACQD8//z/AgACAAIABgD5/wAADQAAAAAADQACAPz/9v8AAAAAAAD5//L/DQAMAPn/+f8AAAAABQAGAPL/8v/5/wMA9f8DAAIAAgAQAAAA+f/9/wIAAgAFAAwABQAAAAAAAAAIAP3/9f8AAAAAAwD2//n/AAAAAPn/8v/8/wIACQAAAAAA+f/8/wIACQD8//z/EAAAAPn/AAAAAAAADAAGAAAA+f/5//n/AAAAAAYAAAAAAAYAAAAAAAYA8v/y/wYADQDy//n/BgDy/wYABgAGAAAA+f8AAAYAAAD4/wYAAADy//n/AAAAAAYAAAD5/wYAAAD4/wwADAD5/wAAAAAAAAgAAgD9//z//P/1//L/AAD5//n//P8JAAYAAAD5//n//P8QAAAAAAAGAAYAAAD5/wYAAAAAAAYAAAAAAAAABgACAPX/+f8AAPn/AAAAAPn/+f8AAPX//P8CAAkAAgD8/xAA+f8AAAYAAAAGAAAAAAANAAAAAAAAAAAAAwD5//n/+f8GAAYA+f/y/wAABgD5//X/AgAJAAAABgAFAAAABQAGAAIAAwD1//z/+f/y//H/DQAGAPL/AAANAPn/+f/5/wAABgD5/wAABgAAAAAAAAD5/wAAAAAAAAAAAAAAAAAA8v/8/wkABgAAAAAA+f/5/wIAAAAGAPn/DQAGAPn/BgAGAPn/+f8GAAAAAAAAAAAABgACAPz/8v8AAAAAAAAAAAAAAAD5//n/AAAAAPn/9f8KAAIAAgACAPz/CQAAAPj//f8JAAAABgAFAAYADAACAPz/AwD8/+7/+f8AAPn/6/8DAAMA/P/8//X/AgAJAAIAAgACAAIACQAAAAAABgAAAAAAAAD5/wYAAAAAAAAAAAAGAPn/AAAGAAAAAAD5/wYABgAAAPn/+f8AAAAAAAD5/wAAAAD5//n/AwD8//X/AgAQAAYAAAAAAAAAAAANABAA/P/8/wMA/f/8//z//P/1//3/+f8AAPn/AADy//X/AgACAPz/AwAYAPn/BgAAAPL//P8JAAAAAAAGAPL//P8JAPX/CQANAAYAAAAGAAYA/P8DAPX/AwD8//L/+f8AAPL//P8DAPz/AwD1/wIAFwAGAAYABgAGAPz/+f8AAAoA9f8AAAAA8v8GAAAA8v/5/wYA+f/8/wIA/P8JAA0AAAAGAAYAAADx/wAAAAAAAAAA8v/9/wIAAwADAPz/AgAKAAAABgAAAAYADQD8//n/BgACAPX/AAADAPz/+f/y//n/AAAAAAAAAADy//z/AwADAPz/AgAJAAYABgAAAAAAAAAAAA0A+f8AAAAAAAAGAPn/+f8GAAYAAAAGAPz/+f/5/wAAAAAAAAAAAAD5//L//P8DAPz/AgD8/wMAAwACAAMA/P8CAAkAAwAAAAYABQAAAAAABgAAAAAAAAAFAAIA/f/2//L/+f/5//z/9f/8/wkA9f8DAPz//P8KAPz/CQADAAMACQAGAAYABgAAAAYACQD8//X//P/1//n/AAAGAPn/BgAAAPn/+f8AAAYA+f8GAAAAAAAAAPn/+f8AAPn/AAAGAPn//P/8/wMAAwD8/woADQAAAAYABgD5/wAA+f8AAAAAAAAAAAAA+P/5//b/AwAJAP3/AgADAAwAAAD5/wAABgAGAPn/+f8GAPn/+f/5/wIA9f/8/wMAAgARABQACQD8//z//P8DAAMAAgD8//z//P/1//X/+f/5//n/AAD5//z/AgADAAMA/P8DAAoAAAAAAAAABgAGAAAA+f8AAAAAAAD5//n/AAAGAAAABgAGAPn/+f8AAAYAAAD5/wAA+f8AAAAA+f8GAAAAAAAAAPn/AAAGAPn/+P8MAAUAAAAAAAYAAAADAPz/+f8AAPn/AAAAAAAAAAD5/wYABgD5//n/+f8AAAAAAAAAAAAABgD5/wAAAAD5/wAAAAAAAAYABgAAAAAABgAGAPz/AwD8//X/AwD5//n/AAD5//L//P8JAAYABgD5/wAAAAAAAPn/+f8DAAIABgAGAAAABgAAAAAAAAAAAPn/BgAGAPn/DAADAPX/AAACAP3/8v/5//n/AAAAAPn/9f8KAAMAAwD1//z/EAACAPz/AwAKAAAABgAAAPn/AAAAAAYAAAAAAAYA+f8AAAAA8v8AAPn/BgAAAPn//P8GAAYA+f/5//X/AwADAAkA/P8DAAMAAwAAAAAABgD5/wYAAAAAAPn/+f8AAA0ABgAAAAAAAADy//n/BgAAAAAA+f8AAAAA8v8CAAIAAwAGAPn/BgAMAAAA+f8AAAAAAAAAAAYAAAD5/wAABgDy/wYAAAAAAAYAAAD5/wAABgAAAAAA+f/5/wAAAAAAAAAA+f8AAPn//P8DAAIA/P8CAAoA/P8DAPz/AgACAAIA/P8KABQA+f8AAA0AAwD1//n/BgAJAPz/9f/8//z/AAD5//n/+f8GAAYAAAD5//L/AAAAAPz/AgACAP3/AgAJAAYABgAGAAAAAAAAAAUAAAD4/wYAAAD5/wAAAAAGAAAAAAD5//n/AAAAAPn/+f8DAAMAAAAAAAYABgD5//n/BgAGAAAAAAAAAAYA+f/5/wYABgAAAPn/+f8AAAYA+f/5/wYA+f/5/wAABgAAAPn//P8DAAYA+f8GAAYA+f/y/wYABgAAAAAAAAD5//n/AAAGAAAABgAAAAAADQDy//n/DAAKAO7/+f8GAAYAAAD5/wYAAwD8//L/AAAGAPL/8v/8/wMAAwADAPX//P8DAAkAAwADAAoABgAAAAYABgAAAAYA+f8GAAkA/P/1//z/AwD8//X/8v8AAAAAAAD5//L/AwD8//X/EAAJAPz/BgD5/wYABgAAAAAA+f8NAAAA+f8GAAAAAAAGAPn/AAAGAAAA+f8AAAAA+f/5//b/9f/9/wIAAwD1/wAACQAPAAoABQAGAAAABgAKAAMA9f/8//L/+f/5/wYA+f/y/wIAAwANAAAAAAAAAPn/BgAAAPn/AAAAAAAAAAAGAAAAAAD5//L//P8KAAAA+f8DAAYABgANAAAA+f8AAPn/AAAGAAYAAAD5/wAABgD5//n/BgAAAAAA+f/5/w0AAAD5/wAA+f/5//z/AgD8/wkADQAGAPj/+f8MAPn/+P8AAAAADAAAAPn/AAAGAAAAAAAAAAAAAAAAAPn/AAAAAPL//P8JAAAA+f8GAAAAAAAAAPn/AAAAAAAABgAAAAAABgD5//n/BgAGAPn/+f8NAAAA+f/5//n/AAAAAAYA+f/5/wYAAAAAAPn/AAAAAPn/AAAGAAAAAAANAPn/+f/5/wAABgAAAAAAAAAGAPn/8v8GAAYAAAAGAPn/AAAAAAYABgD5//j/+f8FAAYAAAD5//n/AAD5//X//P8JAAMA/P8CAAkAAAAAAAYA+f8AAAAA+f8GAAYAAAAGAAAA+f8AAPn/AAANAAAA8v8AAAAA+f/5/wAAAAAAAAAA+f8DAPz/AgADAAMABgAGAAAA+f8AAAYABgAAAAAABgAAAAAAAAAAAAAA+f8AAPL/BgAAAPn/BgAAAAAA+P/5/wAAAAD4/wIABgAAAAAAAAAAAAAAAAD5//n/BgD5//z/AwADAAMAAAAGAAYA+f8GAAAAAAANAPz/AgADAPX/AwD1//L/+f/y//z/AwD8//z/CgAKAAAAAAANAA0AAAACAPz/AwD8//X//P8AAAAA+f8AAAAA8v8AAAAA+f8AAAAAAAAAAAYAAAANAAAAAAAGAPn/AAAAAAAA+f/x/wYAAADx/wMABgAAAAYADAAAAPn/AAAAAPn/+f8GAAAABgAGAPn/AAAAAPn/+f8AAAAAAAD5//z/AgAGAPn//P8NAAYA+f8AAAAABgAAAPn/BgD5//n/+f8GAAYAAAAGAAAA8v8AAA0A+f8AAAYA+f/5/wAABgAAAPn/AAAGAAYA+f8AAAAAAAAGAPn/BgDy//n/DQAAAPn/+f8GAA0AAAAAAAYAAgD8//X/BgD9//H/8v/5/wIAAwADAAAA/P8DABQABgDy/wAABgAAAAYAAAAGAAMA9f8CAAMA9f/8/wAA+f/r/wAABgD5/wAA/P/8/wkABgD5//z/CgAAAAAAAAD5/wYA+f8AAAAAAAAAAAAADQAAAAAAAAAAAAYAAADy/wAABgD5/wYAAAAAAAAABgD5//L/BgAAAPL/9f/8/wkACgD1/wIAEAAAAPn/AAAAAPz/AgANAAwAAAAAAAAA+f/5/wYAAAD5/wAAAAAAAAYABgD5/wAABgAAAAAA+f8GAAAA+f8AAAAAAAAAAAAA8v/8/wIAAwD8/wMA/P8JAA0AAAAAAAYAAAAGAAYA/P/8//z/+f/5/wAA+f8AAAAAAAAAAAAAAAD5/wAA+f8AAAAAAAAGAAAAAAD5//n/AwD8//3/AgAJAAYA+P8GAAYAAAAAAAUABgD9/wAAAAD5/wYAAwD1//L/+f8AAAAA+f/8/wkA+f/1/wMAAwADAAkA/P8DAAMAAwD8/wMACQD5/wYABgANAAAAAwADAPz/AwD1//z/AwD1//L/+f8AAPL/9f8DAAMACgD8/wMAAwAJAAYAAAD5/wAABgAAAAAABgAAAPL/AAAAAAYABgD5/wAABgAGAPn/BQAAAAMA/f/9//3/AAD5//L/BgAAAOv//P8JAAYAAAD5/wYAAAAAAAYAAAD5//L/DQAGAAAAAAANAPz/AwADAPX//P/5/wYAAAD5//L/AAD5/wAA/P/8/woABgD5/wAABgAGAAYAAAAGAAIAAwD8/+7/BgD5/+v/BgAAAPn/9f/8/woAAwD8/woABgAAAAYAAAAAAAAA+f/y//z/AwAJAAUA+f8AAAwADAADAAMAAgD1//3//P/8//L/+f8GAAAAAAD5/wAADQAGAPz/AAD5/wAABgAGAPz//P8AAPL/8v8GAAAAAAAUAAIA+f8AAAYA+f/5/wYABgDy//n/BgAAAA0AAAD5/wYAAAD5//L/9f8DAAMA/P8DAAkABgANAPn/AAAGAAYAAAAAAPn/8v8AAAYAAADy/wAABgD5/wAADQAMAPz/AAAJAPX/+f8KAAIA/f/9/+7/8v8GAAYA+f8AAPn/DQAAAPn/8v/8/woA/P8GAAYA+f8AAAYAAAAAAAYA+f/5/wAAAAAAAPn//P8NAAAAAAAAAAAABgAAAPL/AAAAAPn/BgD5/wYAAAD5/wAABgD5//n//P/8/woAAwAAAAYAAAD5/wAAAAANAAAAAAAGAAAABgD5/wYAAwD1/wIAAgDu//j/+f8AAAYAAAAAAPL/AAD5//z//P8KAPz/AgAJAPz/AwAGAAAABgAAAAAADQAAAPL/BgAAAAAAAAAAAAYAAAD5/wAAAAAGAAAA8v/5/wAA+f/8/wIAAwAJAAAA+f8GAAAA+f8AAAAAAAAGAAAA+f8NAPn/AAAGAAAABgADAPX/+f8AAAAAAAAAAPn/+f/5//X//P/8//z/EAACAPz/CgAMAAYAAAAAAAAADAACAPX//P8DAPz//P/1/woACQD1/wMA9f/1//n/+f8GAAAA+f8AAAAAAAAAAAAAAAAAAAAABgD5//n/AAD5/wMA/P/8/woAAgADABQADQD8//z//P/5/wAAAADy//n/AAD5//z/AwADAAMA/P8DAPz//P/8//z/AwACAAoAAgAQAAYAAAAGAAYAAgACAP3//P/2//n/AAAAAAAABgAAAAAAAADy//H/9f8KAPz//P/u/wAADQD8/xAAEAAGAAAABgANAAMA7v/5/wYA+f8AAPn/AAD5//X/AwAJAA0ABgD5//n/+f8AAAAA+f8AAAAAAAAGAPn/+f8GAA0ABgADAPX/+f8AAPL/8v/8/wMAFAANAPn/BgAKAAkA/P/1//z//P/8//z/+f/5//n/+f8AAAAABQAAAAAABgAAAAAA8v/2/wIA/f8DAAIAAgAKAAAA/P8CAA0ABgAAAAYAAAAAAAAA+f/5/wAAAAAAAPn/AAANAAAA8v8AAAYABgD5/wAAAAD5//n/AAAAAAYABgAAAA0AAwD8/wMA9f/8//n/+f/5/wAAAAAAAAAA+f8AAPn/AwAGAAAABgAAAAAADQD5/wAA+f/5//n//P8JAPn//P8CAAkA9f8DAAkAAAAGAPn/AAAAAAYABgAGAAYA/P/8//z//P8AAAIA9f/y/wAABgDy//L//P/8/wIAAwAKAAYA+f/8/wMAAwANABQA+f8GAAoA/P/8//z//P/8//z/8v8AAAAA+f/5/wAA+f/1//z/AwAKAAMACgD8//z/EAAGAAAABgAGAAAACgADAPz//P/8/wMA/P/1//z/8v/5/wAA+f/4//z/AwAJAAAAAAAGAAAA+f8AAA0AAAAAAPn/8v8DAAAAAAD8/wIADQAAAPn/DQAGAPn/AAAAAA0AAgADAPz//P/1//z/+f/5/wAA8v/8/wYA+f/1/wIACQAJAAYAAAAAAAYABgAAAPn/BgAAAAAA+f8AAAYABgAJAPz//P/8//z//P/8/wMA/P/8//X/AAD5/wAAAAAAAAAA6v8KAP3//P8DAAMAAgD9/w8ADAAAAAAAAAAAAAAA+f8GAA0A+f/5//n/AAAGAAAA8v8AAA0ABgAAAAYAAAD5//n/AAD5//n/AAD5/wMA/P/8/xEAAAD5/wMABgAAAAAADQANAPz//P/8//n/AAAAAAAABgD5/wAAAAAAAAYAAAAAAPn/BgAAAPL/+f8AAPn//P/8//X/CgADAPz/CQAJAAIABgANAAwAAwADAP3/AgD9//X//P8CAO7/8f8AAPn/AAD5/wAAAAAAAPn/AgAGAAAA+f/8/w0A+f/5/wMA/P/8/wMACgD8//z/EAANAAYABgD8//z/AgD8//L/BgAKAPX/+f/y//n/AAAAAAAA+f8AAAYA+f/1/wkABgD5/wAAAAAAAPn/AgAAAAAABgAGABQA9f8AAAIAAgD1//L/AAD5//j/AAAAAAAA+P/9/wkA+P/1/wkACQAAAAYABgAAAAAA8v8GAAYA+f8AAAAABgD5//L/BgAGAAAAAAAAAA0ACQD1//z//P/8//z/AAD5//L/+f8AAAAAAAAAAAAA+f8GAAAAAAAGAPn/+f8GAAYA+f/y/wMABgAGAAYA+f/5/wYABgAAAAYA+f8AAAYAAAAGAPz//P/5//n/AAD5//n/+f/1/wIAAgAKAAMAAgAGAAAAAAAAAAAAAAAGAAAAAAAAAAAABgAAAAAABgAAAAAAAAAAAPn/+f8AAAAAAAD5/wAAAAAAAAYAAAAGAAYAAAAAAAAAAAD5/wAABgD5/wAABgD5/wAADQADAPn/AAAGAPz/AwD8//L/AAAGAPn/8v/5/wMABgAAAPn/BgAAAPn/BgD5//n/9f8DAAMAAwADAAIACgAGAPj/AAAGAAYADAD4/wAAAAAAAAYA+f8AAAAAAAAAAA0AAwDr//L/BgAAAPL//P8KAAYAAAAAAPn/+f8DAAIADQAAAAAABgD5//n/BgAGAAAAAAAAAAAABgD5//n/BgAGAAAA+f/5/wAA+f/5/wMA/P/1/wMAAwD8/wIAEQAGAAAABgAGAA0AAgD8/wIA/P/u//L/AAAGAPn/+f8GAPj/+f8FAAYABgAAAPn/AAAGAPn/AAAGAPn/+f/5/wYAAAD5//n//P8JAAAAAAAGAAYABgAAAAYACgD8//X//P/5//n/+f8AAAYA+f/5/wAAAAAAAAAAAAD5/wAABgAAAPn/+f8DAAMAAAAGAAYA+f8GAA0AAwAKAAMA9f8DAAMAAgD1/+7/+f/5//n/AAAGAPn/8v8DAAYA9f/8/wMACQAKAPX/AgD8/wMAEAAAAAAA+f8FAAAABgAAAPn/AAAAAAAAAAD5/wAABgAAAAAABgAAAAAAAAAAAAYAAAD5//L/AAAGAAAA8v8AAAYA+f8GAAYABgD5/wAABgD5/wAA+f8AAA0ACQD8//z/CgD1//z/AwD1//z//P/5/wAA+f8AAPn/8v8DAPz//P8KAAMACgAGAAYAAAAAAAAAAAAAAAAAAAAAAAAA+f8AABMACQD9//X//P/5//j/+f8AAAAA+f/5/wYABgAAAAYA+f/5/wAAAAAGAAAA+f8AAPn/DQAGAPn/BgDy//L/BgD5/wYABgAAAAAAAAAGAPn/AAAGAAAAAAD5//L/AAAAAAAAAAD5/wIA/P8JAAYA+f8GAPn/BgAGAPn/AAAGAAYA+f8GAAoA/P/8/wMAAgD1//X/+f/5//j/AAAAAPn//f8CAP3//f/1/wkAAgD9/wIAAwACAAoAFAAAAAAAAAAAAAAAAAAGAPn/BgAAAAAABgDy//n/+f8NAAAA8v8AAAYAAAAAAAYAAAD5//n/BgAAAPn/BgD5/wAABgD5/wAAAAAGAPn/8v8UAA0A/P/5/wAADQD8//L/AAAGAAYA/P/8//n/8v8AAAAA+f/u/wkAAwACAPz/AwADAAIACQD8//3/AgAJAAAABgAFAPL/+P8AAAAA/P8GAA0AAAANAPn/AAAKAPz/AwD8/+7/+f8AAPL/7v/1//X/BgAGAAAABgADABAAEAD5/wAADQANAAMAAwD8//X/EAD8/+7/9f/y/wAAAAD5//L/AwD8//z/EAD8//z/EAAAAPn//P8KAAYA+f8AAPn/AAAGAAAABgAAAAAABgAGAAIAAgD9//b//P/9//3/8v/4/wAA+f8AAAYAAAAAAAAAAAAAAAAA+f8AAAAABgAGAPn/+f8AAAYA+f/5//n/9f8KAAMACQAGAAYABgAAAAAABgAAAPn/AAAAAAAAAAD5/wAAAAD5//L//P8CAPz/CQAKAPn/BgAAAPn/AAAGAAAA+f8GAAAABgAGAPn/+f8GAA0A/P8CAAMAAwADAPz/9f/2//3/+f/x//n/+P8CAAIA/f/8//v/CQACAPb/AwAYAAYAAAAAAAAAFAD8//n/AAAGAAMA9f8AAAAAAAAAAPn/+f8AAAAAAAD5//n/AAAAAAAABgD5//n/BgAAAAAA8v/1/wkACgD1/wMAFAAAAAAADQAGAPn/AAAAAAYACQD1//z//P/5/wAAAAD5//L/+f8DAPz//P/8/wMAAgACAAkA/P8DAAIAAgAGAAYA+f8AAPn/9f8JAAIAAAAGAAAAAAAGAAAAAAAAAAYAAAD5/w0A/P/y/wAAAAAAAPn/8v8DAAAAAAAAAAAA+f/8/wIACgAGAAAABgAGAPn/BgAAAPn/+f8GAPn/+f8GAAAA+f8AAAYABgAGAPn/AAAAAAAAAAAAAAAA+f8AAAAA6//8//z/CQAKAPz/CgAGAAAAAAANAAYA/P/9/wAACgADAP3//f8DAO7/6v/y/wMABgD5//z/AwD8//z/AwD8/wMAAwD8/wkACgAAAAYAAAANAAAA8v8GABQA/P/r//n/+f/5//z/CgAGAAYABgD5//n/BgAAAAYA+f/r//z/AwD1//X/AgAKAAoA/P8JABQAAAAAAAYABgD8//n/AAAGAPz/8v8AAAYA+f/5/wYAAAAAAPn/AAAAAPj/+f8CAAAAAAAGAPn/+f/8//z/EAAAAAAADQAAAAYABgD5/wAABgD8//n/DQD8//X/BgD5/wAABgAAAAAAAAD5/wAA+f/5/wYA+f8AAAAAAAAAAPn/AAAAAPn/AwD8//z/EQAAAAAAAAAGAA0AAADy//n/BgAAAAAAAAAGAPn/AAAGAAYACgD1//z//P/y/wAAAAD5/wAA+f/5/wYADQAAAAAABQAGAP3/AAACAP3/+f8AAAAABgAAAAAAAAAGAAIA/P/8//z/+f8AAAYAAwDy//L/+f8DAAAABgDy//X/CgADAPz/CQAJAAYABgAGAAYA+f8AAAYAAAACAPL/8v8GAPn/+f8GAAYABgAAAAYACgD1//z/AwD8//X/8v8AAPL//P8JAPX/9f8CABAACgAGAAAAAAAAAAYADQD8/wkAAgD1//z/9f/9/wAAAAD4/wAAAAAAAAAA+f/5/wAAAAAAAAYABgAAAAAAAAAGAAYA8v8AAA0A+f/5/wAAAAD5/wAADQAGAAAA+f8GAAAABgAAAPn/+f/y/wAAAAAAAAAAAAD5//z/CQAAAAAA/P/8/wMAAwANAA0A+f8AAAYA8v/5//n/BgANAAYAAAAGAPz/AgD1//n/AADr//z/AwD8//X/AgD8//z/CQACAAIAAwADAAIAAgAGAAYABgAAAAAAAAD5/wAABgDy//n/BgAGAPn/+f8GAAYA+f/5/wYAAAD5//L/AwAGAPn/AAD8//z/CgD8/wkAAAD5/w0AAAAGAAYAAgD8//z/AwD8//z//P/1/wAABgD8//n/+f/5/wYAAAD5//L//P8KAAIAAAAAAAAABgAGAA0AAAD5/wAADQADAPX/AgD8//3/AgACAPX/8v8AAAAAAAD5/wAABgD5//n/BgDy//z/CQAAAAYA+f8AAAYA+f8AAAAA+f8GAA0AAADy/wAABgAAAPn/AAAAAA0AAAD5/wAAAAAGAAYAAgD8//X/BgD8//n/BgD5/wAAAADy/wAA+f8AAPz//P8KAAMAAwAAAAAAAAAAAAAABgAGAAYAAAD5//n/AADy//b/AwACAAkA/P8DAAkABgAAAAwABQD5//j/+f8GAPn/+f/1//z/CgD8//z/CQADAPz/AwAJAAAADQAUAPz/AgAKAPz//P8CAO7/9f/8//n/AAD5//L//P8CAPz//P8DAAkACgAAAAAADQAGAAAAAAAAABEAAwD8//X//P/1//L/BgD5//n/+f8AAAAAAAAGAAYABgAAAAYAAwD1//n/BgAAAPj/+f8AAAAAAAD5//n/BgAGAAAAAAAMAAAA+f8AAAAADQADAPX/+f/y/wAAAAAAAAAABgD5//L/AgAGAO7//P8JAAoABgAGABQA/P/5/wYA/P/5/wYAAAAAAAAA+f8AAPn/+f8AAPn/BgD5//z/CgAAAAAAAAAAAAYAAAAAAPn/+f8AAAAAAAD5/wMABgAAAAAABgAGAAYAAwD8//z/8f8AAA0A+P/5/wYAAADy//j/+f/8/wIACgD8/wMADQAAAAYAAAAAAAAABgAAAPn/+f/5/wAAAAD5//z/AgADAAMAAgD8/wkAFAANAPz/9f8DAPz/+f8GAPz/+f8AAAAAAAD5//n/+f/8/wkAAAD5/wMAAAAAAAAA/P/8/wkADQAGAPn/AAAGAAYA+f8AAAYAAAAAAAYA/P/8/wAA+f8AAAYAAwDy/wAAAAAGAAkA9f/4/wAADAACAO7/8f/5/wYAAAD5/wAABgAGAAAA+f/5/wAABgAAAPn/AAAGAAAABgAAAAAA+f8AAAYAAAD5//n/+f/8//z/CQADAPz/CQAGAAYAAAAAAAAAAAAAAAYAAAD5/wAABgAAAPn/8v8GAA0AAAD5/wYABgAAAPn/+f8GAAAABgAAAAAAAAAAAAAA+f8AAAAA+f/4/wYABgD5/wYAAAAAAPH//P8MAAYAAADy//n/BgAGAAAABgAAAAAA+f/5//n/BgAGAPn/AAAAAPL/AgADAAAABgD5/wAA+f/8/wkA/P8DAAYAAAAAAA0ABgD5/wAADQACAAMA/P/u/wAAAwD8//n/AAAAAPn/+f/5//n/BgAAAPn//P8NAAYA+f8GAA0ACQD8//z/9f8AAAAAAAADAP3/+f8GAAMA9f/5/wAAAAD4/wAABgD5/wYA+f8AAAAA+f8GAPL/AwD8//z/EQAAAAYABgD5/wAABgAAAPL/+f8AAAAABgANAAAAAAAAAPL/AAAGAPn/BgANAAkA/P/1//z//P/5//n/AAD5//n//P8CAAMA/P/8/wkABgD5/wMABgAUAAMA/P/8//z/AwADAPz//P8DAPX/9f8AAPn/AAD5//n/AAAAAPn/AgAAAPz//P8JAAYAAAAAAPn/AAAAAPn/BgAAAAAABgAGAAYAAAAAAPn/AAD5//n/BgAGAAAAAAAGAAAAAAAGAPn/8v8GAAYAAAAAAAAADQD1//L/AAAAAPn/9f8DAAoABgAGAAAAAAD5/wAADQAGAAIACQADAPX/9f/8//z/+f/y//n/AAAGAAAA+f8AAAAABgAGAPj/8v8CAAYAAAAAAAYABgAAAPj/DQD4//n/DQAAAAAAAAAAAAAAAAAAAAAAAAAAAAYAAAD5//L/+f/8/wIA9f/u/w0AAwD1/wAADQAQAAoAAwANAA0AAAAAAAMA/P8CAAMA9f8CAAMA7v/5//L/+f/5//z/AgD8/wIACgACAPz//P8DAAkADQAAAPn/BgAGAAAABgDy//n/DQD5//n/BgAAAAAA+P8AAAAABgD5//j/BgAFAAYA8v/x//z/CgAGAAAA+f8AAAAAAAAGAPn/AAAAAAYAAAD5/wAABgAAAAYAAADy/wYADQAKAPz/9f/8/wMAAwD8//z/9f/5/w0A/P/5//n/BgAAAOf//P/8/wIACgD8/wMAAwANAAAAAAAAAAAABgANAAIA/P8CAPX/AgD8//X/AAADAPz/8v8AAAAA+P8AAAAAAAAAAAAAAAD4//n//P8CAAIA/P8QAA0AAADy/wAABgAAAAAAAAAGAPn/AAAGAAAA+f8AAAAA+f/5/wYA+f/5/w0AAAD5/wAABgD5//n/AAD1/wIACgAAAAYA+f/u/xAAFAAGAAAAAAAAAPn/8v8AAAAABgAGAPn/+f/5/wAABgAGAPn/+f8AAA0ADQADAO7/AAAGAPn/8v8AAAAA+f8AAAYABgAAAAYAAAD5//n/DQAMAAMAAwD1//z//P8KAPX/7v8GAAMA+f/5/wYAAAD5//n/+f/8/wMA/P/8/wMAEQAAAAAADQAGAAAAAAAAABAAAgD1//z/9f8AAPn/+f8GAAAA+f/5/wAAAAD5/wAA/P8DAAIA/P8CAPz/EAD5/wMADQAAAPn/+f8AAAYABgAAAAAA8v8AAAAA+f8GAPL/AgAMAAAAAAAGAAwA+f8FAP3/8v8AAAAA+f8AAAAA+f8AAAYABgAGAAYA/P/5/wAABgAAAPn/+f8AAAYAAAD5/wYABgAAAAAAAAD5/wAABgAAAAAA+f/5//n/BgANAPn/AAAAAAYA+f/5/wAAAAAAAAYABgAAAAAAAAAGAAAABgD8//n/AAAAAAAA+f/5/wYABgAAAPL/AAAAAPn/BgAAAAAA8v/9/wkAAgAAAAAAAAD5/wMABgD5/wAABgAAAAAAAAANAAkA/P8DAAMA9f/1//z/+f/y/wAA+f8AAAYA+f/1/wIAAwD1/wMACQD8//z/CgARAPn/AAAGAA0ACgD1//z/AwACAPz//P8DAPX/8v8AAAAABgAKAPz/9f/5/wAA8v/y/wMAAwD8//z/AwACAAMAEAAGAPn/BgAGAAAAAAAFAPn/+P8GAAYABgADAO7/8v8GAPn/+f/5/wIABgAAAAAABgAGAAAA+f/5/wYABgD5/wYAAAD5//n/AAAAAPn/BgAAAAAABgAAAAAAAAAGAAYAAwD8/wMAAwD8//z/9f/5/wYA+f/y//n/AAAGAPn/+f8GAPn/AgAGAAAAAAAAAAYABgD5/wAA+f8AAAAA+f8GAAAA8v/8/wMACQAAAAYAAAAMAAAAAAD5/wAABgD5//n/8v8GAAAA+f8AAAAA7v8DAAoAAwAGAPn/DQAGAPL/AAAGAAAAAAAGAAYAAAAAAPn/AAANAPX/+f8AAAAA+f/y/wYABgD5/wYABgD5//n/AAAGAPn/+f8AAPn//P/8/wMACQADAAIA/P/8/woADQAAAPn/DQAGAPn/AAANAAIA9f/5/woAAwD1//z//f/9//j/+f/x//n/AgD9//z//P8JAAMA/P8JAAkAAAAGAAYADQADAPz//P/8//z/9f8GAAIA7v/y/wAA+f/5/wYABgDy//X/CgACAA0ABgAAAAAAAAAAAPn/BgAGAPn/AAAAAAYA+f8AAAAAAAD5//n/AAAUAAYA8v8GAAYAAAD5/wAAAAAAAAAA8v/y/wMA/P/u/wMAEQAJAPz/CQANAAYABgAAAAAAAwD9/wIAAwD1//b/+f8AAAAAAAD5//L/BgAGAPn/+f8GAAAA+f8AAA0AAAD5//n/BgAGAAAA+f8AAAAAAAAAAAAAAAAAAA0AAAAAAAkAAwD1//z/AwADAPz/9f8DAPX/6//5/wYA+f/1/wIAAgAJAPz/AwANAAYAAAAAAAYABgD5/wAABgAAAPn/+f8AAAYAAAD5//n/AAAMAAAA+f8AAP//8v8AAA4A///4/wAAAQD4//7/BwABAP//9/8AAA8A///w/wAADgD4////BgAAAAAA//8AAPr/AAD//wAAAAAAAP//+P/5/wAA/P/8/wMAAwAJAPz/BwAGAPj/AAAHAAAA//8AAAcABgD3/wAADgD8//f/AAALAPT/9/8HAAQA9P/+/woA9//4/wQAAAABAPj/9/8AAAAABQD4//r/BwAFAPn/AAANAAAAAAAGAAMA9f/5/wYA+f/5/w0ABgD5/wAAAAAGAAAAAAD5//n/AAD5/wAAAAAAAPX//P/8/wMAAwAJAAoABgAAAAAABgAAAA0A/P8DAAMA/P8DAPz/9f/1//n/AAAGAAAA+f/5//n/AAD5/wMAAwAGAAAA+f8GAAYA+f/5/wYA+f8AAAYADQAAAAAAAAAAAAYAAAAAAAAAAwACAAIA/f/8/wIA/P/u//n/BgD5//L/+f/8/wMAAwD8//z/CgADAPz/CgAUAAAAAAANAAIA/P/8//z//P/5/wYA+f8AAAYAAAD5/wYABgD8/wIAAgD1//n/AAD5/wAA+f/y/wIAAgD8/woABgAAAAAAAAD5/wYADQAAAAYACQACAPX/9f8DAPX/AAAAAPL/AAAGAAYAAAAAAPn/AAAGAAAA8v/5/wAAAAAAAPX/AwARAAAA+f8AAAYAAAAAAPn/AAAGAAAA+f/5/wAAAAAAAAAABgAAAAAABgAGAAAAAAAAAPn/AAAAAPn/8v/8//z/AwD8//z/AwARAAYAAAANAAYACQD8//X//P/y//L/AAAGAAAAAAAAAAYAAAD5/w0ABgD5/wAAAAD5/wAA+f/5//n/9f8DAAkACgAAAAUADAAGAPn/AAAAAAYA+f8AAAAA8f8AAPn/BgAAAAAAAAAAAAYA+f/y//X/AgADAO7/8v8UABEAAgAJAA0ABgAGAAMAAgD8//X/+f/5/wAAAAAAAAYA+f/5/wYAAAAAAAYAAAAAABAACgDu//X/AAAAAAAAAwD8//L/AAAAAPL/AAAGAAAABgD5/wAAAAD5//n/9f8DAAMACQD8//z/FwAEAP//AAD5/wcABwAHAAQA/v/2/wQAAwDu//j//v/v//P/7P/3/wUACgD9/xMAEwACABAADwALAPz/CQD6/+T/9f/1/+//9/8CAAMAAQAJABAACQAGAAUACgD8//v/7P/v//X/9v/3//T/9f/9/wwABQD//wUACwARAAAA//8EAP7/9/8EAP////8AAAYAAAAHABIA9v8DAP3/9f/7//X/+P/4/wAAAAAAAAAA+v/5/wcA+P/t//v/AQABAPr/+/8CAAoA/f8LABIACAAPAAQAAwD8/wIA9P/6//r/+v/7//H/8v/2/wQABAD+//7/AwAKAAIA+//0//v/AQACAAIAAwAKAA4ADgAHAP3/AwACAPv/+/8CAPv//P/8//3/AwD9//b//f8KAPX/8f/4//f/9//7/wIAAgD9/wMABAAOAAcAAAAGAAYA//8FAPv/8P/4////+P/4/wIAAAAAAAYADQAHAAAAAwADAAMA7v/4/wAAAAD4//j/8v/8/wMA/P8KAAMACgAAAPn/BgAGAPj/BgAAAAAAAAAGAAYA+f8NAAMA/P/u/wAABgD4//j/DQAAAPn/DQADAP3//f/8//z//P/4//j/6v/8/wIA/P/8//z/AwAKAAoACgAOAA0AAgAJAAIA7f/9//z/6//x//X/9P/8//z/AgAKAAMA/f8RABgABwAAAAYAAwD1//H/AAAAAAAAAADx//n//P8DAAMABgAGAAYABgAGAAMA/P8CAAIA/P/1//X/AAD5//n/8v/8/wMAAwD8//3/AwADAAoAAwAGAAAAAAAAAPj/AAAGAPj/AAAAAPn/AAAGAAAA+f8AAAYABgAGAAIA/P/8//z//P8KAP3/7v8GAPj/6//5//X/9f/8/wkACQACAAIAAwANAAYABgARAAoACgAAAAAA+P8AAPH/7v/8//X/9f/5//L/9v8KAA0A+f/2/wMAAwACAPz//P/8/wIA9f8AAAYAAAARAAoAAwAKAAYABgANAAIA/P/1/wAAFAACAPX//P/u//z/AADy//n/AADy/+7//P8DAAMACQD8//z/EAACAAIABgAUAAYA/P8JAPz/AgD1//X//P/8/wIA9f/5//n/6//8/xAAAAD5/wMAAwAAAAYADQD5/wAA+f/5/wAADQAAAPL/BgAAAAAA+f8AAAYAAAAAAA0A+f/5/wAAAADy//z/BgD1//z//P8JABAAAAAGAPn/AAANAPn/+f8AAAAAAAD5/wAAAAAGAAYA+f8AAAYABgDy//n/+f/8//3//f8KAAwAAAAAABMA+f8GAAkAAgD1//z/AwD1//L/+f8AAPn/+f/8/wMA/P8CAAMA/P8KAAYAAAAAAAAABgAGAPn/AAAGAAYAAgAJAPz//P8KAPz//P/1/+7/+f/5//n/AAAAAPn/DQANAPn/+f/5/wAAAAD5//z/AwD1//X/CQARAAYAAAAGAA0ACQACAPz/AgACAO7/9f8AAPL/+f8GAPn/8f/8//X/AgD9/wMACgACAAkA/f/8/xEABgAGAA0AAwACAPz/AgAKAPz//P8DAPz/9f/8//X/9f8AAPL/+f8AAPX/9f8DAAMAAgADAPz//P8XAAYA7v8KAAYA+f8DAAYAFAAAAPn/BgAKAAIA/P8DAPX/9f/8//n/6//u/wMAAwD1/wMAAwD1/wkA/P/8/woAEAAGAAYADQADAPz/AwAJAPv/9f/1/wIA9f/4/wAAAAAAAPj/+f8AABQAAwD1//n/8v/5/wMAAAAAAAAADQAAAAYABgADAAIAAwD8//z//P/1//n/+f8AAAAAAADr//z/AwACAPz/AgAQAPX/9f8DABAADQAGAPn/AAAAAAYABgD5/wAADQD5/+v/BgAAAPL//P8DAAYAAAAGAAYAAAD5/wAADQD5//n/BgDx//j/AAD8/wMABgAMAAAA6/8GAAUA+f8GAAAAAAAAAAAABgAAAPn/+f/5/wAABgAGAAAA8v8GAPn/+f8GAAAA+f8GAAYAAAAAAAAABgAGAAAAAwADAPX//P/5//n/8v/1/wMAAwD8//z/AgAKAPz/AgAUAAYAAAAAAAYAAAD5/wAAAAANAAMA9f8DAAIA/P/8//X/AADy/+v/AwACAPz/AwD9//3//P8DAAkAAgACAAkABgAAAA0AEAAJAPX//P/8/wMAAwD8/+7/6//r//X/CgADAPz/AwACAPz/AgAQAAAA9f8DAA0AAAD5/w0ABgAAAAoA/P8CAPz//P/8/+7/AAAGAPn/8v8AAPn//P8NAAYAAAAGAAYAAwD8//z/+f8AAAYAAADr//n/DQAAAPL/BgAGAPn/AAD5/wYAAAAAAAAABgAGAAUAAwD1/wAABgD9/wMA/P/y/+v/6v8CAAMA/P8KAAMAEQAUAAYAAwAUAAIA9f8DAPz//P/1//X/9f/y//n/AAD5//z/AwANAAAA+f8GAAAABgAAAA0ACgADAPz//P8CAPX/9f8AAPn/+f8AAPn/9f/8/wIAAwD8/+7/BgAQAPz/CgAKAAYAAAAAAAYABgD5//L/DQAGAAkAAwD8/wMAAgD2//z/AwDo//n/DAD5//j/AAAAAAAA+f8AAAYA+f/u/wMACQADAAMABgANAAAAAAAAABQACgD1/wMA/P/1//z/AgD8//X/+f/5//n/8v8DAAMAAwADAPz/CgAGAAAABgAAAAYADQD8//n/BgADAAIA/P/8//X/8v/5//n/AAANAPn/8v8GAPn/AwANAAAABgAAAPn/+f/5//X/AgADAPX/AgADAAkADQAMAAAAAAAAAAYAAAAAAAIACQD8//z/9f/y//n/AAAGAPn/+f/y/wMAAwD8//X//P/8/wAAAAAAAAYADQACAAoAGAAGAAAADQAKAAIA/P/8/wMA/P/1/wIA/P/8//X//P8DAOv/8v/5//z/AwADAAMAAwAGAAYABgAGAPn/+f8GAPn/8v8GAPn//P8DAAoABgD5/w0ADAAJAAIAAwADAP3/9f/1/+7/8f/y//X/AwAJAA0AAAAXAAkA/P8JAO7/CgAKAPX/7v/y//n/8v/1//z//P/1/wYACQD8//z/FwAKAPz/CgAGAA0ACgD8//z//P/8//z//P/8//L/+f8AAA0A+f8AAAAA+f8GAPL/+f/8//z/9f/1/wYACQD8//z/CgAXABQADQAUAA0ABgAAAPn/+f/x/+v/7v/2//L/6//u/wIAAwD8/wIACQAKABUABgD5/wAA+f/5//z/9f/8/wkACQANAAYAAAAUAAkAAwD1/+7/+f/5//n/8v/1//z//P/8/woAAgACAAMACQACAAIAAAAGAA0ABgAAAAAAAAAAAAIAAwD1//n/BgD5//n/AAAAAAYABgD5//n/AAAAAAYABgAAAAAAAAAAAPL/8v/8//X/AwAKAAIACQAGAAAA+f8AAAYABgAGAAcA/f8AAAIAAgD1//z/+P8AAAYA+P8GAPj/8v/5/wAABgDy//3/EQAAAAAAAAAAAAAA+P//////DAAMAPj/+P8AAAAAFQD3/wEAEgD2//b/AgACAPT/9//2//7/8P////X/BAAEAAUABQAFAA8AAAAGAP//9//3//b//v/+//v/AgADAA4AFgD7//r/AAAAAAAABQAFAPj/+P////j/+P8AAPX/CQAAAPz/CgAAAAYABgAAAPn/AAAGAAAABgD5//L/+f8AAAAA/P/1//z/CgACAAkABgAAAAAADQANAPz//P8DAAMA/P8DAPz/9f/1//n/8v/y/wIAAwD8/wMA/P8DAAMAAwADAAkAAAAAAAYA+f8NAA0A/P/8//z/AwAKAPz//P8CAPX/7v/5//j/+f/4/wMA/f/9/wkADAAGAPH/+f8DAPz//P/1/woACQAKAAYADQAGAPn/CQADAPz/CQD1//X//P/1//L/+f8AAAAA+f/1/wMAAgD8/wMACgACAAMABgD5/wYAAAD5/wYAAAD5/wAAAAD5/wAABgAAAAAAAAAGAAAABgAAAAYACQDu//L/AAAGAAYAAAAAAAAAAAAAAAYA+f/y/wAABgAGAPn/AAAGAAAA+f/5/wAA+f8AAAAAAAAAAPn/AwACAA0ABgD5/w0AAAD5/wYA+f8AAAYAAAD5/wAA+f/5//n/7v/u/wAADQACAAIAAwD8/wMAEAANAAAADQAKAPX//P/5/wAABgAAAPn/+f8AAAAABgD5//n/+f8AAAAAAAAAAAAA+f/1/wMAAgD1//z/AgD8/wIAEQD8//z/EAANAAAABgAAAAAABgADAPX/AAD4//n/AAD5//j/+f8DAPz//P8DAPz/CQD1//z/EAAKAA0ABgAAAAYACgADAPX//P/8//X/AwD8//z//P/r/wYABgDr//X/CgAGAAAAAAAGAAYAAAAAAAYABgADAAMA/P8CAPX//P/1//n/AADy//n/AwAAAAAAAAAAAAAABgAAAAYAAAD5/wYAAAANAAkA/P/8//3//f/x//n/BgD5/+v//f8DAPb/AgADAPz/AgAJAAIACQD8/wMADQAUAPz/+f8GAAMACgD8//X/CgD8//z//P/1/wMAAwD1/+v/8v/1/wMACgD1/wMAAwDu/wAACgADAAMAEQANAA0ACQAQAAIA9f/8/wIAAwD1/wIA7v/u/wYA+f8AAPn/8v/8/w0AAAAAAPn//P8DAAYABgD5/wAA9v8KAAYABQD5//j/AAAGAAwACgAJAP3/9f/8/+v/8v8GAAAA+f/5//X//P8CAAIAAwADAAMAEAANAAAAAAAUAAMA9f/8//z/9f/5//n/BgDy//L/AwD8/wkAAgD8//z//P/8/wkACQAGAAYAAAANAAAAAAAKAAMA/P/8/wMA9f/1//n/6//1//X/CQAQAAAA7v8KABQABgAAAAAAAAD5/wAABgDy//j/AAD1/wIA/f/9/woAEAD1/wMACQAAAA0AAAD5//n/+P8AAAYA+P8AAAAAAAAAAAAABgAGAAYA+f8GAAMA/P8DAPz//P/8//X/AAACAPz//P/x//j/+f/1/wIAAwD1//X/CgD8/wMAEQAUAA0AAAAKAPz/9f/8/wIACQDu//H/+P/4//L//P8DAAMACgANAAYAAAANAAMA/P8DAP3/9f/q/+v//f/9//z/9v8AAAwACQAKABUADQAKABQAAAAAAAAA6//n/+v/5//1//z/CQAJAAIACQAUAA0AAwADAAMA/P/v//3/+f/r//n/7v/8//z/AAAAABAAFwAGABQAAgACAPz/9f/5//n/8v/1//b/9v8DABEAGAAUABsAEQAUABQA+P/x/+f/4P/g/9n/zv/g/+v/AAANABsAHgAeABcAEwAaAA8AEQAKAOn/5v/p/+7/+//0//D/BAARAA0AEwAOAA4AAwD8//X/6P/l/97/4//n/+z/9P8QABQAFAAfACwAKAAkACMACgD4/+n/6//d/8T/xP/d/+//+v/+/wwAHwAuACsAGgAGAA0ABgACAAgA7P/v/+7/6v/t//r/AAAAAPn/+v8OABIADAAQAAMA7//w/wEA9P/s/wIA6v/x////+v8RACUALAAhACkAKwAVAAYA6v/c/9H/zf/C/7n/2v/p/wYAEgAgADQAQABCAC0AGQADAPb/7//j/9n/1P/Z/93/7f/6/w4ADAARACwAKQAZABwAEwAAAOz/1f/O/9D/3v/y/+//6f/x/w4AGQAgACwAJgAbACQAJQAMAAcA9f/p/+z/4v/e/83/0P/f//b/EAAcABUAFwAdABcAFAANAO7/6P8BAPz/+//8/wUA+f/0/woAEgALAAgAAAAAAAwAAwD0//n/6v/i/+///v8EAPj/8v/r//b/BAAMAAYAAQAOABEAJQAkABYAHQAIAAsADAD9/+P/0f/M/9f/3v/s//j/+f8EABUAGgAiABcACAAHAAUAEQAWAA0A9v/1/+L//f/2/+H/9P/9//f/+f8OAA8A9P/p//7/BAAKAAwABADu/+v/+/8CAAkAAgDu/wYAIQAuACMAGAATAAMAAAAHAPz/5v/P/8H/0P/h//r/6//j//D/EQAxADoAKQAYAAwAEwAkAB8AAwDr/8//1P/k/+3/7v/p/+//CQAKACYAJgAZAAUA7//0//v//v/3/93/1v/p//3/AAAAAAAAEgAmACoANQAfAAUA+/8GAAwA9P/n/8v/2P/e/9v/6f/2//7/9/8XACYAKQAkABgAEgAKAAkADQALAPv/3f/o//f/4v/h//X//v8BABAAAwDz//v/CAAEAAAAEgAJAAAA//8BABoAFwANAPj/5P/s/wYAAwAAAPD/7P/2/wcA9P/6/wIAAgAOAAEA+f/x/+7//f/4/+3///8MAAAADgAhACUAHgATABYAAwADAAEAAwDo/9L/1f/V//X/6P/q/+f/7P8CAA4AGAAcABsAEAARAB0AHgAeABUA+v/y///////w//X/9//q/+T/+P8FAPb/7f8BAAEA4//p//L/2f/4/wsAEAAaABgAHwAlADYAOgAdAAcA+f/0/+X/2v/k/9X/xf/S/+T/7P///xoADwD9/xcALAApABYA/P8AAAgACwAIAAsAAAD3//n/AgACAPL/7v/s/+r/9f/+////7//y/wMABgAQAAwA/P/+/wQADQARABAAAAAAAPr//P8KABAA/P/3/wQAAgD1/wcA7//j//H/+//9/+f/8P/z/wMADgAOAA8AAAAGABAAEAASABcAFwAVABUABQAIAAMA/v/d/9X/5P/l/+f/2f/c/+f/7f8LAAoACgD+/w4AJwAqACEAFQAOAAUABQAEAPz/8f/2/+//8f/3////AwD1//b/CwAGAPj/5//v//L/7P8GAAAABQD+////FgAXABAADAD9/woAGQAfABgACgAAAO//7v/u/+r/7v/y/+3/3//l/+//9v/l/+f//P8EAA4A+f8QABQAFgAWAA0ACgD2//b/BgD9/97/3v/s/9f/1v/3/+j/4v/i/9//8f8QABoAFAASABQAJwAeAC8AJgACAPj/AAAUAAQA6v/O/73/xf/m//D/3v/h/+//8v/6/wgAEADz//L/CAAMABEAFwAJAPr/AgAIAAIA//8FAPX/5v8DAAUA7v/i/9v/2//x//X/8f/o//H/+//z/wkAHQAUAAQAEwAUAB8ALQAaAAAA/v8LAAkACAD2//D/2P/R//D/+f/p/+T/8f/7//n/AAACAAIAAgD9/xsAFAAiACEAEAAIAAcADgACAPr/DAACAOb/8//s/+//5//l/+b/8f8AAPn/+/8DAAwABgAUAAQA/v8ZABsACQAAAPb/+f/z/wkADwAAAPf//f////n/AAD3/9X/6//8//z/9v/1////AAAKAA0AFwAgABEACgAWAAkAAAAFAPz/9P/8/wMA9P/4/+//6//0/wMA/f/0/+z/8P/6//z/9v/1//X/9v8MAAcAAwAJAAcA7P/t/wEA+f8OAAkA+f8GAPf/3P/c/+3/5v/j/+v/+f/x/+//+P/x//n/CAAWABMAEwANABAACQD8//z/+v8IAA4AEgACAPf/+P/+/+7/BADu/+j/4//s//T/5//0/+z/6P8HAPz/AgALAAwA9////w4ADAABAAoAFwAKAAsA/f/u//T/8P/3/wQA9v/+//f/6//5//v/BwAAAAIACADw/wUA///4//j/7P/r//b/AwD8/wYABgD4//v/9P/0//r/+v/t/+z/+P/p/+r//v/5//j/BQD4/+r/+P/+/wAAAAD///j/+f8FAP7/9P8DAAEA9f/u//7/+P/4//H/AAD8//z/AgAJAAYAAAAGAAYABgADAAMA/P/v/+v/AAAOAAgABgAAAAAA+P8GAAYAAQAAAPj/+P/4//D/+P/4//j/8P/w/wAA/v/4//j/+P/w//X/+v8KAAwABwAAAPj/BgD4/wAAAADq/+7/9f8DAPz/AwACAAIAEQANAA0AAAAGAAoAAgD1//X/9f/y//n/AAAAAPj/+P/5/wYADAADAPz/9P/x/wAA8v/x//j/7f/1//z/AwD7/woAAwD1//z/FwAUAA0ACgADAAMA9f/u//z//P/8//L/8v/u//X//P8AAA0ACgAQAA0ADQAUAAkA9f/u//z//P/q/+P/9f/7//z/+v8BAAMA9v8CABcABgD+//H/+P/4/wAA/v8GAOr/+P8FAPj/+v/0//T/+f/q//D/8f/w/wUABgD5//r/+f8NAP7/+f/5/+r//P/1//r/DwAFAAUA8v/7//r/+/8DAPT/9f/u/+r/+f8AAPj/AAAAAPn//P/8/xEADQAAAAAABgD5/+P/9f8KAAIA/P8DAPz/9P/6/wgA/v8MAP7/AwAKAAoACAD4//b/6P8IAPn/+f8AAAAA8v/1//z/9f/7/wEACQAFAPj/+P/+/wUA+//0//v/9P/t/+r/8f/x//H/9P/0//T/AgACAAUADAD0//v/+/8CAPv/7v/1//z/9f/r//n//P/8//X/AgD8//n/DQAJAAIAAwADABEADQAGABEA/P/1//L/8v8AAP7//v/w//j/+P8GAAYAAgD6/wMA/P/8//3/7f/x//n/+f/x//z/9f8CABIAEgAOAAEACAAAAAYABQD4//H/AAD4//7/BQD1//n/AAAAAAAABgD+//H/8f/w/+r/AAD2//n/+f8DAAAAAAD+/+n/8P/+//j/8f/t//L/AwD+/wYA+P8MAPH/AgACAPX/AwD8/+7/8v/y/wIABgAAAAAACAD5//z//v8GAPH//P8MAAYA/v8GAAAAAADq/wAABgD5//n/AAAGAAYABgACAPr/9f/8/wIAAgD7//X/9f/9//r/AQAAAPL/5f/s/+X//v8PABgA+f8FAAUA+P/7/wgA9P/m//z/CgDs/+b/8f/x//H/AQAGAPj/6v/0//T/8v8CAPv/CwAOAAYA+P/2/wUA/P/5//n/AAAAAPn/+f/x//T/DQD4/wAA+P8NAAYA+P/+//H/DgDx//D/FQD+//j/8f/4/+r/+P/x/+3/EQATAAoA/v8GAP7/+P/x//H/8P/2//H/+P/5//H//v/5//z/AgD8/wIADgAAAPb/BgAGAPP/9f/w/wAA8f8AAPn/6v/8/+z/BAALAPz/3v8AAA0A8v8AAAgA+P8GABQAEQD8//z//P8DAAIA/v/8/+7/6//4/wYA8f/4//j/8P/4//7/AAD4//L/9f8nAA0AAgDu/+n/AwD8/wEABgD2/wYA6P8BAPH/2v/s/wUAGADh//7/BgAGABIACgAMAPT/9f/t//n/GADi/+7/9f8MABwA8P8gAPX/EAD7/+L/BQDe/wAA/v/4/yMA2f80AOz/9v8AAPD/CgDw/+n/+P/+/xAA9v/4/+n//v8NAAIAGwDz/7//yv/m/+j/6P8AAPj/8f/+/wQACAAAAAAA+f/6/wUAEQAEAAQAEgAKAAsADgAAAAgAFQAOAPr/EQD7/+7/6v/5//n/+f/8/wsAAgACAPX/9f8DAPz/CgAKAAAACQANAAUA+f/z/97/+v8BAO3/5v/p//j/8f/4//j/DQD4//n/AAAGAAAA+P/5/+r/7v/0//X/+f8GAPn/DQANAPv/AwD0/wEADwANAAIAAgD8//X//f/1//X//f8DAAEA8v/4/wAA+f/5/wYAEQAAAAAADQADAAkA/v/0//X//P/9//X//P/4//n/+f8GAAEA+//+//v/+P/+//T/+//7//j/9f/m//j/+//7/wIAAgD+//7//v/0//n/8f/5/+v/8v/8//L/6v/0//7/BQADAAYAAgAIAP7//v8UABAABgD5//H/9f/1/+7/6f/w/+r/+v/8/wEAAgD+/wQA+P/4//H/AAD5//X//P/1//r/+f8GAAYABgANAAkAEQAUABsAEAAOAAAABgD1//L/8v/f//z/5v/f/+P/7f8CAO3//v/4/wIACAABAAUABQARAPT/9P/t//z/+f8AAAAAAQAAAPn/+f8AAAYAAAD+//b/8f/x//j/8P/i//X/7P/t//v/+//0/wkAEAD+/wYADAAQAA8AAADx//n/7v/n/+v/9v/8/wQA9P/1/wAADQAXAA0A+P/+/wwA+//0//T/7f/8//T/AQAAAPr/+f8GAAgAAAD4/wAA8v/8//z/AwD0//X/+f8GABAA/P8KABcADQAKAAoAAwAGABAAAAD5//H/6v/n/+f/6v/j/+b/8f8GAPj/+P/4//7//f8PAAgA+P/2//7//v/7//z/1f8AAAAAJgAJAPv/BAACAPr/5f/V/+z/4v/l/+z/9/8HANn/+f/o/xYAKAAPAEEALQAVAND/9P/6/+b/9v/0/xsA9P/6//P/AAAIAPj/8v/i/8j/AAD8/wMA+v8BAAkA7P8KAAIAOwAmAOD/GAAOAOT/pP8EAAAA9//x//D/IADh/7z/GgAIADUApv8LAAoA7P/a/wQAOAAAAAgA+f/u/wgA2P8QAAAABQAGAPv/HgDw/wkA+//1//z/o/9UAOb/kP/4/woAJADM/xAAEAD//wUACQAWABkACwAjAOD///+K/1IA/f8sAPP//v8HAOf/7f/s/7v/yP8FAEEA9P/7/wMAAwAKABwA9P/u/z0A8v/8/+v/wP8BAP3/HQDw/8j/CAAcAPT/3//v/+X/3f/d/7H/GQD9/wIAFwAbACMAFwAOAB8A+v/n/+3/YAAgAM//TQDE/+//+f+z/+T/z/8VAMH/ZwDd//b/KADD/8v/QwD8/wYA2P8UAOr/SADi/+7/7P/o/2MAr/8RAML/BgDR/+///f/o/7//GgAGAE4AHQDw//v/4v8DAD8A8v8EAOP/UgC2/xkAyv+l/xcA5v/X//v/xv8dAN//LACO/0UA6v8jAAAATADr/wgAAwDz/w4Atv+NAKv/TgDH/xwA7P8/AOD/3//4/8b/TACv/xwAv/9hALP/WABx/zQAyf8dAAMA7/8gANv/PQDX/9f/FADt/x0A6P8mAKD/MADU/18Au/8IANz/HwDj/woAyP8gANX/QwCP/y8A7/8HABQAvv9TAOX/LwC2/wYAAgAQANP/QwDP/+f/HwDY/zsAwP8xAMf/QgDQ/wkA2f8gAO//JADs/wsA/P+9/z4A2P8kAD0A5f8PAM//EwDN/wMA8P+4/0AA2P8vAI3/LgDO/xQADQA7AOD/TgARABUAwP/B/xsA4/8uAOj/DQBDAM7/CADC/wQA0//t/wQAnf9MANT/GQDk//H/CQDr/yEA9P8BAA4ABQASAPb/xv92AHD/YACt/ywA7f/s/wkAGgDy//j/ov+KAOT/+v+e/ysASwDE/w0AAQDh/wQA3v8RAKL/pAC8/yoA6f8BABYAwP+t/zMA2v8xAOH/TQC2//L/pP8yAN7/NgCw/1AAvv8cALz/DAAmAPr/LADG/yYA8f9FAMT/5v/U/0IAEgDk/+j/6v8RALr/IADl/yEA+f/s/ykAxP8gANv/BgD4/87/RQDw/zYA8f/8/8T/DgD8//z/OQC9/wkA1P8YAOL/6v8oAM7/9P/p/y4A1P8zAAYA8f/0/wsAOwCu/2wAw/8bAJ3/IgAZAOz/CgDe/xAAuf/e/7z/CgD9/xoA/P/k/yQA+v8eABwA8v8FALn/PAC7/w8AMwDG/2EAEwDq/8j/DwDp/+f/SgASABQAtP88ALb/9f+///f/jf/w/zsAEADw/x4AGAD+//r/4P/1/wMADgD6/53/JgD5/1AA/P8KAPr/5v/S/9D/uP9lAOv/yP/L/+z/PAAOADMAEgBTANf/DADj/5b////c/9H/EQAQACIAAAAjAGAA4f8FAJj//v/R/xEABQAHAMn/EAAQABQAGgAHABgA6v/7/wAA+v/W//D/CAD//wkA8P+4/1oAGADy/0IAJgD1/xQAAgDz/9//2P/l/93/8P/g/wYA0//z/1AAv/9kANr/uf/f/+f/7//p/yYACgASAOv/nP8iAOr/AQD1/xYA/P9aANj/BgD4//P/+P/r//3/6/9SAHX/bADA/8L/+v/p/w4AsP89AOz/SADw/yEAKAD1//L/NwDn/+L/jP8CAOb/XQASAOz/XAADAJ3/6v8bAPb/8P8tAB4Amv/z/5//bwBc/4oARQA7ALD/LwD1/7X/7f9HAFkAsv9YAOr/KgBh/0sA3//9/9v/7P/+/6v/CADY/wcA1f8BAP7/8f/t/9j/BgDw//P/+/8DAPT/+v/5//7/BACa/7n/ZQD3/2IA8P8zAPP/YQAfAOT/+//V/10AsP9bAMH/YQC5//v/1f8jANj/sv+x/0gA7v9IAOf/EAAxANf/wv8BACYAf/9pAMP/DwDS/+r/yP9m/wwA2v9aAEcALwA5AN3/CgD5//f/sf+j/1EA6f93AG8AXAAwAHL/fP9v/3v/Hv/I/93/BgDF/wUAGQApACIANQDEAFgASQD+//z/4f/u/xIAAgCzAEwA9v+F/wn/MP8s/zkAMABVASIBGgHAAPj/3f9w/3T/S/8U/zz/Dv+a/47/6f84AF4AEQH4AEQBOgEKAewAkABoAB0A5f+t/+b/FQD2/xAADwAGAIj/7/+z/7f/wv+e/1T/wP6a/kj+OP5D/vX9eP5A/qn+4P7i/2QA4gCoAakCAANiAyMElgPUAz8DlwLSAf8A+v8p/+H+MP72/Qz9PP1U/Dv7GvuV+gL7Ovr2+vT6Kvsy/E3+DQDDAbED7QXbBogHnAheCDkIgQbzBfADzAGOAIX/l/62/Tr9m/2I/XT9tv2Y/Yb9c/3a/CT8Lfvm+mv6d/ms+dH5ePrh+5f+6wAZA30FiAeICE4JfAkBCbQHdwYnBU4D3gCG/6P+rf1Y/U79EP6+/jD/9/8NAJj/ev/6/q39W/yJ+/76cPnM+ND4zvgR+pr8+/9uAlAFBghVCewJ5AlQCaoHbAWOA5kBGP8y/YD8Cfz7++/8Iv5L/wEA6gBrAcUAtv8Z/7396fua+hj6MPnP9xX46Ped+Av7V/7GAW8E+QcFCtUKCgtVCuQIGAZyA3QBQP/x/Aj8B/wT/BH9RP7x/6oATAHeAagBtABe/7P+4PxR+036Cvr2+AL4Z/gp+Hf5R/y0/+gCxwUNCZ8K/grCCrEJygefBC4CcQAo/kX87vtu/PD8Pf7O/y0BrAGrAcwBGwGv/zj+SP00/Pr6lvpy+tz5+/gF+ez4yfmg/Ob/DgPmBR4J1wrkCiMKSAlIBy8EogEPAAb+9PvJ+3b8H/0+/vL/kAHiAdAB1AHzAGz/5f3b/BT8Nvu++gH7ovrZ+WP5V/kU+UT7UP6XAXYEjgcPCnoK/AkRCZMHzQTQAR4Azf7g/B789Pzc/e3+ZQDsAaACUwLXAf4AV/+C/Rf8JfvZ+pz6/PrF+5b76/rk+gb61vou/XsAPwMkBsgI8gmnCcgIjAdoBS8CCQC+/nP98vtC/Lv9sv5IAP0BSgNnA6cC0AFJACX+Vvwd+4T6g/qv+rT74fsg+8D6Ofpq+QD76/2bAYYEnwcpCrgKLgoRCaIHOwRrAaH/X/6w/NH7E/0a/hX/zwBcAv4C6ALhAf8A9P50/Qz8Qftb+3v7Efxx/AP8EvtH+qj5BvmY+ob9WQE8BFkH1wm4ClEKBwmgB14EbAF4/yX+xvxY/In9yP7C/z4BsgJGAwUD+gGeALj+3vyg+8v6ivrc+tP7iPy3/DP8+vvc+tP5Mfro/BQA/wIZBsAIDwoyCjYJzAfyBPwBFgCS/nH9Nf0u/vD+1P+BASQCagJfAmcBqP/i/Yv89fvz+hn7t/uU/Bz9Of0U/Wb8wfqb+Yr5xftl/48C+gWiCGwK2ArECRwINwUDAggAhv4c/Q/9+f2S/rL/eQHwATICSAIQAV//GP6M/Ab8OPs7+/v7hPwy/ST9af11/Lb69/n2+N36lv4QAq8F2Aj5Cr0LUgqJCLQFOwKs//D98PyB/HL91f7P/44BhAJ7An4CeQG3/3H+Af1e/AX8yPto/O/8dv1u/cv9B/2a+4X6U/m9+cz8pf8IA2AGKQmGCugJgAgTBiQDaACj/qv9JP2L/cD+uP9aAV0CdwKPAvoBewDp/mn9g/w9/OH7Xfwh/ZH9lv2V/bL8CPu0+VT4A/mb/P3/1AOQB1sKdwtQCtUIEwauAuP/V/6I/RX9ov0A/9L/CQEEAuQB2AF/ARIA0P6r/dX8o/xj/Nb8nP2q/az9b/09/A/7+/kF+Y/5A/3PAPUDYwdhCgkLzwlXCKAFFQJW/9v95vxo/Gf96v7V/04BXwIwAqYBWwHA/0r+W/3E/LD8KP2K/XT+cP5I/uD9P/yg+hD6kvig+eL97QAgBAoIMwovCs4IFAdhBFEBof9w/pn95/1+/vn/IAEmAoUCAgKUATQAKf8B/hL9E/1Y/Xv9Lf5i/g3+xv2E/Pf6afob+WX5FP3i/5oCbgaoCBcJMAiUBlkE1wEoAJv+K/45/nP+tP/iAK4B1AGSATsB8/8T/03+WP00/YT9gP3p/S/+9/3G/en8hvsI+wT61/n0/Jv/LQK8BS4I/whYCOAG5wRvAqgA8P5h/jf+ff51/8EAkQGXAdgBcgEKAD//af5t/QT9B/0D/VX9bP1Z/W39fvyh+5T7jPpw+zL+SwAOA/EF1QdtCLcHZgaNBLkC9ABs/xT/l/7T/qD/mwA9AQcBSgHfAI7/DP9d/tz9Tv1F/VL9LP0C/eL8vPyy+zf7M/tx+vT7cv80AZ0DWwZsB38HugZQBQ0EZgLmABEAo/+m/3b/+P9QAVQBJwGsAXkAkP/+/hr+QP3f/K78r/xE/Dj8V/yF+0P7fvvu+sz86//dAQMEaAZBBxkHGwa2BGQD4gHbAB4A6f8tAOD/RwAgAdoAqgDiAO7/U/+g/jX+v/1I/Uv9QP3d/Iv8oPwU/Gj7wftj+zb8OP/uAAwDOAVMBn0GYwZHBbEDkAJXAUkAv//s/8z/v/+VAMEAhwBiACwAVP8x/5b+1v3Z/Y79Uf0g/dv8bfzV+8f7Ofvg+zX+v///AQcEowUtBgYGbQXzA5ACvQGPAOj/DQDb/+D/iADQAJQAWAAsAI///v6f/tn9rv2G/UP9E/3i/HT8OPxE/AX8SPzI/U3/1wBrAvAD5AQPBRIFdAR3A+ICDAIaAc0AbwAnADwAXQBEAAMA4v+a/xb/4P5j/g3+Df6i/Xr9V/0I/ef8Bv3u/HD9gv7G/+AAQgIaA7kDAATCA1gDoAILApYBDQGhAIsAXwAyAC4ALADu/5j/Vv8T/73+mf5t/lj+Yf42/kj+d/5n/mz+mv7X/hz/Xv/S/y0AnwDIAAcBHAEqAQwBKQEiAQQBBAECAeYAzgCqAGQAKwAuAA4A7v8JABgAEAD4//T/xv+H/1D/RP8s///+Lf9Z/3D/ZP+J/57/mP+v/+P/9P/+/x4ARwBrAHIAfACTAGUAOgA/ABwA/f8TADcANAAlAEIASQArADAALAABANr/vf+o/5D/ef+a/6r/nP+h/9P/4//7/wsAHQAmACAANgBCADEAGgAUAAUA5//g/+H/0v/c/wAAFwAoAEIAVABWAFMAUwAsABkA+//o/9H/xv/F/87/vv+k/87/2P/H/+D/AAAFAPf/DgAWAA8A8P/z//r/1f/O/9//0f/l//D/EwAPADMAQABDAFAAQwAnAAsAEgD+/+P/4//e/+H/0f/W/+X/5//n//n//P/+/wAA+v/6/wIA8P/s/+b/2//h/9n/6f/x/wAAGAAvADQAQwBAAEEAVAAsAB8ADwATAP3/7//n/9z/1//k/+X/2P/e/+D/2P/w/+b/8f/z//f/8P/t/+r/3//d/+X/7P8OAAAA+P8GABkAIQApADIAIQAYABcAGAAIAP3/8v/b/9P/0f/U/9L/zf/f/9j/1//m//j/AwD///n/AwAFAPb/8v/o/+X/9f/y//X/DAARAAcACwAXACIAGAAlADEAFwARAP3/AgDw/+3/7v/u//L/+f/6//3/DAABAPj/BwD/////+//z//j/7v/l/+r/9//z//P////v//v/DgAKAA4ADwARABIADwAJAAMAAAD8//T/7P/u/+f/5//t/+P/6v/x//j/AADr//f/+//8//7//v8EAAQABwDy//P/9v/2/wEADQASABcAEAASABMACAAAAPz/+f/2/+v/8f/z//j/8f/t/+3/7//2/wQA/v/3//v//P/0//T/9//4/+j/7v/9/wwAAgAHAA0ACQAdABkADwALAAYA+v/+////6//q/+b/4//h/+D/6P/x//////8GAAwAAQAHAAcA9v/0//z/9/8EAAsA+v/2//T/+v/1//P/9f/t//n//P/5//3//v/6//P/BQD+//z/CwD1/wEAAwAAAP//+//2//f/AQAEAPv//P/9//f/9/8FAPz/AgD8//7////4//3/+P/2/wcAAAD6/wAA/f/3/wIAAgD9/wwAAQD7//P/+f/6/wAA/f/v//3/AgAIAAYABQD4//3/BgD+//z/AQD6//j/AwASAAkA9v/1//n/9v/0/+//7//9//7//P8BAAQACgD///v/DwAFAAIABgAJAAkAAwAAAAEA8v/0//T/7v/l//L/9v/m//T/8P/6//7/AgANAAIACQAHAA8ACwAHAAMA9//3//D/6P/p//T/6v/u//T/9v/1//D/+P/9/wQACAD1//n/CwABAAUACAD4/wUABAD1/+f/7v/e/+P/8v/6//P/+P8BAOf/9P8GAAEAAgAHAA8ABQAKAAgADwAHAN3/EwDx/+v/+f/v//H/6/8FAPb/AgAKAAsA8/8OABAACgDp//L/FgAKAPH/+f8QAPv/6P/+/wgACAD4/wMA+//2/xoADwDs/6z/4v8VADcAEgD8/+7/9//7/xIAOwAVAPL/uf/f//X/9P/N//j/CAADAM7/2/9w/7L/JABXAB4A+/+a/7j/tQCMAL//mf/VAQ0C5f4K/VL/nQFBANH+PgCnAVMAf/69/noA1P8i/7D/AgH1AK7/f/8CABEAe/+N/1IAFADw/5T/mv/0/zEAPABlAG4ABQDS/38AawDA/xgAZgDYANj/dv/z/9YAegB0/yUAogA1ADP/dP9EAHYA2f+G/woAQgDd/2j/tP8qAA4AtP/I/xMA9/+2/+7/8f/0//7/0P/V//z/IADF/9P/RQAcAE//LQCFAPf/d/8HAHYA8/88/8P/cwAnABT/8P+uALf/iP8PAAABCgB0/2D/bwCgAC//IP8mAdwAN/9m/7YAwgCZ/z//RgDcAGMAhv71/yUBcgDm/pj/JwF4AM3+Pf8/AVYAuv8O/7sA3gCi/y//KQDsAOP/GP/f/94AcQDA/gEA0AAxAD//HAAvAAcAuv8v/zEAeADe/9n/2f9kACEAsP/Y/zAASgDU/z3/VAAIAPX/LP+r/5cALQAO/7z/2ADHADD/f/9AAKMAvP9o/yMAuAAVAGL/ZP9eAUwAH/8iAH8A9//5/5P//v8+ACcAS//T/8cA/P9a//j/tAA2AHH/uv9KAGEAtv97/ycAegB6/6j///+5AHb/xP8HAO4AvP+G/3gAIgD5/5X/ov9+AHsARf8v/6oAdABQ/6v/aAA/ANr/r/+5ADEAx/+I/04AbgDu/xX/8ADr/zMAbv/4/1AA3/+u/6T/fwAgAHL/3/9dADQAO/8EAGwANACY/6v/hAAYAA8Aev9GADoA0P+v//T/UADN/wsA2f8uAAQAnv8uAPP/KQDQ/yEAAgAIAPv/0P/o/y8A5P/a/+j/GgAIANj/mP8TAFAA5P/j/yAARgACANT/6/8mAPD/x/+a/zMAxP8QANT/DAApAOf/DgAJABYAPgAAADYAo/9LAMD/GADw/wcACgDr/9L/DQBMAOb/w//m/+b/AwDH//z/8f8kAPT/JADG/0kAFgBlANX/LADx/+r/6f/V//H/yv8DANX/x/8MAND/KwDx//D/MAAhAN3/BQAlAAYA8//r//3//f/k/+z/wf8YAN3/6P/0/woASQDa//v/TwDy/z0Atf+EANX/3P8AAAIA///G/xYAwv/4/9z/8P8IAOj/2//f/zIA3P9UAPT/JwDV/yAA+f8gAAQA7f/p//b/+f8aANj//P8TAMX/GQD+/wMABwACAGcAwP9EAA4A8f/y////9f/I/zgAo//a//n/6v/b/+//OQDQ//L/RgDl/wAAPADu/w4A/P/o/+v/AQDe//f/v//z////+f/7/8//VwDw/wAA/v8sAOf/FgDl/yIA+v/M/+X/JgDT//D/CwDj/xkAzP8IAP//AgDm/+P/IQDG/1kA7f9QAMT/HgDG/xIA9f8sAOL/7P/x/8H/GADZ/yIA4/8zAPH/BwD9/+//KAAAADIAGADx//L/0P/r//D/HQDC/xMAtf/5//z/QQC0/00AAQAKAEUA0P/6/w0A/v/4//b/8v/i/+z/6v/o/+L/7f/7/wAAAwAEAAgACAAUABIAEAAbAA8ACwD9//X/9v/y//L/7f/v/+n/5//u//v/8f/4/xIABwAIAAwACwAUABEAAwAAAP7//f/+/wIA6//q/+//6v/3/+v/8//7//r/8P/4//z/+P/5//L//v/+//L/8P/s//j//v/s//v/+P/6//z/BQD//wIACQAEAAkABgALAAsADAD8//3/AgAAAPn/8f/3//P/9v/l/+v/9/8CAPr/7/8AAAkABwAEAAMA9P8CAPP/8v/9//r/BQD9//P/8f/7//3/AAD2//L/+//5//X/+f/6/wAABQACAAAAAAD6//3/AwARAAAA/P/+//X//P/6//z/7//3//T/+v8FAAEA+P8AAAMAAQAAAP7/BwAAAAAABAD2//v/AAD8//7//P8GAP3/9//7//v/9/8MAAEA7f/2//n/+v/5/wIA+f/p//T//P8DAAAA9//+/wcA+P///wIAAQD6//T//v/7//f/9v/1/wAA+f/7//P/8P/x//j/BgD4//P/+P/+//7/9f/3//7/AgD3/+//9P/9//7/+v/x//3/BQAGAAAABgD///3/+P/6/wQAAAAAAAIA8v/8//L/6//4//v/9P/t//X/9P/s//j/+f/6/wgA9/8HAAYAAAD//wcACQAGAAkA+//6//////////b/BgAAAPL/9v8BAPj/+P/7//r/+//+//z/8//x/wIA+P/v//3//P/4/+7/+f8JAPf/AAD///3/8f/1//b/9P/5//D/9//7/wEAAwD7/wIAAAD+//n/+/8DAAAABwAJAP3/BwATAAQAAQAFAAkAAAAAAAYA/P8DAAEA+v8AAAIA9//n/+j/8P/p//7//f/1//f/+P/5/wEAAQD2//b/8v/3/wMA7/8AAP7/7f/z//v//P/2//7/+v8EAAgABgD///P/AQAGAPv/8//8//f/8v/+//X//f8BAP///v/8//7//v/2//j/7//3//b/AQADAAUAAAD9////+//1//P/+P/9/+7/+f////v/AgADAAIA+f/+/wEAAAACAAgABgAAAP3/9//+/+//+v/0/wYA/P/x//j/9f/2/+3/9f/4//j/9f/1////BwD7/wAABQD+//j/9/////r/AQD8//b////3//3//P/w/+j/9f/2//r/+f/3//r/+P/8/wIAAgAGAPj/+P/2/wsABAAIAAEA/f8DAPn/+P/0/wMABQD5/wEA+P/7//P/+f/5//L//v/9//n/9P/0//3/CgAAAPv/AQAFAAUABQAHAPj/CAAAAP///P8AAPb/9v/2/wQA+v/+////AgD0//X/CgD0//f/9v/v//z/9//y/wIACAD8//3/+P/+////+v/4/wIA+v/u//f//P8AAAQABAAGAAQABAD+//r/+P/8//T//P/0//T/9//5//7//P8CAP3/AgAHABAABQAEAAgA///7//X/AAD0//f/AQD2//T/+P8DAPn/8v/7//P/7f/9//7/9f/+/wMABAD6//b//P/7//T/8f8FAAUA8//7//z/+//x//f/+P8AAAAA+P/4//j/+P/8//T//P/5/+f/AQADAP7/8//5//T/9//+/wAA9f/5//j/7//9/wAA8/8AAPn/8//2//f/+P/7//X/AQD4//j//f////j/AAAAAPj/9//9/wMA+v/2//7/6f/q//z/AwDr/+3/+P8LAAkA/f/9/wAA9P/6////AQD//w4ACAACAAYA9//4//T/AwD///P/AQADAPP/9//6//z/7f/2//H/AgD9/+X/AgAWAAgA/f8IAAsAAQAKAAEA8f/9////AQDz//P/8f/h//H//v/6//3/+//8//n/+v/9//n/9f/1//j/+P/5/wAAAQD7//7/AAD8////7f/4/wkA//8AAP///f8BAAsAEgD2/+z/+f8JAPj//P/4/+7/+f8DAAMA/v/5//v/CAANAPv/AAAKAAIA+//3//j/9f/m//D/8v8BAAkA+f8HAPb/9/8EAPP/AAD//wYAAAD///7//v8BAPD/+f8BAPv/+v8IAPT/9P8GAPv//f8OAPr/7//8/wMACAD//wEACQADAAEA8P/+/wEA+/8JAP//BAD5/wIA8//+/wIA9////+7/+P/z/wAAAAADAPf/+P/z//j/+P/y/+3//v/z/+7//f8AAAAACQD9/wgACgD4//b/AwABAPT/9v/z//r/+//q//r/8P/9/+z/9f/o/+z/8f///wMA+f/7//D/+f8IAAcA9/8AAAcAAwD8/wsACAAIAAwABAD6/wgABQD7/wwABAADAPf//P/4//P/4//x//r/AQADAP7/BADz//P/+P/z//j/+P8AAPn/6f/k/+3/AAD1//r/EQD+/wMACwAMABMA+f/4/wsAAAD6//r/AgABAAQA/////wAAAADq//j/6P/w//X/8P/4/wQA+v/r/+r//v/4//n/FQABAA0AAgAGAAYA+v/2//7/8v/s/wAA9f/0//7/8//5//L/AQD8//z/5v/+/xUACgAQAA4A+//l/yAAAgABAP3//v/7//7/9v/l/wEA/P/7/+7/7f/5/wIA6v/2//z/9P/8//r/EQD1/+v/CgABAPj/BgD+/wUA6P8AAPP/+f8MAAgA4f8AAAYA/v/y//3/AgD6//z//P/8//b/+f8FAPn/3P/8/wkA+P8JAPX//f/8/wIACQAJAPj/DgDo/wAA9v8UABIABAD0//X/GQDu/+f/+P/3//D/4f/4//P/7v8MAPv/EgD4/wgAAAD7/wQAFQDl//X/+v/1/wIA7v/8/wIA/P/1/wAAAAD5//n/BgAMAAEA8f8OAP7/+P8AAPT/8f/9/+H/+P8QAOb/AQD7//r/BgAIAPj/+P/4/+v/7f8CAOX/8v8CAAkADAAAABAADQAAAPn/+f8FAAgA8f8IAO7/9f8CAPr/FAAEAPr//f/7//v/7f/q//T/+P/0/+3/2v/6/wAA+f8BAPr//P/8/yQAAgAEAA4A8P8GAAAA+P8OAAAA+f8AAAAA5v8AABAA+P/5//n/6v/+//n/+P/+//H/8f8SAAYABQAAAAYA8v/2/woA+f/0//f/+P/x/+7/DwD+//X/CQAJAPz/AgACAAwA9v/y//n/8v/p/xUAAgDx/wkABgD+/wYA2//u//D/8P8IAPT/+P8IAPn/9f8IABUABgAVAA4AAAAAAPj//f/1/+D/4v/y/+z/9P/k/+z/+v/q//7/+P8CAPz//P8XABcAGQABAAYAEgD9//X//P/6/+r/4P/3//X/7v/9//r/CAAZAA0AFwADAP3/+/8RAPz/+v/t/+b/7f/Q//X/8f/1/wYA+v/5//j/BQANAAIACAACAPz//P/1/+f/6//u/+7/+P/y/wAA+v8BAPH/BgAFAAYA//8IAAQA8v/5//H/5f/u/wAA8/8DAO//AQAYABUADwAbABQACgARAPb/9v8CAPz//P/1//X/8v/y/+j/5//0/x8AIAAbABEACQADAAAA7//v/wEA+P///9//7f/j/+r//v/2//r/DwD7//3/FAAMABcACQDn/wEA2//c/+T/4//j//b/3//e/+P///8LABMAFgAMAPz/8f/d/+f/1v/p////9/8MAA4ABwALAAkAKgAhAAYAFgASAAUABQD3/+//7//u//T/6P/t/9X/5f/V/9///P/8/wgAGwAjABoAJAAdAAgABgAWAPj/8v/g//H/7P/3//3/6f/m/wEAEAAXACoAEAAKAAcA8f/v//j/9/8HAOj/5P/p/+r/6P/w//j/BQAFAP3/9v/7//P/+f//////9v/+//3/AwD3/+v/+P/x/9f/6f/0/wMAFQAdABMAEQAEAOn/8////wQA9P/c/+j/9P/8/woABQAQACEAGQAUAA0A7//y/+D/z//Y/+3/3//a/+X/8v8UAAAAGgAiADAAIQABAPj/6//w/+D/4//x/+T/6f/k//D//P8JAAIABwDz//b/HwAMABoACQARAPr/AAD1//H/9f/g//T////l/+r/+//v//f/HwAeABsAFwAKAPv/BgDm/9X/7f/r//X/8f/Y/9//9P/4/wAA+f8fABgAAwATAPz/CwAJAP//GgD0/+P/+f/z//v////u/+X/0P/t/+j//P8WABcAGADy//n////+/xYA9v/t/9r/5//l//z/9f8IACAACQAmAC0AEQAWABEA8f/q/+j/2//3/wUA/f/W/9v/3f/p//j/HgAKAAEAAADy/wIAAwAJAAkABwAIAOD//f/u//f/AwDh/9D/yP/U//L/FQAeABcAHQD7/wMA/P8JAAQA7v/s/8z/0v/5/wEABwAZADkAJQAWACAAFwADAP7/6v/J/93/AwD5/wkAAwD8/+3/AAAdAAgAFAD5/+r/4v/W//H/BgAfAAoA+P/m//D/3f/u//b/3P/j/9X/4f8AAB4AIgAnAC8AKAAmABAAEAAXAPT/4v/W/9L/9f/3/w4ABAAEAAkABQALAAkADwD6/9T/uP+8/9v/+P8FAPP/7P/l/+D//P8bACAAEgD6//H/8P8OACcAKgAKAN7/3P/u//r/FAD///3/5f/T/8T/3P8BABIAIQAnACEAKwAbABEAEQABAPn/1f/Q/9D/6P8EAB4AJwD4//X/AQAHABkADgD2/77/tP/b/+j/DwAgABwA7P/h/+j/BAAOAAYA8P/2//f/7f8GACAAJwAMAPb/+f/7/+3/9//i/9//2P/T/+P//f8TAA4AKAAqACYAHgAGAPr/AADf//T/1//Q/+L/AAATABsAIgAUABAA8v/9/xMAAADn/9//1P/y/wMAJwAkAAQA5v8OABAADwAWAAwA3f/J/9//5/8MABEACwDz/+P/2f/M/9r/5v/7/wYA3//t/+3/6/8PAC0ARQA4ADEAHgD///b/5v/i/9n/1//V/+f/9/8TAAwABADf/+n/AgANAAoA8v/g/6v/vP/6/w0ALwAZAAoAAgD6/xMAMgA2ABgA7f/Y/+n/AgApACsACgD0//7/+f/m//z/EAD6/9L/3v/Y/+D/9v8EACwAOwAlAB0AFQDp//L/8//o//P/3//g/+v/AAADAAMACAD2//r/AQAYAAUA/f/r/+z/4f/r/wQAEQAgABUAAwD0//r/CgAHAPL/2//U/+j/CAAXABMA9//b/+n/8f/w/wYACQDv/+3/5P/U/+L/6v/v/wIALgAXAA8AEQAEAAYA///+//T/5P/w/w0AEQAAAOT/5P/s/wEAGwAUAPb/7P/m//v/DgAGAPr/7/8FABoAFgAVABAA+f/w//3///////b//f///wIACQABAPj/BQABAAEA8v/l/+b/2//9/xcAFAATAAgA9v/+/xgAFgAgABoABADu/+T/6P8HABoABwDx/+j/5//r//b/6//m/9n/0v/u/xMAGwD5//f/6P/k//z/HwAmABEA+f/f/+L/+f8PAPn/9P/w/+n/9/8BAAoAAgAGAAAA6//f/+7/CAAOAA0AAwD1/+T/5P/u/wUAIQAcAA8A7v/1//7/BwACAOr/6v/x/wUAEgD+/9r/zf/Z/+3/AwAXACcAGAD5//j/6f/s/wsAMQArABcABADf/8n/5/8SAAgA/P/u/+j/+v8aAAoABQD5////BAD9/xQABgDs/+3/8P/+/wAA/v/7/wkA/f8GABMABwANAA4ABQACAPf/5v/u/wsAHQAMAPP/0v/L//H/BgAqACYABQDg/+T/BwAPABQAGQD6//b/CwAOAAAA9v/t//D/6P/q/+7/CQAjABsABQAIAAsACAAHAAwA/f/p/9D/1//0/wIAEwAVABgAAwABAAIABwALAA8ADQACAO7/3//u//X/EQAaAPn/6P/d/+z/DwALAA4A6v/P/+f/CwAtADEAKQD//9z/6/8WACUAFQDl/8P/wP/T/wgAKgAuACMABgAMAAYAAQAEAP3/6f/n/97/1v/2/wIACgAhABwAGAANAP3/BAACAN3/4//y//3/FQAQABIABwD8//n/6v/t////EwAaAA0A5v/O/9j/AQAlAC0AJAARAPL/5P/6/x8AMgAEAMj/qf+9//j/KQA3ACEACwD4/wYAFAANAAYA7v/k/+j/4f/t//T/BgATACAANwAmABcA8f/d/93/0v/c/+j//f8YAC0AFQD+/+X/3P/n/wcAJwAlABgA7f/e/+j/BQAZAAMA9P/k//z/FAAtADoAGgD2/97/1P/Z/+n/AQAJAP//+f8AAP3/GgAtABEA+//d/8r/4v/5/yQAIAAKAAAAAAAXACAAHgASAOX/1P/a//j/DAAGAPz/9v/z/+n/5//w//n//v8FABMADgAXACkAKgAtAAEA3//G/7X/5P8SAB8AJQAdABAACgAVABgAAgDr/8z/xf/Q/+P/+/8TABIACgAIAAoAEwAOABMAFQD9/+P/7/8GAB4AHQAEAPH/2P/j//3/FQAeAAUA8f/g//H/BwAQAAEA4P+7/9D/9P8XADMAOgA1ABgAAgD///f/9//1//H/2P/Y//T/CAAoADYANAAcAOj/1P/d/+r/9//m/9n/1P/u/xQAMgAoAB4AEwAMAAUA6f/9/wgAAgD6/+j/6f/f//L/DgAcABcAAgD6/+j//f8UABkAFAD9/93/2f/7/w4AFAD0/9//4v/0/wwAJwAkABAAEwAVABUADwD3//D/2v/U/+f/CAACAPr/6f/s//j/+/8LABsAEQAeABsABQDy/+//6f/6//3///8GAAEAEQAXABIABAAJAAEA6v/a/9v/5P/3/wwACQAJABMA9P/t/wUAFwAbAAkA9P/h/9r/5v/t//v/CQAeAC8AJgAhAAcAAAAHAAEADAADAOX/2//e/9T/4P/x/wEAEwAUABYABQD7//n/BwAIAAUACwD9//7/AAARABkAEQAIAAAA6f/r/+L/2v/m/wMAFwAdABoA8v/n/wAAAAAKAAkA/v/y/+v/8//4/wcABAAAAAAACQANAAQAFwAGAPj/AAAWABUA/v/l/+H/7v/5/wIAAwACAAcAAADr//T/7f8AAA4ADAASAAoA9P/m/wEAHQAdACEAEQAGAO7/2//r/+3/BwAAAPP/6//1/wIA9f/5/wYADQAIAAgAAgAKABoAEwAMAP3/AwAAAP//5P/f/+b/8v/2/xYAJQAWAAQA9P/o/+j/AgACAPT/7f/3////BQAAAAAAFwAbABsAFQDz//X//f/4/wcACwADAPr/8v/1/wsAFQAKAAAA7v/i/9v/4P/1//v//P8CAAAACwACAPz/BAAZACAAFAAWABIA/f/d/9r/5//9/w4AGQAWAPT/9f/1////CAARAP//8f/k/+r/8/8IABwADwAQAP///P/7//T/BAAHAAMAAwANAAoAAQDr/+v/CAALABMAEQD0//n//v/u/+r/4f/r////+f8MAPv/6v/7//b/BwAjAB0ACgAAAAQA9//4/wgAFgAUAPH/4f/m//j/BgAZABcA7f/r/+H/5//6/w4AGAAKAP//8//l/+n/+/8XACsAJAAYABEABgD//wAABgDx/+L/7P/t/wAADwAEAPz/AAD2/+H/5/8GAPj/+f////3////3/wQABQAGABIAGgAEABMAGQAFAAgA9//o/+T/9P8NAA8ACwD3/9j/2P/e/wMAKQAyAB4ACwDx/93/2P/s/wUACQAJAAYAAwD1/woAHAAPABIAEQD///b//v8FAPr/+v/5/+z/6v/m/+T/7f8EAAUA9/8HAA8ACAABAAIADgAIAAIACgAJAAEAAAABAPr/+v8DAAwABwDy//3/6//i/+X/6/8NABMADAAVAP7/9P/8//f/BwAIAAIABwAAAPH/AAD7/woACQD5//f//v8AAAgAHAAVAA4ABADb/97/5//5/wMAEQAPAPD/7f/w//L/CgATABsAEwD1//D/9v/3/wYABwD6/w4AAwD8/woA/P/u//j/8f/1//b//v8LABEA///t/wEACQALAA8AAAD4//D/+/8DAAwACQAIAPj/5//x/wEACwAVABIACAD+//T/7f/s/wQAFQASAAEA///8/+b/+v8KAAkAEAAIAPH/8P/+//j/9f8LAAYA+f8GAA0A+f/5/wwAEAD2//z/CgACAPT/7f/x/wAA+//0/wMA9P/o//3/DAAEAA0AHgAgABAA8v/r//f/BgAMAP//BQD9/+b/6f/z//v//f8EABIABAAAAA0ABQD/////BgADAAMAAwADAAIA9f/1//z/6//r/wMA/P/1//X/BgAKABEAGAAMAPv/+/8CAAoABAAEAP3/5//m/+//7f/1/wcACAAAAAAAEAAPAAkAAAAGAAwACQAKAAMA/f/1/wkA/P/j/+r/7v/1//z//f/5/wYAAAAGABAAEAAUAA0AGwARAPn/+P/x//j/AADu/+f/8v/5/wAAAAD1/+7/8v/5/xQADQADAAkACgANAA0ABgADABEAAwDu/+7/8v/5/wAABgAAAAAABgD5//L/DQAYAAMA/P8DAPX/7v8AAAAA8v/5//z/7v/1/wAA8f8GABwAAgACABgAFAAFAAMAAwACAAoABgDx/wAA9v/u//X/6//r/+7/8v8AAAAA+f8DAAkAFAAYABgAFwAKAPz//P8CAPz/9f/u/wAABgD4//L/8v/1//X/AwACAAIAEQACAAUADgAGAP//AwADAPT/+f/6//H/+P8DAAAA//8AAPn/9f8CABEAFAAJAAIACQANAPH/+P////T/8//u//j/9v/p//z/AgD8/wMACwAEAAsACAD6/wAADgAOAPz/AAACAA8AAQDt/+3/6f/w//v/CQAGAPb//f8LAAQACwAIAAEABwAHAAAAAAAAAPj/BQD///D/8P/7//v/+/8QABQADQD9/wAA+v/6/wAAAAAAAAAAAAAAAPj///8FAP//9//w//T/+/8CAPX/AwADAAMAGQAVAAcA+v8RABEA9f/2//z//P/7/wIA/P/1//z/+P/4//j/6//u/wAAAAAGAA0AAwAKABgABgD5//n/BgD5/wAABgAGAAAAAAAGAAAA+f8AAA0A+f8GAPz/+f/y//n/AAAAAAYA+P/4//X//P8CAAIA/P8CAAoAAwAKAPn/AwAHAAAAFQARAAMA/P/8//z/9f8CAPz//P/u/+f/AADt/+7/BgAQAAMAAwAJAA0ADQAAAAUAAgAKAAMA/P8DAPz/9f/1//z//P/5//n/AAD5//L/9f8DAAoAAwD8//X/AwD8/xEAEAAGAAYABgAAAPn/BgAGAPz/+f8GAPn/8v8AAPn/BgAAAAYABgD5//L/9f/8/wMA/P/8/xAACQAGAAYA+f8AAAYA+f8AAAYAFAADAPX//P/u//n/+f/5/wAA+f8GAA0A+f8AAAAA+f8AAPj//P8CAP3/AwADAAoAAAAAAA0AAAD5/wYADQD5//L/+f/y//z/AwAKAAMADQAXAPz/8v8AAA0AAwD8//z/9f/5//n/AAAGAPn/+f/5//X//P8DABAADQD5/wAA+f/1/wMAEQAGAAAAAAAAAA0AAwADAAMA9f/1/wAAAAD5//n/AAAAAPL/9f/8/wMACgAJAAAABgAGAPn/AAAAAAAA+f8AAAYA+f8AAAYABgAGAPL/8v/8//X/AwAQAA0ADQADAPX/+f8GAAMAAwADAPz/9f/8//n/+f/5//n/AAAAAAAA9f8DAAIA9f8KAAkAAAAAAAYABgAGAAYAAwD8//z//P8DAAoA/P/u//L/AAAGAPL/+f8AAAAA+f/1//z/CQADAAIAAwD1//z/AgAKAAMAEAAGAAYABgD4/wAAAAAAAAYAAwADAPb//f8KAPz/9f/8//z/AwD8//X/+f8AAPn/+f/5/wIAAAD8//z/9f8JAAIAAgADAAkADQAAAAYABgADAPz/+f8AAAAABgD8/wAAAAADAAMAAwD1/+v/AAAAAAAA+f/5//z//P8DAPX//P/8/wAABgAJAAMAAwAQAA0ABgAGAAkACQD8//X/9f/1//L/BgAGAPn/AAD5//H/AAD9/wkAEwAAAAAAAAAAAPL/+f8AAPn//P/8//z//P8KAAMAAwAKAAMABgAAAPn/AAAAAAYABgAGAPn/BgAKAAMA/P/8/woAAgD8//z/9f/u//n/8v/u//X//P/5//n/BgAGABQACgAKABQAFAAKAAoAAAAAAAYAAADy/+f/7v/8/wAA6//y//X//P/8//z/EQARAAMABgAAAAAABgAGAAAA+f/4//L/AgACAP3/CQANAAAAAAANAAAAAgD1//n/AAAAAAYABgDy//n/AADy/wIABgAGAA0ACgACAPX//P8DAO7/8v/5/wAA+f/8//z//P/8/wkA/P/8/wMACQAJAA0ADQAAAAoAAwD8//X//P/y//n/+f/y/wIAAgAGAAAAAAAGAAYAAADy/wYADQDy//n/BgD5//L/AgD8//z//f/9/wkA/f8DAAkACQAGAAAAAAAAAAAAAAD5/wAABgAAAAAABgAAAAYAAgD1//n/+f8AAPL/9f/8/wMA/P/8//X/AAANAAMA/P8DAAoACgAYAA0A9f8JAAkA9f8DAPz/9f/8/+7/+f/5//n/+f/1//X/AgAJAAoAAwD8//z/CgANAAAABgANAPz/8v8AAPn/8v8GAAYA+f8AAAYAAAD5/wAA+f8AAAYA+f/5/wAA/f8GAAYABgAAAAAABgDy/wAADQAAAAAABgD5/wAABgD5//n/AAAAAPn/AAAAAAYAAAAAAAAA8v/5/wYAAAAAAAAABgANAAIA+f8AAAAABgD5//n/+f/y/wYABgD5/wYAAAAGAAAAAAAGAAYAAgD1/+v/+f8AAPz//P8CAAMA9f/8/wkACQD8/wMAFwANAPz/AwD1/+v/8v8DAPz/9v/9/woACQD8/wIACgAGAAAAAAAGAAAAAAD5//n/BgD5/wAADQAAAPn/+f8AAAAA+f8GAAAA8v8AAAYAAAAAAAYABgAGAPz/AAAJAPX/AwD8//X/+f/y/wAAAAAAAPn/AAAGAAAADQAAAPn/BgAGAAIA8v8AAAAAAAAAAPL/AAD5/wYAAAAAAAAA+f8GAAYA+f8AAAAAAAD5//X/CQAAAPb/AgAKAAMA/P/8/xAABgAGAAAABgAKAPz//P8CAPz/9f/5//n/AAAAAPL/+f8DAPz//P8DAAkA/P/8/wMAEQAAAAAADQANABAA/P/8/wMAAwD8//z/7v/y/wAABgD5//n/AAD5//n/AwAAAAAABgANAPn/+f/5//z/AwD8/wMACgAAAPz//P8JAAYA+f8GAPn/AAAAAPj/AAAMAAYA+f8AAAYABgADAAMA/P/1/wIACQD1//z/9f/5/wAAAAAAAPL/+f8AAAAAAAD8//z//P8DAAMACgANAPL/AgANAA0AAAD5/wYAAwD8//n/+f8NAPz/+f8AAPn/BgANAAIAAwD8/wIAAwD8//X//P/u/+v//P/1/wMA/P/8/wIA/P8JAAMA9f8CAAMACQAKAAYABgANAAUA/P8JAAIAAgD1//X/AgACAP3/7f/5/wAA+f/5//n//P8CAPz/AwAJAAAAAAAAAAYAAADy//z/AwAJAAAA+f8DAPz//P8DAAkABgAGAAYAAAAGAAAAAAAAAAAABgD8//z/AwADAPz//P8DAPX/9f/5//n/+f8AAPX/9f/8/wIAAwADAPz//P8DAAkAAwAKAAYABgAAAAYADQD8/wMA/P/2//z/CQD1//L/+f/y//z/AgD9/wMA/P8JAAMAAwAGAAAAAAAAAAAABgAGAPn/8v/5//z/AgADAPz/CgAAAPX//P8KAAkADQAGAAAA8v8GAAYAAAAGAPz/AAAAAAAA+f8AAPL/AAAGAPL//P/8/wkAAAAAAPX/9f8JAAMACQD8/wMACQAAAAYADQAGAAIA/P/8/wMA9f/8//n/8f/4//n//P/1/wkAAgD1//3//P/8/wIAAwADAAkACQANAAYADQD8/wIACQAKAPX/9f8DAPX/9f/y/wAA+f/y/wYABgDy/wAAAAAAAAAAAAAGAAAAAAAGAAAA+f/5/wYADQAGAPz/+f/5/wAAAAAAAAAAAAAAAPn/AAD5/wYABgAAAAYAAAD5//n/AAAGAPL/9f8DAAIA/P/1/wIAEAACAPb/CgACAAIAAwAGAAwAAAAGAAoA9v/1/wAABgADAPX/AAADAAMA9f/5//n/+f/5/wAAAAD5/wMAAAD1//z/CQACAAMACgAGAAYABgAJAAMA9f/y//n/AAAGAAYAAAD5/wAAAAAGAPn/BgAAAPL/BgAGAAYAAwD1/wAAAAD5//n/AAAGAPn/6//8//z//P8CAPX/AAAGAAoACgAJAA0ABgAGAAAABgACAAMA/f/9//3/AwD8//b//P/y//n/BgD5//n/+f/1//z//P/1/wAABgAJAAMAAgADAAoACgAAAAAAAAAGAPn/AAD5/wYAAADy/wAABgAUAAoA/P8DAAIAAwD8//X//P/8/+7/8v8AAPn/8v/8/wMA/P8DAPz//P/8//z/CQAJAAIA9f8CABAADQAUAPz//P8KAAMA/P/8//z//P/9//3/7v/5//j/8v/9//3/AwACAAkADADx//z/DQAAAAAAAAAAAPn/AAAAAPn/AAAGAAYA8v/1/wkAAAAAAAAAAAAGAAAAAAAGAA0A/P/y/wAAAADy/wYABgAAAAYACQADAPX//P8DAO7/8v8AAPn/+f/8/wIACgD8//z/CQAGAPn/BgAGAPn/AAAGAPn/8v8CAPz/AwAKAPn//P/8//z/AwAQAPz/9f8DAAIAAgAUAAYAAAAAAAAABgDy//n/AAD5//n/BgAAAPn/AAAAAAYAAAANAAAA6/8AAA0AAADy//n/BgAAAPn/+f8GAAYAAAANAAMA/P/8//z/AgD1/+v/BgANAPn/AAAGAPL/+f8AAPn/BgANAAAA8v/5/w0AAAAAAAYA+f8AAAAABgAAAPn/AAAAAAAAAAAAAAYABgAAAAAAAAAFAAMA/f/y/wAA+P/r/wIAAgD9//b/CQAKAAMAAwAGAAYAAAAGAA0A/P/8//z/AwADAPX//P8DAPz//P/8//n/8v/5//n//P/8/wMAAwADAAkABgAAAPn//P8GAAAA+f8CAAYAAAAAAAYAAAD5//n/AAD5//z/CgAGAAAAAAAAAAAAAAAGAAAABgAGAPn/AAAAAPn/+f8AAAAA+f8AAAYA8f8AAAYAAADy//3/AwACAA0ADAD5/wAAFAAKAPX//P8JAPX//P/8/wMAAgDu//z//P8AAPL/8v8GAAAA+f/8/wMAAwAGAAAA+f8GAA0ABgAAAAAABgAKAPz/7v/5/wYABgD8/wAA6/8AAA0AAAAGAAYA+f8GAAkA/P/8//z//P/8//L/+f8AAPn/AAD5//z/CQADAPX/CQAKAAYAAADy/wIADAD4/wAAAAAAAAYAAAAAAAAAAAAAAPn/AAAGAPn/AAAAAAYA+f/5/wAABgAAAAAAAADy/wYAAADy/wYAAAAAAAAAAAAAAAYABgAAAAAA+f8AAAAABgANAPL/6/8GAAAA+f8AAAAABgD5/wAAAAAAAAYA+f8AAPn/9f8DAAIA9f8DAAkACQANAPn/AAAAAAAA+f8AAAAABgAGAAAA+f/x//n/BgAGAPn/+P8AAAAA+f8GAPn/AAAGAPL//P8KAAYAAAAAAAYABgD5/wYAAAAGAAMA6/8GAA0A8v/y/wAABgAAAAAA+f8AAAYABgAAAAAAAAD5/wAA+f8GAPn/AAD5/wAABgD5/wYAAAD5/wAAAAAGAAAABgAAAAAAAAAAAAYAAAD5/wAAAAAGAPn/+f8AAAAA6//8/wIACQADAP3/AgD8//3//f/9/wMAAwAJABAA+P8AAAYAAAAGAAYABgD5//L/AAAAAAAA+f8AAAAAAAD5/wYAAAAGAAAA+f/5/wYA+f/y/wkAAAAAAPn/AAAAAAYAAAAAAPn/BgAAAPL/AAAGAAAABgANAPz/+f8AAAYAAwDy/wYAAwDy/wAABgDy//n/AAAAAAAAAAD5/wAAAAAAAAAABgAAAPn/BgAGAPn/AAAAAAYAAAAAAAwA/P/5/wAAAAAAAAAA8v8GAPn/7v/8/wMAAwACAAoABgAGAAAA+f/5/wYABgANAAAA+f/y//n/DQD5//n/BgAAAAAABgAAAAAAAAAAAAAA+f8AAAAA+f8AAPn//P8KAAYA+f/1//z/AwAJAAYABgAAAAAAAAAGAAAAAAAAAAYA+f8AAAYAAAAGAPn/AAAAAPj/AAAAAAYA+f8AAPH//f8DAAIABgAAAPn//P8DAAMA/P8DAAkA/P/8/xEAAAAAAAYABgAGAAMAAwD8//z/AwD8//z//P/1//n/+f/r//X/CQADAPz//P8CAAIA/P8JAAMA9f8CABAAAwAAAAYABgAAAAYABgACAPX/AAACAAkAAgDu//z//P/8//L/+f/5//n/AAD8//z/AwAJAAMABgDy//3/AgAKAAMA/f/9/wMAEAAAAPn/BgAAAAYADQD5/wYAAwD1//n/AAAGAAAA+f8AAPn/AAAAAPn/+f/1/wMAAwADAAIA/P8JAAMAAAAAAO7/CgAKAPz/CgD5/wMABgD5//n/BgAGAAAADQAAAAAAAwD8//z/+f8AAAAA+f/5//n/AAAGAAAA+f8AAPn//P8KAAYAAAAAAAAAAAD5/wAA+P/9/wUAAAAMAAYA+f8GAAYA/P/5//j/AAAAAAAABgDy/wYA+f/5/wAAAAD5//z/DQAGAAAAAAAAAAYABgD5//n/BgAGAPn/BgAAAAAABgD8/wAAAwD8//z//P8DAPX/+f8AAPn/8v/8/wMA/P/8/wMACgADAPz/CQACAAAABgAGAAAABgAGAPn/BgAAAAAAAwD5//n/BgAAAPn/AAAGAPj/+f/4//n//f/1/wIA/f8KAAkA/f8KAAYAAAAAAPn/BgAGAAAA+f8NAAYA+f8GAAIA/P/1/wAA8v8NAAYA8v/5/wYADQD8//L/+f/5//X//P8DAAMACQD8//X/CQAQAAAA+f8NAAYAAAAGAAAA+f8AAAYABgADAPz/9f8AAAMA/P/5/wAA+f/5//n/+f/8/woABgD5//z//P8CAAIACQAGAAAABQAAAPj/AAAGAAAAAAAAAAAADAD5/wAABgAAAAAAAgD8/wMA9f/y//n/AAAGAAYABgD5//L/+f8AAAAA/P8DAA0AAAAAAPn/AAAGAAAAAAAAAAAA+f/5/wYAAAAAAAYAAAD5/wAABgAGAAAA+f/5/wYA+P8AAPj/8f8AAPj/AAD5//n/+/8NAAUA+f/y//n/BgAAAPH/+f/7/wUA+P/x//D/DAD4/wAA8f/w/wYABQAAAAAAAAD4/wYABgD8/wAAAADy//n/AAAAAAYAAAAAAAAA8v/8/wIADQD5//n/BgAAAAYA8v8AAAYABgAGAAAAAAAGAPn/8v/5/wAA/v/5//H/+//4//j/+P/+//H/5v/6/wkA+P/+//j/+P/4//j//v/4//H/BQD6/+3/+P/4//7/8f8AAPn/+f8AAAAA+f/4//z//f8CAAIACQD8//z/AgAQAAAA8f/+//j/+P/4//j/BQD+//T/8f/+//v/7f/4//v/9P/x//7/+v/t//H/8f8AAPn/8v8CAAIAAwAGAAAAAAAAAPn/AAAGAAYABgD5/wAAAAAGAAAABgAAAPn/AAAGAAAA+f/5//n/BgAGAAAA8v/5/wAAAAAGAAAA+f/1//z/AwAJAAMABgAAAAAADAAAAPj/AAAMAAkA9f/4/wAAAAAJAPz/8v8AAAAA+f/5//n/AAD8//z/AwADAAMACgAAAPn//P8CAAoAAAAAAAAABgAAAPn/BgANAAAA+f/y/wYAAAD5/wAAAAAAAAAAAAAAAPn/+f8AAAYAAAD5//n/AwAGAAAABgD5//n/BgAAAAYAAAD5/wAA+f/5/wYAAAAAAAAA+f8AAPn/AAANAAAAAAAAAAAABgAAAPn/AAAAAPj/BgDy//n/BgAGAAAABgD5//L/AAD8/wYABgAGAAYA+f8AAAYAAAAAAAAABgAAAAAAAwD8//H/8f8FAPT/8f/4//H/AAD4//H/AAAAAAYA+f8AAAAA+f8AAA0A+f/5/wYAAAAGAAYABgD5/wYAAgADAPX/+f8KAAMA/P/1//n/BgD5//L/AAD5//3/AgD6//v/9f/1//3/CwALAAkADQAGAOn/8f/9//7/+P/4//7/BgDx/wYA9P/5//j//v8BAO3/8f/x//H/+P/4//7/+P/q/+3/+//7//r/+//8/wMAFAAGAPH/AAD+//7/8f/4//H/DQAGAOH/8P/w//H/8f/+/wYAAAD5/wAA+f8AAAYAAAAGAAEAAAAGAAEACAAIAAgAAAAAAAAAAAAGAPn/AAAGAPj/8v/+/wwA8f/x//7/+P/+//H/8f/+//H/8f/+//7//v/4//H//v/4//j/+P/x//j/+P/4//j/+P/4//j/+P/4//7/+P/+//j/+P8AAAAA+f8AAAAA+f/5//n//P/8/wIAAwADAAMACgAAAPz/AwAGAAAAAAAAAAYA+f/5/wAAAAAAAAYAAAD4//7/8P/5//n/6f/2//b/+P8VAPT/8f8GAPH/+f8AAAAAAAAVAAgAAQABAAgADgAIAAAAAAAGAPn/AAD+/+r/+P/+//j/8f/4//7/+P8GAP7/8f/4//7//v/0//H/6v/4//D/6f/w//7/+P/4//j/8f/4//7/+P8AAAYA+f/5/wAA+f8GAAAAAAAAAAAAAAAGAAAA+f8GAAAA+f8GAAYA+f8AAAAAAQD5//X/9f8CAAoACQD8/woADAAAAPL/BgAMAAAA+f8AAPj/8f/4//7/AADx//H//v8AAP7/BgD5/+r/8f/4//7/8f/4//7/+P/4//j/AAAGAPn/AAAAAAAA8v/8/wkAAAAAAAAAAAAGAAYAAAAAAPn/BgANAAMA9f/8//z/AAAIAOr/+f/x//j/BgDy/wMAAwAEAAQABAARAPv/AwAJAAYADQAAAAYA+//1//X/9P/s/+n/8P/8//D/2v/9//j/+P/p//H/DQD4//j/EAAIAPj/CADp//j/+P/p//D/6P/p//T/+f/w//D/+P/4//7//v/5/wAADQAIAAgADgAEAAEAAQAOAAEAAQAGAAAAAAABAPn/AAD5/wMADQD4//L/+P/+//n/AAAAAPn/BgD5/wAAFQAAAAAAAAANAAMA9P/8//T/9P/0//H/+P/4//D/6f/w//X//f8BAPT/9P8BAPX/9P8CAAkAAwD8/wsACQAAAAEACgAIAAgABgD4/w0A+f/4/wUA8f/w//D/8P/o//D/8P/p//D//v/4/+r/6v/8/wIA/P8DAAQAMgAxABwANAA4ACgAQQBNADAAMAAtABAA+f/I/93/lf+Q/5j/ev94/4j/if+m/7j/2f/4/xkAZAB0AKIA5QDWANgA2QB9AG4ALgDu/4H/Af/h/sX+fv5w/nj+eP6e/tH+EP9A/47/5v9bALQAFQGpASkCuALmAggDOQMxA/gCngIZAnAB2ADx/xD/PP5b/bP8FPx8+zv7K/sb+yH7cPvo+378Tf2Z/tL/JgGeAhAEWAUwBukGeAdmBwYHUAZYBf4DmwL2AED/9v26/OD7IPvR+sH62PoA+1D7zvsI/Hj8//xO/YX90P0h/mH+4P7G/70AlgGmAtADxwRoBecFQQYnBsIFQwV0BGMDUAIQAaP/m/7S/Rr9pvx1/Hr8ovzI/B/9d/2p/fH9SP5g/lH+Bf6+/Yb9XP2U/TX+Ff/9//4AKAJAAxMEuARJBYoFawU0BckEAgQPA/QBnACO/8j+Ev5q/ev8tPyN/Hz8pvzV/AL9SP2B/Yj9fP1D/eX83fwW/cb9qv7F/wIBIAJkA4YEBQW+BRAGKAbyBW0FyASIA18CAQHc/+f+5/0g/W38BvzF+4L7k/vA+/L7P/yV/Nf88Pzr/L385vxI/dX9v/7o/wYBYAJsA30EnAUgBogGzwa3BmkG1AUUBdkDkgIyAcP/ov6v/cT8FvyQ+3P7WvuP++P7T/zB/BX9fv2l/av9i/2k/dD9Fv6w/ov/eQCMAZkCeAOABEYFtQUXBkMG+AV9BbsEwgOVAlsBFQD4/h/+bP3J/DT88/vY+9z7A/xA/Kj8Bv1Z/ZH9of2W/Wb9ef2q/fr9jf5W/1MAcAFvAmYDaQQYBbAFEwYhBt8FawWwBJEDcQI2Ae7/7P4V/lj9n/w4/Pb7yvvE++n7J/xv/Lj89fwa/R799vzm/Bj9Q/2z/XH+aP+SAOQB3QI0BGEFMwaaBusG4AZpBq8FvwSHAz8C6wCq/6H+y/0U/WP8EvzV+7/71/sM/Fz8tvwY/TX9Tf1g/UT9QP0//Yn9//3H/qr/3QAYAhQDVQRGBQAGZQaiBnYG8QVABU8EPQP+AdIAtv/B/sv9B/18/A/8vfuz+8H73vsU/FT8ePyU/Lj8xfzP/PD8XP3i/Zr+cv+aAKEBpQLoA+oEmQUbBoUGiAYlBqsF7ATyA8sCkAFkAET/Uf6L/dn8U/wC/N376vsO/Ev8n/zn/BL9N/1N/U/9MP01/XP90v2D/kr/XgBoAX4CwAO4BIIFEQaEBoAGLQa1Be8E6wO6ApgBYABH/1T+bf2v/C/82fu0+7774Pso/IX8vfzt/Bz9Ov0q/Tj9d/3g/W3+Kf8WABYBNwJSAz0EHgXLBTQGVwYjBrIF9gQIBNYCjgFDADb/Rf5x/cb8KfzN+6f7rfvZ+xf8hfzq/Cv9Y/2G/Y39Yv1o/aj9/v2T/kn/CQAsAVACZgNYBEgFBQZQBmoGUwbEBQcF8QOJAk8BLQDu/gj+IP1i/O37gPtu+4L7s/sR/HP8wvww/Ur9Wf1A/Vv9pP35/YL+Jf/c//QAHgIMAwMEEAXoBUEGdwafBl0GwgXRBIoDRAInAZT/h/6c/b/8LvyF+0f7Vvtt+7X7Efxx/Ov8Qv1Z/XT9Xf1g/YL93/2G/hz/GgA/AVkCTQNcBGAF9gVHBocGhgY/BpEFhwQ4AyoCyABX/2v+a/2o/Pj7fPtS+1n7bPu4+xD8b/z7/E39cf2h/Zr9qv20/S/+0/5Z/1gAXgFIAi0DCQToBHsFtwXmBekFhgXuBOoDwAKzAYgASf94/rH9Gv2g/Ej8Jfw3/Ez8b/zB/Pr8T/2V/af9qv2X/Yj9lP34/aP+cP9bAJgBrQKsA40EfwUgBk4GZwYwBqAFvQSWA0gC8AC9/4z+bv3K/BL8sPtv+0z7efvH+y38pvwI/V79yP3b/b79pP2P/bj9Fv7k/tP//ABMAm8DVwQlBRwGgwZ2Bl0G/gVFBS0E5wJ6AQgA5f7M/bf8OPy++3D7avt0+8L7Jvys/Az9ef27/br9pf2S/Yz9w/2Y/l3/VACQAcYCrAOPBKEFOwZeBmgGNwaoBbIEjQMwAsQAnv92/l79vvxe/A388PsV/G78xfwq/Yr9yv27/X397/xd/NX77vuv/Mv9If/XAIwC5APXBMAFUQZOBhAGtgUnBUgEMwPtAaIArv/A/r79Lv3w/KD8jfzH/FL97v15/uH+9f6f/un9//zP+6T6Gfpe+mn7Qf1C/0EBIQN6BI0FPwagBmQG+AWNBbkEwAOwAnoBLwBR/5z+Av69/cX90P3x/SD+yv53/8H/7v9x/8r+tP2A/BP75fk0+Z75Lfu7/VYAcQKFBNUFtwbwBvIGTQZgBcUExgOpAo0BiABW/1r+zf11/WD9h/3Q/VD+rP5p/z8AVAAsAHP/f/44/QT8y/q/+TD5jflC+839CwGqAi4EwQSBBXgFbgXyBHcEKARmA3ACoQHJALn/4f5t/in+CP4g/l7+0v4X/7T/aABpAFUAcf/A/p79u/xq+0n6gflj+Q37wv0RAaYC6gNsBBQFHQUEBbcEiAQrBHUDaQKHAa0AmP+9/kj+Fv7i/Rn+Rf6w/if/pf9OAEgAGgA6/3L+n/2b/NX7z/pX+uH5HPuT/dIAwQLGA0gEfwS4BJgEbQQ8BBgEaANNAhcBngByAMj/U//S/qL+iP6a/qX+Jv+I/xcAQgDG/wr/Gf6E/a38CPz/+jP6svne+Uv8BQB0A9gE7ATqBLsE8ASMBIUEggQmBOMCGgFJACkA6f8x/5X+8P3f/VX+l/5P/x8AUACRANP/Z/86/o/94vxb/Kn7lfqj+RP5YPrI/f8BogTYBFME2QMXBIUEpgS0BGcETQOHAUoA+v9YAAAAhf+i/gr+If6d/iH/IwCqANsAPwCW/+v+ZP4K/n/94PzY+7D6p/m4+d77of9cA38EDQRGAxwDnwP+Ax0EPwTvA6cCEgExAEgAnQAvAE7/g/4r/rr+Uv8eAOsAVAHPAKL/sf4R/tT9mP0r/YD8bftG+lb52vlg/GYAoQNABHIDwgJXA0YE1gSdBGgEmwNLAqkA//8MAF8A7//r/uD9uv2a/nb/FwDDAAwBjwB4/4r+LP4//kX+zv0I/ff72Pr++Yn6DP3aAKIDygO9AiUCEAOBBOEEHASjAx4DXgLNAMj/xf8dABIAIf/3/cr9Vv4y/87/lQAUAbAAov+Q/ib+YP6D/tb9wfzF++76PvqQ+uT8kgDvA0wE2wIhAiEDOgW1BXUETwPKAkgC9wCn/5T/CgA0AHf/MP7x/Xr+TP/f/3wA3wBwAHj/ev47/oH+rf7l/ZX8m/vj+lH68fob/d0A+AMrBN0C9wHkAsYEWgVtBGMDpgITAuUA8P/U/xQALgAq/7z9SP3B/RH/IwC/AMEA4////lv+YP6t/nP+cP1G/BP7APoA+o376f7VApME2AN3AlIC+wN4BU0FKwQMA2sCCAIHAWUABAAVAIP/1/3E/CD9Zv4mAPEA+gByAIT//f62/uH+9f5g/jn96vuZ+tj5P/pM/KD/BQMPBDQDQQK/AoQEwAVnBTYE6AJmAukBEAFvAOH/if+8/mD94/x7/ar+1/9AAEUA8P93/y7/AP8G/8P+I/4l/ej7B/ug+t/6Z/xb/7ICSwRsAxgCFALtA5cFpgVUBNUCRQItAoQBRAA6/7H+yP4h/r397v2d/ov/IABOAAMApf9n/0b/MP/I/iz+Uv1G/Gj7uvqn+rT7S/4RAksE4gNlAgYC0APUBfsFWgRgArYB9AF4AWkAB/+A/sr+mP4E/rj9XP56/5gA6ABlALz/bf9t/2X/+v4t/pn9vfz++xr7pPoa+wD9UgCHA4EExwOxAt4CiwSvBVEFgAPZAVcBKQGGAIf/eP5O/mD+KP7Y/Qb+2v4GAO4A8ABhALr/df+Q/4b/3P7z/QD9HPyP+z37Hfv0+2j+vAH+AzwEEwNnAlYD/ASbBYIEcQJHAS8BDgFvAED/Zf5Y/jb+B/7g/U7+l//kAH0B4QALAIX/r//P/0n/IP75/Av8gfs0+9D6Fvu2/M//EgPTBIAEUgMiA18ElgVaBcwD2QESAeoA6gBXADD/a/4J/rL9ov3s/cv+8P/mACABhADD/2X/a/97//3+Ff7+/AX8ffs4+wj7Vfv5/OH/1wK9BF8E8AKdAjUEsQWvBfIDzAEFARIBPQHMAIT/nf4m/s79yP0F/tb+/P8VAVoBsQDQ/yP/Av8b/6n+qf2R/NT7ePsK+3f6bPoc/N3/sAOnBfgEXwNjA0oFPwaZBXcDlAEtAWIBJgEYAMf+IP4c/ur9Bv5a/kj/gQAaAd4ANADT/8j/qv9j/6j+wv36/Hn8HPxe+8D6a/qm+9f+6AFNBHEEaQPDAhIEpQWzBZYEewJXAQ8B4gAyAP/+BP7B/ab9pf00/gP/RgApASQB0wBcAC0AEADt/zX/Jv43/Y38Vfzh+0/7yfoP+1H9kQCvA/AEZASBA4wD6ATbBf4EWAOgAfEA7gBqAHT/O/6E/dH96/0Q/ov+Xf+tADYB9QBVAAgAFwAOAOL/8v7c/Yr8C/z9++X7Yfu1+gD7Rf0pAWoEpgXIBL8D4wMnBdgF7wQxA6UB9ACdAN7/7f4y/vv9df52/hb+Of76/pkAUAE9AWoAkf9s/4T/hv/N/rr9bfz2+x/8R/wG/HD7mPuU/esAKwSBBcwE2gO/A9MEcAW3BBcDjwHOAF4Ar//d/kv+R/6s/rv+QP5H/vL+cwBNAUgByAALANz/0v+//8j+uf1+/Bj8AvzX+2z7IPuA+2H9NgA1A9ME4wSpAxkDUwNuBKgE0QNXAkQB6QCYAOP/Gv+S/q7+C/+V/3D/df+k/4sANgEMAZkAyv9c/yD/8P49/l39avz6+/H7wft2+0D7tvvX/egAjgNhBUIF5wNOA54D0wSFBFEDdAGbAGkANwCx/9T+c/6I/r7+/v7G/lP/CwBSAQwBZACk/zj/UP9F/wf/J/6A/ef86PzL/Fz8+/vD+5T8aP43AXEC8wMGBTAFLwR9A2gD4gOWA20CfAA2/zP/eP+x/zf/+v61/uv+PP9z/z4AIAGEAfcAIgDA/1D/Sf8M/3b+q/2V/Oz7n/sQ/Cj8Lvyy+3v8xf5rAbUE+wVXBToEAQTQBD4FqwROA5MBAAF+ABgAQf+H/j7+JP5O/jf+2v4FABcBJgFxALb/c/93/yj/eP6G/UX9aPwU/Mb7B/xl/Jr8hfzC/cj+NgGgA7wFxQaeBXEEzwMpBBsEIwPgAZMAJgAnAKn/9/4d/hr+QP5h/kD+cP6G/7kARQGuANr/hf/G/5v/aP4j/ZD8mPz4/KP8ePzo+xP8uvww/qX+DQC1AnoFtAZBBTADyALWA4cEcgPjAaoAhAAHAYwAeP98/oP+/f6G/2P/aP8gADsBqwFtASkAlf9E/yD/8v0h/Wf8O/wl/P37/Psc/Hb8Df2K/ez9fP+4AqcFkwbUBOgC1AL/A5kEfQPaAbsAaACaAEcAg/9h/3X/fP+D/zv/hv9xADgBdQEMAQMAdP8r/7H+FP5K/bD8KPzt+/X7Q/x+/Hv8kfxl/bv+0P9KARYD5wTEBQUF1QNWA5sDqwPmAsQB9gBTADoA6P9m/03/SP8f/wn/8/4w/zwADQFgAaQArv8b/w3/p/4Z/j39wPxz/HL8mPz2/Bn9IP1d/SL+KP/z/9ABTAPFBM8EAgRrA4ADvwM3AwwC+ACCAFcAVQC1/3L/b/9w/03/Hf8S/7L/pQAfAeIAFQA3/0f//f6E/mr9CP3R/MP8tvy1/F39rv3X/c79Nf4z/9T/PAHHAp8EbwWNBJADJQOOA2gDaAIRAckAuACCAMP/WP+5/9n/kP8d//z+fP9gAAEB/ADTAPH/cf++/mz+zv2L/Rv94vz4/Bv9nv2r/aj9rv0B/oD+5f4BAJ0BgAOBBOsDDwPRAhQDCgMxAigB9wApAfYAUADT/zUATwDs/2n/Ov+A/0UAngC/AJwAUwCA/y3/0v46/pH9Av27/MP87vwZ/Wz9gP0p/ZT9Cf7F/lT/UQC6AfwDdAToAwADQAN2AwoD+AFHAXYBWAHwACwAJgBfACgABACP/6z/cv8eANf/NgAiAJ3/p/5X/nX+yv1V/fD8Of1Q/Z/9cf3G/dL9k/32/Yf+u/4i/8v/UQFGAwcEhQNCAxwDBQM8AvQB4wHlAXAB9gC6AH0AngBDAEkAOAAdAM7/GwBcAHwA3gAxANX/9/7a/ur9Vf0a/TH9Tf0X/YH9iP0T/oj9GP7b/iv/G/+y/9cAUQKhA7oDnANtA/wCQgLDAdQBtgFgAeMAtwBwAGcAUwARABsAlP+b/4H/PgAjALUANgALAHv/CP+N/p/9Wf2m/Db9XP0C/pL9S/24/ZP9eP7J/ib/Pv8YABgBrgKeA5MDbgMaA7AC9gHIAcABlgF9AUQBHgHDAIAACADu/5//Nv8s/5T/CAA3AGoA6v/X/zP/4/43/q79H/3X/A79af3W/XX9O/1w/aD9SP5q/jX+/f65AAoCKAOJAxsEsANQA98C4AK5Al4CZAIhAlcBIQGzAOMAYABHALv/sv/D/6//1//S/wkAtP+W/wT/nP76/Wz9F/0Y/V79Af29/OX84PxC/b79+/1t/mD+bv7S/98AVgJNAwIERQTPA5QD1ALFAl0CQQJLAqgBowH1ANcAjQBoABEAk/+9/5v/pv8GADkAYADI/5v/7f5i/lH9B/2p/Lj8Bv3X/B39+/xf/dn99f0k/oz+fP74/jcAmgF+AlQD6gM1BNIDSgPYApECAgL9AcABcQEnAbAApgBFABMAn/9//5D/Z//A/9D/CwCy/3b/If96/tT9X/03/eP8B/1M/Tv9vf1i/T/+W/50/rb++v4f/6j/RAH7AfoCfgM5BBcEmAN0AxcDwgI5AksCuQFxAVMBAwHhAGYABAC7/3D/WP9D/47/hP+Z/1j/A/+e/mb+1v0W/f78pvy+/LH86/zX/Cr9zv0x/s395v5//pL+gf8CAYUBngIYBPUDLATuA/UDNwP3AtcCmwIPAvcBgwHYALsAHwBt/9/+3v64/sX+Lf9t/5P/sP+P/3L/6/6b/tP9RP0J/dD83vxM/bn98v1M/ij/q/7O/mP/eP4A/0gA/ADbAZwD8QPTAzcEmwMIA8ECdALKAcYBpgFOAQUBswByANj/sv8V/wj/L/8v/37/1P/6/67/5v9T/8X+U/6l/d38pfwQ/YD8Pf2o/cf9A/72/s7+sP6q//3+Vf+PACYB8AFwA8kD+gNKBMwDGAMbA2ACsAGcAWcB/gC8AIwAKQC6/3//Nf8Q/xT/J/87/3H/f/9E/2L/A/+W/ij+rP39/OD8KP29/Ar9nP3A/Qj+cv6I/qz+Qf8e/+r/0ABgAXMCXwOsAxEETwS1A2oDVgNzAgYC7QF0AfwAzwBIANT/b/8W/9H+7v7u/hf/wP+t/7//EADI/1P/HP+e/qf9SP1E/ez8u/xC/YP9k/0k/m/+cP70/kT/PP8oAOQAOwFiAhMDYAMYBBMEnQObA5MDkgJTAnYCnAFbATgBcwC2/5z/8/5I/uX+c/5l/lb/I/8Z/6T/if/v/iH/0/6c/XX9U/2t/MX88fzO/BT9Ff78/R3+Lv/p/uz+DQByAJwADgK1AtgCDgQUBIEDAATCA6gCowK5AqkBmwGoAbYAKgBKAHP/y/43/6j+Zv43/03/5P6w/6z/Ff9M/xj/H/4U/vr9P/2J/bD9O/2F/fb9MP5B/uH++P76/or/CwBZAO0A3gFNAukCpQN4A4YDsANYA7IC0wKfArIBugFUAZMAUAAQAAz/9/7I/j3+s/4d/5v+X/+B/wr/Sf8o/3D+B/7u/Tn9Pf04/eH8Pv1o/ab9DP5N/nf+0f41/8L/agDoAM0BgwIoA+QDRgRNBIAEdgTxA+wDpAPEAlgCsgEpAYUAEABW/+r+iP5C/iT+eP54/r3+Af/1/hP/8P6m/jr+6P03/WX93vwA/V39Uv3R/Tj+Tv6V/iz/Q/+4/2IALgD4ABgBnQFwAtcCegPRA7AD7gPAAyoDGAOsAtYBtQElAWoAMgCL/9/+i/49/gb+BP5Q/hn+g/6l/n7+uP60/hT+8/3W/RP9UP01/Qb9gP36/eb9Yv7T/v/+X//4/yEANAD3AAIBqwGOAtUCrQPMA8UDCATQA2QDNwPPAhQC5wFKAZwAbADK/y7/1f6T/lD+oP5h/oX+xv6//u7+EP/y/oD+f/7//cT9tv1//Yb93v0l/vX9nf6m/uH+af+p/+D/ZADMADcB0gGaAt0CkwO7A7AD7wOmA0kDDQOQAuUBogEDAWUAIgBC//7+xf5i/pD+xP49/tD+if5w/sT+oP56/jr+Fv6g/bj9hf1f/Y795P3p/Tv+jP6o/hD/YP+i/xAAaAC8AEoBzgFbAgUDawO7AwAELQTFA7YDZwO7AmYC+QFhAekAWQDR//z+wf5Q/uX9Pf4f/vz9Yv5H/hD+gP5P/in+Gf7R/Y79oP2N/Xz9uv3v/db9hv7D/uD+k//R/+L/gQC3AAYBowEfAosCFgPBA68DSwQ1BOYDuwNUA68CDgLQAewARgAKABP/pv6X/vL9AP5B/vD9//2Q/ib+af6W/k3+LP4t/un9gf3E/Wv9aP0J/qz9J/6p/qT+B/+u/5f/8f+BAJsAGgEJAkIC/AKDA7wD+ANEBPgDlQOdA+wCYAIjAmEBnQBJAJj/u/69/hv+FP5P/jP+EP55/pb+rP72/v/+7f7C/qf+CP7z/cn9Uv27/d39/f00/of+uP7x/oH/xP/4/60A/wCNAR8CwgIBA2AD4QPXA80DoANpA/oCoQIuAnMB8QCAAND/UP/R/kr+I/4V/u393P3u/QD+Lv5L/lv+fv5+/nj+k/5e/lD+LP4G/gn++f0t/nv+q/79/jP/mP/Y/yAAegDAACsBhgH1AVgC2QIOA2kD6gP0A+sDyAOXAyMDsAINAlIBnQAIAFj/wP6N/hz+xv2c/Wv9bv1P/Wz9hf2a/az91/3X/Qz+If4v/nH+df6x/gL/QP9e/5j/2P/v//D/FwBSAJoAwgAzAbMBNQKdAhoDswPqAxkEAATgA6EDRgOpAuUBHAFfALj/7v5X/uz9if03/eT8yvzG/Nz8Dv1C/XH9vv0A/hP+Uf5s/oj+xv7u/jv/aP+j/7f/4P8EABwAJwBQAJAAxAD5ADQBrgElApwCKQOXA/ADEwQQBPcDtQNPA8gCJwJyAbUA3f8a/37+BP59/R/96/zL/Mr82PwF/Sf9Yf2f/bP97P0Q/kD+cP6w/gv/PP+I/7v/9/8cAEoAcQCUANEACwFEAXQBzAFIAqACDANyA6cDzQO5A5cDNQPIAkACoAEKAUYAc/+//i7+q/01/cn8mPyX/Kb8z/wJ/Uj9ff26/ej9L/5R/p7+w/75/i//Zv+R/7j/yv/m/wMAGgBmAKcA7wAwAYgBCwKsAiYDjgPiAx0EHgQNBLIDRwPHAhgCbQGwAPb/H/9+/u39eP0O/dL8yPzR/Nn8BP01/Vz9nf3N/fv9Kf5x/q3++f4y/2X/qf/e//b/IQBIAHQAqwDVAAUBQAGKAewBYQLYAj4DdAOpA7oDnANZAwMDgwLpAWMBpQDl/zT/mP78/YX9Pv31/NH86Pwb/Tj9Xv2U/dT9DP4//nX+pf70/if/XP+p/7j/2v/8//P/+P8MABYAWACbAM4AFwGIAQACXwL/AmYDyAPwAwsE/wOcAy0DigL8AQ8BNQBe/5f+7/1d/er8ofxv/H/8ovzG/On8Mf2B/dL9If5o/qT+5/4f/17/n/+6/97/6P/j/93/zv/m/xoAUACjAAIBhQEgAp0CCgNAA4oDzAPtA7cDcAPuAk0CqAEIATQAZf+5/kP+uf1f/R79BP0C/Sz9bv2C/a/92f0U/lD+ef6v/tD+/P4W/0P/jf+g/8n/4f/H//D/BgBaAHwAwQAQAZgBKQKDAtgCIANqA7MDrwN0Ay0DugJDAqwBBQFZAJH/5f56/vr9lP1b/TX9If07/X79kP3A/fn9Nv5s/pP+qv6//vj+I/80/1T/kP+y/9r/+/8RAC8ATQB4AKoA8gBJAcgBTAKrAv8COwN3A7oDrgNjAw8DmAILAmYBpwDr/yH/j/4K/qf9YP0w/Rj9Ef0n/XL9uP3p/ST+if6//sD+x/73/h7/Gf8q/1j/af99/5b/h/+k/8z/6/8tAHEAwABAAcUBNgKTAvMCSwOaA6cDgANDA9wCcQLwAUcBlwDb/0L/yf42/sr9fP1Y/UP9Mv14/c39+f1D/pr+1v7g/uX+D/8E/9v+2f70/gL/8v73/v3+F/88/3r/0f8XAIgA/gCEAf0BWAKqAv8CTwN3A3ADSAMCA7wCUgLKATQBkAD//2r/9v5x/vr9xf2g/Wr9fP3B/e39IP51/rz+5f7m/hL/Ov8u/yP/Q/9X/07/U/9i/23/j/+j/7v/3/8nAGYAswAgAX0BygEQAlMCrgLsAg8DEAMEA9oCcQIUAoMB5QA0AI7/If+m/jP+3f26/av9j/25/QD+NP5g/pb+z/78/uj++/4M//P+4f7x/hP/CP8P/yX/Sf91/5v/yP8GAGoA2AA3AZoB3QEmAowC2ALoAt4CtAJ9AkkC6wGDAf8AnQAtAKn/W/8I/7j+kf5z/lj+eP6w/sX+4/4P/yX/I//8/v7+wv6V/nX+fP6Q/p3+t/7t/hn/Ov+G/8r/CwA4AIwA+wBIAYYBwAEBAigCTwJCAiEC+AG8AbABdgEyAdYAlwBgAP3/vv9i/yr/8/62/oP+Zv6J/nD+bv6V/qz+sP65/tf+0v7M/tn+Df9H/3j/pf/F/+L/EwBYAI0AlwDFAAsBQAFQAU8BaAFpAWABXAFgAUMBIAHyAOAAuwCOAEsAHwD8/8D/oP93/3X/aP9Q/zT/K/8N/+z+4f7f/sv+mf6g/sf+4/4P/y3/TP9g/4b/r/+5/9v/JgCUAOAAHgEjAUYBVgFRAWABLQFHAR4B9gDWANMAqQCLAIoAUwAvAPL/0P+s/4n/hv+G/4T/Yf9L/zf/LP8L//P+1P6h/oz+nP7K/v3+HP8x/1j/eP+L/5v/w/8MAGMAlwCuAMIA9gAIAQgBGQEAASABEAEGAQcBCQHHAIYAiwBYACMA/f8dACAACgAAAOf/wv+f/4D/pv+K/33/e/92/1f/QP9C/x7/C/8O/y3/SP9Y/2X/df+W/5z/rv/L/xQAdgCqAOsABAHoAPIA0wDLALEArwCZAKEAegA8ADIAAwDr/7j/xv/O/9P/0f/n/+j/8P/f/+3/8P/K/9L/r/+O/3j/bf9Y/zb/Qf9c/33/iv+8/9L/8v8AACgAUQBJAI4AnACoAKUApQCTAHgAYAA2ADsAIQAoACUAMAA+ADIAMQAIAPb/2//I/8r/zf/B/7j/r/+h/43/d/97/33/h/+h/6f/qv/L/+H/1v/R/9n/9v8CACMAUQB1AGIAWQBcAFIAMQAZABgACgAPACAANgBGAEwAPAAiABIA8//m/+H/6P/g/9j/0f/X/8P/qv+i/5//qf+1/7j/z//g//j/AgAQABMAJgAiACIAIQAUAA0ABQAEAAIACQAdACwALAA1ABkADQAOAA0ADQAMABoAGgALAAoA+v/n/9X/2f/O/9P/1//Z/+j/6P/q//b/+//t/+7/BQD0//T/9v/3//P/7P/9//f/8v/5//L//v8BAP//BQAFAPT/CgD4/w8AFwANAAwAAwD//wUAAAD7/wUABwAQABYAGwAPAAEAAwD5//H/8v/s//7/AgD4//T/6//f//D/6f/x/93/7P/8//3/5//x/wEA9P/Y/+f/+/8SABYAGAAYAB0AEAAOAAAA6v/e/+f/+////wEADgD7/wUACQAAAAAABAAIAPb/+//5/wYAFgAGAOn/8//1/+z/8v/s//D/+P/w//f//f/z//T/9//x//H/9P8DAAQACwADAAgACgAMAP//+f/1//7/AgD3/wAAAwADAOv/AgAMAAMA+P/4/xAA/P/y//X/8P/x//D/6//x//z//f/2/+P/9f/5//j/9f8HAPz/5f/x//v//v/4//T/BwAAAPr////6//3/8f8DAAkACwAXABsAEQAQAAoAAwDv//D/BAD///L/6//u//r/+P8AAPn/+P/2/wMAAgAEAP7/+P/+//f/+f/t//X/8f/0//L/AgD9//n//v/q//P/AAABAAQAAgD9//7/AgACAAkABQADAPb/9v8AAPv/9f/5//r/9P/z/wAA+P/7//j/9f/3//3/9v/1//v/AQD4//X/9v/8////BAACAAAA/f/w//n//v/+/wcADAD1//z/AAAFAPv/AAAEAAgAAAD///7//v8DAP7/+/8AAOz/8v8BAP3/AAAFAAUA//8IAAAA+/8BAPz//f8CAPz///8AAP7/AwD7/wgAAgD1//f/+f/8////+f/4//r/+v/w//n/+f/4//b/+f////X/7/8BAAEA/f8NAAEA+P/6//z//v/1//j/+P/5//T/+P/0//b/+v/1//v/+f/0//T/8v/4//b/9P/9/wIA/v8CAAEA9P8BAAIA+//+/wAAAwAAAAMA/f8BAAEA/f8FAP7//f8AAAMAAAD3//r//P8DAAAAAAAAAPr/AwAAAA0ACAD9/wIA/P/2/wYABAD2//7/+P8BAAMA9v/+/wIAAAD9//3/AAAKAAUAAAD+/wkAAQAAAAAAAQACAPj/+P8AAP7//f/+/wQAAwD6/wIAAQACAPz/CgAEAAMAAAD7//T/+v8HAAAA+P/w//r/AAADAAAA9//8/woAAAD2/wUACgAFAAMA/f/9/wMABwAFAPb/AAAHAP//9v/4//3///8DAAAA/f/6//T/AgAEAP7/CAACAPv/AAAIAAAA/v8FAAIA+v8DAAMA+//4//r//P/8//3/+P8CAAgA/P/9/wIABwD6/wEAAQAAAP///f8GAAAABQD///j//P8DAAYABAAEAP///v8DAAIAAgD3//v/AgD5//r////9/wAA/P/9/wgAAQD//wAA//8IAAgA+//5////AwD+//z//f/0//v/AAAEAP//BAAIAPn/+/8EABAABAD3/wEA/f8AAAYA///8//f//P8BAPb//f8JAP//AwABAPv/AAAKAAQA//8BAPz/AgD6//r/BAD4/wAAAwABAPj/+v8BAP//+f8AAAAAAQD7/wEA//8AAPX/9/8FAAQA/v/9//7/AQACAPz/BwABAAEADAAFAP3//v8AAPj/+//6//v////5/wMABwABAPb/+f8IAAIABwABAAAAAAD///3/+f8CAAQA/P/9////8//8/wAABAADAAQAAQD+/wAA+v8AAPn/AwAEAAAAAADy/wEACAD7/wMA/v///wYAAQD//wwACAD//wYA/f///wEA+f/8//f/BwADAPn///8BAP7/AAAFAPn//f8EAPv/CAD9//3/+P/8/wAA//8FAAAA+P/4/wYACQAGAPz/AwAEAAEAAwD7//z/9f/////////5////CAD3//X/BQAFAPv/AwAFAAAAAwAHAPv///8EAPr/AwADAAMA9//x//7/BAD6//3/BwD//wEA+P8IAAAAAAAFAAEA//8AAPv/AQAAAPr/DQD6//r/AAD//wAA+f/6/wEA/f/2/wMACAD+//3//f////r/CAAIAAIA+/8EAPz/AgAIAAAA+f///wAA9/8AAPT/AwAJAP7/AAD8//3//v8CAAAAAAD//wYA/P/6//z///8GAPn//f/7//z/AgAAAAUABgADAAQA+/8CAAgA+v/5//7//P/6//n//f8EAPf/BgAHAPr//f/9/wgABQAAAAMABQD8//z/+f8CAAcA+//9/wcABAD0/wcA/v/+//3/AAD+//r/AAD4//7/AgDz/wAA/v/9//r/AwAFAP3/AAACAAkA+////wMABgD9//3/AAD8//3/AAACAAAAAwD8////AwAFAAEA+/8DAPP/+/8HAPv/AgD9//H/AAADAAYA//8EAAMAAgABAAAA/f8FAAIA/P8KAPn/+f8KAAAABAAAAPb//v/8/wIA9f///wIA+f/5/wAA+f/0/wAA9v/4/w0AAAD9////AQAJAAQACgATAAMAAAD8//z/AgD2//v/AgD9/+3/9v8IAP///v8BAP7//P8HAP3/AQAEAPz//v8CAP7/+v8AAAYA/v/+/wYA/P8CAAAAAwAFAPb/AAAJAPj/9v/9/wAA/f/9//f/BAABAPz/AgD6/wIA+/8AAAEABgABAPz//v/7/wYABADz/wsADgAAAAsACAD8//z/CAAIAPr/+P/4/+/////x//H/AgD9/wQABQAEAPz/BwACAAoAAAD8/wIAAAD3//b//f/7/wQABQD//wMAAAAJAAsAAAAJAAQAAgAAAPr/+//2//j/+//6//n/+P8EAAUA+P/6/wAA/f/+//7//P8HAAAAAgD7/wgABgD5//3/AgAMAAwACgADAAIABwAEAPn/9P/9//3/7//y//j/9//5/wEA///9/wgAAAABAPz/CwAIAPr///8CAP3/AAADAPf/BAARAAIA9v8AAAEAAwD1//n/CgD8////AAAHAAcAAAD5//j/AAAAAAAA+v///wQA+P/y/wsA+//w/wEAAAABAP3/AAAFAAIAAAAMAAoAAQADAAcACAAGAAEAAQAAAPf/8P/2//z/8f/4/wAA8//9/wIAAgACAAIAAgAMAAcA+v8AAAwABAD3/wgA/P/z//v/+v/4/wQABAAAAAAAAAAHAAAA//8MAAIA/P/9//3//P/y//n/+f/5//z//P/8/wIACQD8//3/BAADAAIAAgAIAAwAAAAAAAYADQD8//z/CQD8//3/7v8AAAoA8P/5/wUAAwD///H/+f/5//b/9v/8/wIACQACAAMACgADAAYAAAAAAA0AAAAAAAAAAAAAAPL/AAAAAPj/BQAGAAAA+f8GAAYA+f/5/wcA+f8AAAUA//8AAPn/+v/5/wAAAAD8//z/AgAJAP3/AwD9/wkADAAAAPr/AAAGAAAAAAAGAAkAAwD9/wIACQD8//b//f/8//z/9f/4//P/8v/1//v/AgD1//n/BgAAAAYABgAGAAkAFgANAAcABwADAAkAAgD8//z//P/8//b/7P/5/wwA///y/wYAAAD5//n/+f8FAP//+P8DAP3//f/8/wIAAgACAAkA/P8DAA0AAAAAAAYAAAAAAAYAAAAGAAIAAgACAAMA9v/8/wIAAQD8/+//8//5//j/+P/1//X/AwD2/wAABgD//wwAAwD8/wgAFgD5//7/DQAMAAUAAgACAAMA9v/2//z//P/8//L/+f/5//n/AgACAPz//P8JAAYA9v/9/xAABQAAAAYAAAAAAPn/AAAAAPL//P8JAAAAAAAAAAYAAAD5/w0ABgD5/wAABQAJAPz/7//5/wAA///x////AADv//3/9v8AAAkAAgADAAoAAgAJAAYAAAD5/wYABgAGAAAAAAAJAPz//P/8//z/9f/5//n/AAAAAPn/AAAFAAAAAAD5//n/BgAAAPn/AAAGAAYAAAAGAPL/AAAGAPn/+f8AAAYABgD5/wAABgAAAPn/+f/5/wYAAAD4/wYABgAAAPn/AAANAAAA+f8GAPn/AAAGAPn/+f8AAPn/AAD//wUAAAD5//n/AAAGAAAAAAAMAA0A/P/9/wMAAgD8/wIA/P/1//b/+f/z//n/BQAAAPn//v/9/wMAAwACAAIAAgAMABMA+f/5/wYAAAD5/wAAAAAGAAYAAAD5/wYAAAD5/wAADQACAPz//f/5/wAABQACAPL/AAD5//n/+f8GAAYA+f8AAAAAAAAAAPL/AgACAAIABgDy/wMADQAGAAAA+f8AAAAA//8MAAAA6//5//z/AgAJAPn//P8KAPz/CQAAAPn/BgAAAAAA+P8GAAwABgD4/wAA+f/4/wAA+P8AAAYA+f8GAAYA8v/5//z/EwAGAPn/+f/5/wYAAAAGAAYA+f8AAAAAAAAAAAYA+f8AAAAA+f8AAAYAAADy//n/AgAAAAAAAAD5/wMAAwD8/wIACQAAAPn/AAAAAAYAAAAAAAYA+f/5/wAAAAAGAA0AAgDy//L/+f8GAAAABgAAAAAADQD5/wAABgAAAPj/AAAFAPL/+P8GAPn/AAAAAPn/BgAGAAAABgAGAAAAAwD8//z/AgACAPz//P/8//z/9f/5//n/AAAAAPL/BgAAAPn/AAD8/wkABgAGAAAA8v8GAA0AAAD5/wAABgAAAPn/AAAGAAAA8v/5/wYAAAD5/wAABgAAAAAABgAAAAYAAAD5/wAABgD5/wAAAAD5//n/9f8DAAIAAgAJAAYABgD4/wAAAAAAAAYA+f8AAPn/+f8FAA0ABgD5/wYAAAAAAAkA/P/8//z/CQD8/+7/+f/y//n/9f/1/wMAAgD1/wMACQAJAAMA/P8KAAYABgAGAPn/AAAGAAYAAAD5//n/DQAAAPL/+f8GAAYAAAAAAPn/+f8GAPn/AAAAAAAABgDy//n/BgAAAPL//P8DAAMA/P8CABAABgD5/wAADQAUAAkABgANAPL/8v8AAO7/7v/1/+v/9v8CAP3//P8DAPz/CgAJAPz/CQAGAA0ABgDy//L//P8CAPz/AwADAAkADQANAAMA/P8DAPX/AwAJAPX/9f/1//n/8v/u/wkAAgD8/wMA/P/8/wMA/P/8/wMA9f8GAAkAAwADAAMAFwAUAAkACgD8//z/AgDu//z/9f/5//n/8v8AAAYAAAAGAAYAAAD5/wAADQACAPX/+P/y//n//f/1/wkAEAAAAPn/DQANAPn/8v8AAA0ADQD1//n/AAAAAAAAAAAGAAYAAgD8//z//P/8//n/6//u//z/9f/5/wAADQANABAAFAANAAkACQACAPX/9f/1//z//P/5/wYAAAD5/wAA+f/5/wYABgAAAAAAAAAAAPn/+f8GAAAAAAAGAAYAAAD5//n/BgAAAPL/9f/8//v/AgD0/wMAAgADABIADwAOAAsA/v/8/wgA8//r//3//f/v//H/AwABAAkAEQARAA0ACwD9//T/5f/u//X/9f/z/wEAAwAFABQAAwAKAAkACAAGAAgA+f/x//j/+P/2/wUAAwD4/wYADgAAAPn/9/8AAPf/7//8//H/6v/5////AAAIABAAFQAOABEACAAHAPj//v8CAO7/7v/q//n/+//9/wwAFAAOABEAGAAXAAgA+P/2//T/4//p/+7/8P/8/wwACgAEAAQACgACAPn/9//8//r/8v/v//j/CAALAAsAGwASAAoAAQAAAAIA8f/1/+n/4f/0//b/8v/+/w8ACwANABQAFgAFAAEA/f8AAPf/4P/k/+L/6f///x4AFwATAB4AIQAcABEAAAD9/+v/6f/l/9//7P/u/wYACQAEAAcADQAMAPz/BwD9//T/7P/6//P/8v8CAAYAFgAUABQACQAAAAQAAQD//+7/5v/w/+T/8f8JABEABgAXABgABQADAA0A9P/s/+//5v/i/+P/5v/x/xEAEwAXACMAKAAfABwAEQAFAAEA7f/Z/+T/5f/r//3/AAADAAUAFAAGAAUA/P/5/wsAAgD0//T//P/+/wAACAAKAA4ADgANAP7/9v/7//H/7P/y/+v/6f/y/wEABAAOABUADAAOAAUAEQD6/wUABgDv//L/5P/p//n/9P8MAA4AFwAUAAwAEgD+/wIA8v/3//b/7P/0/+//9f8MAA0AEgALAAMACAD5/+///P/7/wEAAgAEAAMA//8IAAkAGwAMAPz/8v/6//f/4P/q/+P/6P/5//j/CQAWABEAEgAVAAUAAwAGAPb/+/8AAPn/8v/l/+r/+//7/wkAFgAWABMAGwAGAAQACQDz/+X//f/1/+//9/8AAAAAAQAJAAkACAAAAPH/8P/5/wYAAwAEAAwAAAAFAAAACAAPAAcABgAHAPD/4//h/+r/7f/n//T/9/8BABIAGwAgAAsACgAIAAEA//8CAPr/+P////L/+//w/+//AAAWABAADQATAA0ACwABAAAA8P/v/+n/5v/q//v/AwAEABkAFwALAPb/+f/3//D//v/3////DwAXAAYADQAGAPj/BQD+/wQA9f/t//X/8//r//n/7//n////AQAZAAkAEQARAAMACQAOAA8ADAAFAP3/7P/k/+L/5//q/wAAEAAWABgAFQAbAAgABgASAPj/7//x/97/4v/w/wYACwAGAPv/AgAJAAIACAD5//L/AAD4/wIADAAMAAkA/P/1//v/CAAEAPf/BgD7/+//9v/v//n/BwABAPv/CQAAAPf/BQANABEAGAD///3/+//1/+z/8//v/+b/9v8FAA8ABwAQABIAFgAfABUACgD7//D/4v/Q/+D/7/8DAB4AGAAeAA8ABAAHAAgA+v/m/93/6f/r//L/EAAXABIAAgABAAcADAACAPr/8//p//H/9f/9/wkADADv//n/8v/w/wAAEQAhACUAFQANAP3/5f/u//r/8v/z//P/6f/q//j/AQAhACEAEAAWABMA/f////L/4f/a/+D//v8LABEAIAAiAA8A/v8TAAMA+P/t/9f/1v/l/wIADwAoAB8ABQAIAPX/8f/1//H/7P/w//D/CAAQABUADwD//+7/5f/x//3/EAAaABEAGAD5//T/+v/4/wUAEgAAAPL/5P/s/wIA/f8LAA0ACQAKAAkABgD4//3/+//s//v//P///wkADAAWABMAGAALAPj/8//m/9//2f/p/wAADwAjADEAEQD2//f/7v/k/+D/4v/q//P/DQAlABMAAAADAPf//P/1//f/CAAMABQAEQABAA4ABAD+/wYABgADAPL/6P/j/+X/8/8KAAUA//8AABUAGgAMAAsACwAAAO7/8v/i/+b/BwASABMAAAD7/wAAAQABAAUA/v/w/+n/7v8QAB4AHAAXAPr/8f/o//H/6f/4////8//s//n/CgATABcA//8AAO7/6f8HAAIAFQAeABoA///9/wIA/P/8//X/AQDy/+7/7v/s/wIAAwD+/wsAEwARABIADgAFAPT/6f/5//L/7f/3/wAACAACAP7/DQATABQADwDv/+X/7f/1/wEAFAAZAAIABQD6/+r/8f/1/+3/6v/n//n/EAAgABsADwAIAPX/5//s//X/9f8GABMAFQAIABoACwADAAQAAgAAAOn/8v/s/+f/+v/2/wUADAAUABcAEQAOAAcA///9/wEA9//n/+P/6//5//b/BwABABAAFQAPABQAAQD6//r/9P/4//r/DwAEAPf/AAD2/+3/8v/o//L/CwAQACUAHgARAP//7P/y//D/6P/l//j/EAAMAPv/DwATABIAEAD7/wAA8f/m//T/7v/z/wEAAgD+/wwAFAAZAA4ADgAMAPb/8/8FAAAA8v/h/+L/6P/9/w4AGgAUABcABwD+/+7/8v8CAO3/5//s//v/AgD8//n/DQACAAIACgATABsADgAAAA4A/v/1/wAA6P/g/+T/6f/w/wAAGAAdABAADwADAAcABQD+//3/9v/2////BQAAAOv/9P/7/w8AAgAGAA4ACAAMAAsADgAGAPD/7//s//r/CQD1/+j/7P/+//j/BQAZAA0A+P/m/+z//v8WAA8ADAAFAPn/AAAVAP7//v8SAAQABADv//X//P/w//7//v/o//T/AgD8/wMAGQAHAPP/BwAOAAAA8v8AAAAA+f8AAP//9//s//P/AAABAAIACwAaABAAFAAeAA8A8//4/wQA/f/u/93/5P/p/+3/9f/7//n/7//9/wsAEAAiACwAGgAEAO7/+P8EABIABwDy/+v/3v/t/wMABQANABEACgD8//v/AAAMAAsA8v/7//T/5v8AAAUABgAIAAoA/f/3//7/CgAWAAMA+v/4/+L/6f////j/AAAQAA8AEQAVAAgADwAKAPv/+f/3//L/4//m//T/6v/d//H/AwATACIAJwAcAAoADAAMAA4ABgAFAO3/z//l/+b/6//6//X/9f/3/w8AGgAfABEADAAYAAUAEgAHAP7/AgDr/9X/4P/e/+v/CQALAAwADQAKAAQADAALABAAEQAAAPj/AAD6//P/7P/v////+v/8/xEACQAHAAMA+f/5/+r/6//x//z/AwAJABIAEgAIAAEAAgAYAAcABgAEAO3/8//9//3/7v/u////6//0//P/+/8YABkAIAAZABoAGQAPAP3/4//Y/8b/2v/z/wIAAwDv//j/CQAWACIAJwAbABYAFQAKAAUA///w/+n/6//e/9r/6v/9/wEA/f8DAAMABAAAABEAFAAYABwADwD///7/BgD4/wQACADv/97/4f/n//f/BQD3//X/7//u/wcAFAAaAAwAEQAaAAwAGAAkABgABgDs/+r/1v/d//D/8v/p/+H/1//u//7/GQAjAB8AIAAfAB0AHQAgAAkA8f/h/9f/3P/w/wAA+f/j/+b/9//2/w0AHAAkABcADQAPAAEACgD8/wAACAD1/+X/6f/z//b//f/z/+7/7v/4/woADgAWAAkAAADx//D/FwAeAB8AGAD4//T/9P/5/xYAFQD1/+X/2f/S/+D/9P8AAPr/+f8GAAgAGgAmACIAIQAXAP3/+f/5/wAA///o/9f/6P/t/wAADAAKABYAFQAQAAEACAAOAAYAAAD3//j/6P/m/+L/2//n//z/AAAQABoAEAAVAAgABgAAAPn/+/8JABAAAAAFAPr/8P/5/xYAFAD///3/+v/x/+L/9P/8/+v/+v/7//L/AQAQABUABwD6/w4AFAAPAA8AAAD4/wMA/P/8/wAA+v8IAPv/9P8JAPz//P8LAAQAAQD2//3/EQDu/+3/7//v//j//f8FAAQAAwD7/wEA9f8LAAsA/f8LAP7/BQAWAAYA/v/9//b/AAABABYA/P/p//7/BAAAAPL/BwAPAAEACAD9//j/8P/v/wEA/f8FAAwAAQAGAAUA///4/wUABgAAAPj/8f8FAAsA8P/+/wUAAAAQAA0AAAAFAAoA/P/1//X//P8CAPv/7P/w///////x//b/AwADAAMACgAEAAYABQAAAPj/+f/8//z/CgAGAPn/AAAAAAAAAAAAAA0ABgAGAPn/AAAGAPn/+f/5//n/9f8DAAoAAAD8//z/AwADAAMAAwACAAAABgAAAPL/AwADAAYABgAAABQA/P/8//z/9f8AAAAABgD8//n/6//u//z//P/8/wMACgADABEAAAD8/wYA+f8GAAYAAAAAAAAAAAD5//L/AwAAAAYABgD5/wwABgD9/wAAAAAAAPn/+f/y/wAA/P/1/wMA/P/1//n/AAAGAAYAEAAXAAYAAAAGAAYAAwD8//X/AwADAAoA7v/y/wYAAAADAPL/AAAAAPL/+f/1/wIACQD8/wMAAgAKAAAA9f/8/woA/P/8/wkA9f/8/woA7v8AABAAFwAUAAAAAAAAAPn/+f8GABAACQADAP3/7v/n//n/AAAGAPH/7v/2//L/+P8GABsAAwD8/wkAEAAUABEA/P/8//z/6//5/wAAAAAAAAAAAAAGAAYA+f/y/wAABgAAAAYAAAAAAAAABgD5//L/+f/8/wkA+f/1/wMAAwD1//z//P8KAAkAAwAKAAAA/P8GAA0ADQADAAoAAwD8//X//P8QAAAA+f/5//X/5//n//n//P/8/wMACgAJAAUAAAAGAAwAAgADAPz/9v/8//j/BgADAPn/BgAJAPX//P/8//n/BgACAAMA/P/8/wMA/P/8//X/8v/5//X//P8DAPz/AgADAPX//P8DAAIAAwAKABAADQAAAPn/AAAGAAAADQADAAMA7v8AAAMA/P8DAPz/9f/y//n/+f/1//z/CQD1//X/AgD8/wIACgAKAAoAAAAAAAYABgAGAPj/AAAUAAMA9f/9//3/9f8AAAkACQD9/+7/9f/5//n/8v/u/wkACQADAPz//P8KAAkA9f/8/xAAFAAAAPn/+f/5/w0ABgD5/wAA+f/y/wMA/P/8/woADQAGAPn/BgD5/wAABgAGAAYA8v/5//n/8v8DAPz/9f/8/wkAAgACAAkADQAGAPn/AAAAAAYAAAD5//n/BgANAAAA+f8AAAAAAAD4//L/AAAAAAYA+f/5/+7/9f8CAAIACgAJAAkAAAAAAPn/BgAAAAAABgAAAAYA+f/5/wYABgDy//L/BgAAAAYABgAAAAYAAAAAAAAAAAAAAAYA+f/y/wAAAAD5/wAADQAAAPn/+f/5/w0ADQAGAPL/AAAAAPL/AAAGAAAADQAGAPn/AAAAAAYAAAAAAAMACgD1/+v/AAAGAAAA8v/5/wYA+P/1/wkAAwADAAIAAAD9//z/AgD9/wMAAwACAPz/EAAGAAYABgAGAAMAAwACAAoAAAD1/+7/9f/8//L/+f/5//z//P/8//X//P8JAAMACgAJAAYAAAAGAPn/+f8GAAYAAAAAAA0AAwD8//z//P/8//n/+f/5/wYADQACAPX/+f/5//n/+f/8/wIA7v/u/wYADQAJAAMA/P/8/wIACQAJAAYABgAMAAYA/f8CAAIA/f8KAAIA9f/9//b/9f/y//L/+f/8/wMA/P/8//z/AwAKAAIA/P8KAAMAAwADAAAAAAD5/wYAAAD5/w0ABgAAAPn/AAAAAPn/AAAGAAYA+f8GAAoA/P/8//z//P/y//n/BgD5//L/AwD8//X//P/1/wAADQD5/wAAFAD8/wkACgAKAAYADQAKAAMACQADAPX/9f8KAPX/5P/5/wYAAAD5//n/+f8FAAYAAAAAAPn/AAAAAAAAAAD5/wAABgAAAAAAAAAAAAAAAADy//z/DQAAAAAABgANAAkA/P/8//X/+f/5/wAA+f/y/wMABgAGAPn/+f8AAAAABgAGAPn/+f8AAAAAAAD5/wAA/P8CAA0ADQD5/wYACgD8//z/AwADAPz/AwD8//X/9f/5//n/AAD5/wAABgD5/wAAAAAAAAAAAADx/woADAAAAPL/9v8JAAYAAAD5/wYABgAGAA0A8v/5/w0AAAD5/wYA+f/y//n/BgAAAPn//P8CAA0ADQAGAPz/CQADAPX//P/8//L/+f/y/+7/9f8DAAMACgADAAkACQANAAYABgAQAPz/9f8DAPz/9f/y//L/8v/8//X/AgACAPz/AwADAAIACQANAAYABgD5/wYAAAAAAAYAAAAAAPn/+P/5//j/AAAAAAAABgD5//n/AAD8/wMABgAGAAYA+f/5/w0ADQD1/wYAEQD8//z//P/8//X/AwD8/+f/+f8AAPn/9f/8/wMA/P8DAAMAAgADAAkAFAANAAMA/P/8//X/+f8GAPL/+f8GAAAA+f8AAAYABgD5//L/AAAGAAYABgAGAAAAAwD1//n/AAD5//n/+f8AAAAA/P/8/wMAAgATAAYA+f/4//n/AAAAAAAAAAAGAAAA+f8GAAYAAAAGAAIA/P/8//z/+f8GAAAA+f8AAPn/8v/8//z/AwD8//z/CgAJAPX/EQAGAAAADQAGAAAAAwADAO7/8v8AAAAA+f/5/wAABgD5//n/BgAGAPL/AAAUAAYA+f/5/wYA+f/5/wAAAAAAAAAA+f/5/wYA8v/1/wkAAwACAAkADAAAAAAABgD4/wAABQAGAP3/AgACAPz//P/1//n/BgD5//n/+f8AAAYAAAANAPn/8v8AAAAABgDy//z/AwAGAAAABgANAAAAAAAGAAMA9f8AAAAABgD5//n/AAAGAAYA+f/5//n/AAAAAAAABgD5/wAAAAAAAAYA+f8AABQAAADy/wYAAADr//X//P/8/wMAEQANAAAAAAAGAAYAAAD4/wAABgAAAAAAAADy/wAABgAAAAAA+f/5//n/AwAGAAYAAAAAAPn/+f8AAAYA+f/5/wYAAAD5/wAADQAAAAAA8v/1/woABgAAAAAAAAANABAAAwD1//z//P/8//z/9f/y//n/+f8AAPX/9f/8//z/AwAKABAAAgAGAAYAAAAAAA0ACgD1//n/EAD8/+7/AAAAAPn/AAD5/wAABgD4//n/BQAGAPj/+f/5//3/AwACAP3/AgAJAAAA/P8GAAAA+f8NAAYAAAAGAAIAAwDr//n/BgD5//n/+f8AAPz//P8DAPz//P8DAPz//P8KAAMA/P8DAAkAAwANABQAAwD1/wMACgD8//z/AwD8//z/AwADAPz/9f/8//X/6/8AAAYA+f/5//n/AgANAPn/9f/8/wMACQADAPz/CQANAAAAAAAGAAAA8v/4/wYABgAAAAAAAAD5/wAABgAAAAAABgDy/wYAFAD8//X/AAD5//L/8v/8/wIAAgD8/wIAAgD8//X/CQAKAAMACgAAAAAADQANAPn/AAAKAPX//P/8//n/AAAAAAYAAwD1//n/BgAAAAAA8v/5//n/AwACAPX//P8DAAkA9f/8/wkACQAKAAAAAAAAAAAADQAGAAAAAgAJAP3/AgD8//z/9f/1/wAA+P/5//H/9f/9/wMAAgACAAMACgACAAAAAAAAAAYAAAANAAYA+f8GAAAA+f/5//L//P8DAPz//P8CAAMAAwACAAoA+f8GAAYAAAAGAPn/8v8GAA0ABgD5//n/AAAAAPn/AAAGAPn/8v/8//X//P8CAAkACgACAAAAAAAAAA0ABgAGAAMA/P8DAPX//P8DAPX//P/y/wAA+f/r//X/EAACAP3//P/8/wIACgAJAAYAAAAGABQA/P8QAAoA8v8CAPz/9f/1//z//P/8//L/+f8AAPL//P8DAAMA/P8CAPz//P8DAPz/CQAQAAAAAAAAABQACgD1//z/AwADAPz/9f/5/wAA8v/y/wYABgAAAPn/9f8DAAoAAAAAAAAADQAGAPn/+f8GAAAA8v/5/wAAAAD1/wMACgD1//z/CgADAAkABgAGAAYA+P8GAAoAAwD1//z//P/5/wYAAwD8//X/+f8AAPn/8v8AAPz/9f/8/wIA/P8DAAkACQADAA0AAAD5/xQAAwD1/wYA/P/5/wAAAAAAAAAAAAAAAAAABgAAAAAAAAAAAPn/+f8NAAAA+f8AAAAAAAAGAAAA+f/5/wAA+f/1/wIA9f/8/wMAAwAJABAAAAAGAAYAAAAFAAAABgACAAIA9f/1/wIA9f8AAAAAAAD5//n/AAAAAPn/AAAAAPn//P8JAA0ABgAAAAAABgACAPz//P/8/wAAAAD5/wAABgDy//n/BgD5/wYAAADr/w0ABgD5/wYAAAAAAPn/AAAAAAYA+P8AAPj/+f/5/wAAAAD5/wYA/v8AAP7/AAAAAPL/DQANAPn/+f8GAAAA+f8AAPn/BgAAAAAAAAAAAPj/8v/9/wMAAwAJAAAABgAAAPL/AwAGAAYABgAAAAYAAgD8/wIA9f8DAPT/9P/0//H/+P/4//H/+P/4//H/8f/0/wIA/P/8//z//P8QAAkAAAAAAAYABgAAAAAABgAJAAMA9f/8//X/AAAAAPH/6v/x//7/+P/q//T/AQD6//T/+//6//7//v/4//H//v/x//j/BgAAAAYABgDy/wAABgAAAAAAAAAGAAAA+f8AAAYA+f/5//L/AAAAAPz/CQAGAAAABgAUAPz//P8DAPX//P/8/wAA+f/y/wYA8v/8/wMA/P/8/wkAAwACAAYA+f8GAA0A+f/5//j/8f/8/wYA/v/x//j/8v/8//z/9P8DAAMACAD4//j/DQD4//j/+P/4//j/+P/4//j/BQD0//H/+P/+//r/7f/x//j/+P/4//7/AQDt/+r/8P/x//n/9f/9//z/BAD8/wYACQAKAAkABgAGAAYAAAD4/wUA+v/6/wIA9P/m/+b/8f/x//7//v/x//H/+P/+//j/8f/x//j/+P/+//j/8f/4/wYABgD5//n/BgAAAPn/BgANAPn/AAANAAMAAwD8//X/9f8GAPz/+f8AAPn/+f8AAAAAAAD5/wAABgD5/wYAAAAAAPn/AAAGAPj/AAAGAPj/+f8FAAYABgAAAAAAAAAAAA0A/P8DAAMA/P8JAPz//P/1/wMA/P/u/wYA+f8AAAAAAAD5//n/AAD1//z/CQD8/wIAEAD5/wMABgAGAAAAAAAAAAYABQD0//v/9P/0//T/7f/4//j/+P8AAOr/8f/4//j/8f/+//n/9f8JAAMAAwAGAAYABgABAA4AFAD1//z/CgD9//b/+f8GAAIA/f/1//n/AAAAAP7/6f/+//7/8f/+//j/+P/4//H/8f/x//T/+v/7//v//v/w//H/8P/4//j//v8FAPD/BQD0//T//P/0/wMA9P/0//T/9P/0//z/+f/y//n/AAD8//X//P8CAAMAAwADAAMAAwACAAkAAAAAAA0AAAAAAAAABgAGAPn/BgD5/wAACAAIAAgAAAAGAPj/+f8FAAYA+P8AAPH/6f/4//j/9f/0//T/+//6//r/AgD+/wUA+P/+//j/+//7/+3/9P/7/+3/8f/4//j/8f/x//j/+P/+//j/6v/4//j/+P/4//j//v/x//H/9P/0//r/+v/0/wEABQD+//H//v/w//j//v/7//T/+v/0//z//P/8/wMA/P/u//H//v8GAAsAAwD1//L/AAAGAAAAAAAAAAEAEAAJABAACAAIABAABAAVAA4ACAAOAA4ABgD8/wgACQACAPX/9P/t//H/AAD4/+r/8f/s//P/+f/t//v/+//0//v/+//6/wgA/v/x//j/+P/4//j//v/x/+r//v/+//j/+P/x//j/+P/4//H/+P/x//j//v/4//7/8f/+//j/8f/x//j/+P/x//T/+v8GAAAAAAAGAPn/AAD4//H//v/4//D/+P/w//7/+P/4//7/+P/q//j/+P/5/wYA/v/x//n/DQD5//L/BgAAAAYAAAAAAAAAAAAAAAAABgD5/wAABgDy/wgABgAAAAYAAAAAAAAA+f8GAAAA/v/4/+r/6v/+//j/8f/4//H/9v/4//7/+P/+//j/8f/p//H/BQAAAAAABgAAAPH/AAAAAAAAAAD5/wYAAAAAAAAA+f8AAAAABgAAAPL/AAAGAAAAAAAGAAUA+f8AAAAAAAAAAPn/BgANAPn/+f8GAAAAAAD5//n/BgD5/wAADQAAAPn/+f8AAAYA8v8AAP7//v/4//n/+P/x//j/8f/0/+z/+//7//T/+//7//v/+v/7//7//v/4//H//v/+//j//v/w//H/8f8FAPv/7f/q//j//v/+//H/6v/+//n/BgAGAPn/AAD4/wYAAAD5//j/AAAAAAAABgAMAAAA8v8GAA0A/P8AAAMAAwADAAIA9f/8//z/9f8CAPX/+f/y//n/AgD8//X//P8JAAkAAQD4//j/8f/+//j//v/+/wwA7P/m//7/9P/6//T/9P/i//j/+P/4/+n/6f/p//7/+P/t//r/8v/1/+H/8P/2//D/+P/4//7/AAABAAEABgAIAA4ACAABAAEACAAOAAgAAQAAAAwAAAD4/wAABQAAAPj/BgAGAAgAEAANAPz/9f/5//n/FQAOAAQA4v/4/w0A8v/i//T/AwD6//b/+P/x//7/BQD4/wAA/v8BAPT/7f/7//z/9P/s//T/6v/x//n/9P/s//r/+//7/wUA8P/x/wgA8f8DAP7//v8AAAAA/v8AAPH//v8IAPH/+P8AAPH//v/+//L/8P8AAPb/AAARAOn/BAD+//r/8P/+/wAA8f/1//z/CQD8//T/EwACAO7/8P8IAA0ABgD5/wUAAgAEAPP//P/r/wwABQDq/+n/+f/4//n/BAD7/wMA+v/8//X/AwADAAMAAgAGABUA8P8IAAAA/v/4/wAAAADp/1YANgBEAJMAGf/k/7X//P/c/+v/tP/V/zgAAQAaAOr/WgBKANX/yv+q//v/PABaAJj/af/k/+P/IQAAAOX/9P8KACkAHAAQAEYARgDYAJv/5P9l/6gAHgCE/7z/Mf9p/+D/EAD4/wsANQAqADIANABUADsAcgA6AAYA4f/Y/93/yP/Y/+b/5v/p/5j/4P/w/wYAsP9JACEA0ABoANH/6v/D/9v/yP/Z/+T/gv/Y/93/CQATALH/CQD+/wwAIQARABkA1QBYADMA+//Z/6D/NgDgACAACwAYAOD/yf9S/6j/df9I/6j/qP/2/9n/4P8jABsAyP8UAPr/SAA4ACgAGgDZ/xoA2P+QAH4A+P94AC4AgAA+AD4AHQDa/6H/DQDI/9n/tP9q/7L/cv8o//D+HP+I/wn/eP+u/6D/EgB0AGQBawGtARYCzAEFAiICjAEtAXYAOwABAMr/Uv/Z/s3+uv6L/sb9qf30/WD9TP1e/Uj9gv2o/bD9If89ANoAJQJrAwAEWASIBEgE+AP+AiMCUgEmAHr/OP8B/6L+Yv4U/0X/Gv8t/2j/gP/q/qL+Uv7e/aj9cP0x/SL+AP6A/a39rf14/rD/VQCqAUwDKgTcBDYFLgXkBOoDxAKyAYUAov8i/9D+1/7Q/lX/fv9+/7j/2//x/8z/cv/h/qj+Pv5g/U79Jf1e/DL8RvyY/Jz9u/8gAVsC0gPlBGkFYQUVBdUDtAKYASgAGf+5/gj+BP6Z/gX/pP/m/x4AYACZAI0APQCY/5z+O/67/e78yvwx/JT7mPuH+/v7Vf5NAG4BBQJMA8QE+QSRBIkEKgQlAw8CCQE1AB//PP5H/r3++/5T/9X/NwBqAIIAoQCQAEAAb//g/rj+K/7R/YD9//zY/Cr81ft3/IH+HADzAHMB+QLyBGcFiwSoBJYE3wOJAlsBbwAh/+X92f1L/mH+kf76/mT/wf8aAFwAcABBAIT/Bv+N/mj+RP7J/TL9Cv2J/LX7uPvX/ef/RgCBADACFgToBBAEEQSBBEAEDwOiAbEA9//J/jb+Yv6e/rv+4v56/xgAegCAAJIAoQAJAET/tv43/jX+9P2J/TD9/vxw/Mz7Qf0iACoBggBGAZsDNQV5BN8DJQRNBIMD4wGgAOv/K/9w/t39sP0z/sX+Qv+e/1sA1QDDAJgAHQCu/wv/Sf7X/Zb9Tf34/J78/fsz+1j8ev85AakA8QBzA8AFYgVdBIUE6wRLBJgCzQDH/2T/xf7j/Rv9bv1m/iH/Tv/r/9gAFAHeAJAA2P9B/5X+9P17/Sr9BP3Y/Hv8Avzc+6b9KgBiATUBEAJYBOAFUwV4BF8EVQTIA+8B5P++/rD+cv6X/d38cf3U/sT/DwCjADkBUgEMAYYAev+X/h3+s/1D/cT8uPzL/HH8sPt7+0H9NQD6Ab0BHgKhBOUGnQYoBREEvQNpA/wBi/+g/WD9wf2K/dH8CP2I/iMA+wBxAbEBuAHAAVwB/v+n/hD+zv1w/dT8ivxs/CL8kPts+/X8yf8/AoUCYgL5A2QG6ganBfUDOQNHA1UCFAAG/jr9zP0C/o79LP0r/s//xQBSAbgB9QHFAUcBTQDW/u/9gP0W/dP8sPzL/Jz8Svzg+1z8d/5vASwDtgLWAs0EoAZ4BsYEOAPMArYCbwFN/6D9X/24/bj9QP10/Yj+8v86AZkBSgH3ACQB4wCH/zD+UP0a/SL9w/wQ/Hz7Wfu5+3n8Ff60ALkCYgPbA1QFwwbaBp0F/QMIA3gCNAFV/3z91/xA/ab9fP17/Wn+iP/3AOgB/QF1AUsBXgF8AB3/4P0d/fn84PyT/Pb7kvuj+8H7dvyr/k0BugIwAyYE3gX6BsQGXgX1AzwDfQKwAGP+z/zA/En9WP3//Ib9wP5iALgBAwKVAVcBdAHmAKj/RP5t/T79P/0M/Yz8Bfz2++n7OvzN/U8AQwLaAmMD0ARJBq4G4AU9BCIDiwKRAZr/qf3V/Bn9Tv0L/Un9Rv7G/04B/QHbAZEBjwE1ATQAuP6o/Rj9/fzO/GD84fuZ+4b7mvvJ/C3/4AGsAv8CLgQEBvcGaQYkBcYDGgNHAoUAZP4V/Un9pf1R/UT9Nf6l/x8BDwIkAtoBvgFsAWoA8/6m/eb8yfzD/Hz87/uW+4j7YPva++L9JgG5AtgCnwODBf4G3AaxBUkEvgMrA4IBDf83/fH8dP0h/Yv8Ff3g/pQAYwGFAXQBvAHxASUBfP8c/nD9V/0m/X/8IPwI/DT8uPta+0v8UP8tAqcCuAJWBKIGQQeBBhkFSQQABNgCnQA+/mD90/1y/Yr8gvwH/r3/mQC3AB8BuQHDAQYBlf/F/uj9Qv3j/Jb8XPxY/GH88vt+++L75v2jABsCSQKMA9IFKAe8BiQGqQX0BMwD3wG4/zv+7v2B/ZT8Pvw2/dj+7f95AOcAxAELAnkBRABY/9b+wP3L/F/8Tfww/P77qPtV+0/7Nvxo/qsAzQF2AlQEewb5BlcGAQacBYsE1wL1AEb/RP7Z/fX8JvyO/Ar+YP8kAAsB9AGMAjACYQE5AHz/qP4w/UP8FPwY/NH7dvs3+yn7cvuz/DL/qAG+Am0DaAU9B0IHcQbYBWEF9gP9AT8AAP/5/eH8Evwf/AT9G/7q/iwAfgEwAjQCCgJzAYMAuv9n/h/90PyU/BD8qvug+5n7XPur+2H9AwDnAXEC6QNTBhcHYwY0BkQGJAXMAgcBDAD6/mn9K/w2/N/8Pf3y/VD/qgChAbwB3gH6AU4B6v8c/2D+Bf2B/H38J/wP/CD8Fvz6+zn8Tv1o/x4B8AFLA5AFVwbCBScGdAZNBXIDLwIkAYz/Hf4G/cj8BP1G/an9J/+VAEwBggHbASACPAHu/0D/Zv7e/EH8P/za+7v7sPur+7D77fsT/S//ZgGpASsD8AWoBuIFggYrB2cFtwNDAxkCqP9T/pf90fx9/Lj8kv2C/p7/mwA6AYYBzAFQAbYA5P/Z/p79Y/27/Oj76vvr+4f7Yvuu+5X8PP5hAAoBQwKQBMoF6wWYBtwGoQVmBN0DewIrAMj+4v3L/E78h/yJ/Un+Bf9MADwBYQGeAacB+AAKABj/B/6N/fn8GPwl/Cn8wfut+wv8nvz4/QAABgEjAn8EMQWDBXoGfQYZBTcEgAPcATAAH/8m/iL9vfz9/Hj9cv4Z/wcABAGDAXMBngErAUEAgP94/of9Nv2Z/Ez8RPwT/PL7APxP/Cz96/6XAGgBpQMyBVQFewY1BygGOwWZBA0DNAEkAOj+l/0L/ef86Pys/Vr+Df8YAPkAHgFUAWMBlgC4/wb/5f1J/dr8afxA/Pv75fvK++n7kPw7/hgA8wC9AtAENAXNBQIHbwZxBdgEpgO5AUgALv+g/b/8gPxt/Az92v0f/+n/3QCQAaIBowEkASgASP8v/nX97Pxe/Cv85Puy+6X7rvst/Ln9z//GAFUCpQRPBccFHAdMB/AFPwYFBaACogHo/739L/1g/MH7S/zp/Mb9xv7B/5sA5QCOAXgBegAbACP/Cf6t/fv8Hfwv/ND7Jvta+7L7n/zM/hMAagHnA0gF2wV4B78HlAbeBq0FNQN8AngAEP6G/YP8lftE/H38Of2R/jj/RwDoAEgBwQFJAW8A6v9z/uj9YP0u/C78C/we+y77d/u7+6n9LP8mANQCewQyBQcHtAe5BhMHRgbKAxkDZgHr/ir+Lv3x+0L8aPyw/PT9oP6//3wA7QChAX8BvwB4AE3/aP4s/vf8hvx1/Nr7XPug+xL8/vzP/tj/5AEDBOgEGAaKB90GhwaoBnkEGwMqArX/Wf6L/Y38Ifx9/MH8oP17/m3/WACuAFwBpgH0AJkA0P+H/kj+eP1Y/EH8zfsd+3X79Ps5/An+Xv9lAMkCJAS2BGwG4gYoBp0GjwWuA/0CMQFd/5H+ZP3A/M/81Px8/Vz+9P4XAJUA6gBjAQQBkAAPAOz+aP6v/dz8sfwZ/M77yvv8+2n8ev2G/rr/VgG6AvQD+AT0BSQGJgbkBZMEhgM8AkkACP/M/eH8rPyH/ND8sv0//lb/VQCmAGYBbwENAeQAvP8D/3b+OP0G/ar8cvuY+1r7a/uZ/H79CP+nAE0CHgRWBZAGhAdQB28HcgaCBEMDgAFx/0j+0vwH/CT8+/uK/Jv9QP5s/1QArgBOAUUBxgCSAOT/DP99/qD9EP33/Ab89Pu/+8D7k/xC/az+CQBeAZADbASUBeAG6AYVB6kG3QT4A3MCYABK/8T9sfyS/Cr8YvxN/dP9+/7L/zcA3gDwAKwAmwDn/yH/o/6c/RX9vvzx+9/7k/u++5L8ff3g/hQADALkA9EEGAYhBx8HMgdmBvEEgAP6ASAAtf5V/Wn8F/zw+1n8Ev32/RP/+P+EABoBMgHgAJoA8f9H/xz+h/3I/GX8Efza+5/73PuE/Bn9n/60/64BiAOwBNoFyAYUBwYHYAZSBeYDhwLpAFT/Cf4I/ZP8SvyQ/Av9uP2v/pj/VgDyAAUB7QB+AA4AVf8Q/or9xfxg/Nf7o/tI+737GvzZ/JH+ZP/VAWUDyAQeBs8GbAdTB7cGVAUZBEMCqAAq/4/9lvz+++b7IfzD/JH9lP5Y/0wA7gAaARcBKQFNADgAbv8r/h/+Qf3D/HD81PvE+y/8afx5/eH+AAAFApYDkATGBZwGDAe9BuMF3wRbA+4BYwDc/rz9+PyX/In84Pya/UH+/P79/5YAxQAAAfUAaQAnAJv/YP48/pT95vyn/Bb8A/xw/Fv8nf3c/tb/ugEwA/sDjgU3BqsGlwYFBhMF1AN0AtEAUf8F/gf9Z/wV/Dv81/wT/UT+C/+u/1AAVwCZAAwAvf81/zn+B/51/UP9zfyd/MT8YPy4/HD9OP6J/xQBlgKaAxgFDQaQBroGNgaABUkE7wJcAbj/YP5U/ZD8Hfw7/Ln8Bf0W/iH/x/9dABgBFQENAZ8ABAAg/4f+3f1b/eD8ffyg/Ez8gPz+/K/9U/8fAC0CXgMZBOcFVAZ9BtIG6AUYBf8DbAKyAH//7P38/G384vtk/LH8GP1d/jX/pP90AOwA7ADTAFUAlP+w/h7+hP37/GD8c/wy/Pz7Pfym/Kr9L/9DAE4CqgMIBT4GvwYkB9AGEQb7BLYDGgJTAAD/mv31/Dn8F/x+/Mf8c/1p/kv/4v+PAP4AFQHgAHQA0P/6/k7+jv3o/EP8Gfzs++r7KPzS/A/+bP/OAJcC/QNkBU4GqQY3B4wG8wXiBHED+QE9AL7+gP3I/P77Lvx3/AD92/1+/j3/PwAeANQAxABLACoASv+w/jf+dP36/On8NPyA/Fn8cPyP/Wj+DgD4ADED8gOoBQgGvgYBByoGsQVLBAQDSAGf/x/+H/0o/Lz7Bfw3/Aj9yf1v/rX/9v9wAC4BhgCVACMAM//h/uv9ef35/HD8GfxA/AT8nPxi/Tv/6P8YAlwD1wQuBnAGRwcSBzsGhQUcBHYC4ABp/9/9Iv1A/L/7M/wo/Pr81f1S/s//FwCcAF8B6AAHAZ0Az/9M/3T+2v3M/Ff8vPuI+yT7DvxP/c/9OAB/AVADAQXMBQ0HSQfjBmYGTAWyAzACowDo/u/9yPz8+/77vvs4/P/8Z/3E/lT/6//wANIAEgEWAVQAPgB8//f+R/5y/QP9cvzM+8D76/wJ/b3+IgCYAX8DdQTcBeYGkwb8BiMGBgXRAzQCuQBU/xr+3/xQ/OL7q/s0/HH8bf1j/gL/IQC0APsAVgE4AakAhgCU/xr/af5Q/ej8Yfz/++/7lvyQ/Yr+fQDEAV0D2wSzBXsGtQZFBu0FmgRTA94BQgDo/sn9wPwR/OT7yPsw/MP8cP2S/hr///+rANgANQHsAKkAVgB4/yT/Mv5j/f38GPzN+9T7mPxc/bn+iADyAboDFQUYBv8GCAcgB00GGgXKAwkCcQDo/sX9B/zO+2v7PPsO/H78g/2V/kf/XgDfAFYBhQFXAfEAQACF/4r+wP30/Eb8l/t/+w78fPz9/UD/4gCTAuQDSwVFBqUG/AZhBosFXATFAmwB2f+1/in9lPwr/MD7Jfxw/DP99v25/qz/SgDiADgBUwEdAYgAFgBa/33+8f0u/UT8/fsX/Pv7Tv0j/nL/QwFdAggEQAXlBdwGZAYWBn0F4gMBA3kBGACx/nj9/PxA/Bb8OvyP/FX98P2f/nj/MAClAAcBGAHbAGkA7v85/33+sP2h/Bj8dPuA+6372vzY/XT/OgGTAmYEZwWGBuMGqgZUBkQFCQTXAkkB0/9p/nv9zvwx/Cv8MPyH/HX9xf2e/pL/5P+MAM4AtwCFAB4ApP8Y/6P+nP0e/ZX8Pvxn/Lf8+v2T/mYAowH8AoYEWgU3BlQGKwalBagEXgM1Aq8AIv/5/Rj9NPwV/PL7B/zg/IL9H/4f/7//PgDJAOIAwwByABsAkf8f/3D+w/1S/dD82Pzg/Lr9f/6F/xcBCwKvA7kEeAU/BjcG6gVDBQ0E/AKXAQAAvP6Q/a/8Fvzx+9D7Sfzg/En9Hf4E/5n/RwC2ANkAzQCnAD4ArP88/0n+v/0z/e/80/z7/Ob9nP79/0IBkAL6A9gEtAVIBigG1gUEBc0DsAIeAaX/Yv5a/Wf8KvzM+xr8m/z7/NL9sv5b//X/bgCcALwAmgBmAO//cf+X/hT+gv3k/Pv82PyY/Ub+cv/PABECtQNzBKMFSAYyBhEGPgVSBCgDoAFzAMj+tf20/DH8xPu3+wn8i/wH/fv9qf5T//j/PQBeAF8ALgDL/0z/h/7q/SH9pvyg/HD8OP0Q/kD/tgAuAssDugTEBXsGgAYrBmYFhQRMA9EBjwAX/9X97PxC/Nf7tPsF/F/8EP3h/aH+Y/8IAGkAnwCrAHQAFQB7/83+Qf5z/ST9EP0z/dn9xv7S/xMBlQKhA4EEdAXiBdAFbQXIBOUDsAJ0AVoADP8i/mf92vx3/Gf8lPzk/IT9Df7H/jz/1v/h/ycADwC7/2v/qP5d/sf9PP1g/Wj94P25/qD/oQDtARYDBQS3BGYFhQVABZ0E3AMOA7oBiABz/xv+aP2r/CT8B/wb/Ff8Ev27/WH+Fv+t/wIAEgBOAPb/y/8r/6b+b/6H/dj9xP0V/vX+yv8FAfsBXANBBAYFlgW8BYgF8QQBBEYDFQK4AK3/af56/eP8C/wB/On7Ivy3/Fr9Dv63/lP/3/8OADoAKADy/5r/1f56/gb+y/3w/Rn+sv6M/4sAeAGWApcDMATQBPkE3gSCBKkDxgLAAZ4AaP9y/qr94/yI/FD8P/yn/Av9l/0l/sf+Uf+V//b/EAAXAPf/eP9C/87+o/6n/q/+F//I/4gAZAFdAj8D0gN6BKAEhwRJBIoD4gIOAs4A3f8A/xn+Xv0a/aj8wvwD/T79zv0X/p7+5f4a/1z/R/9W//X+o/53/uj9d/4P/un+dv9FAH0BIwI7AxkEpgQ/BR0FCAWKBKsDHgP4AcEA5//L/tj9df3P/H78r/yc/AD9Rv2P/RT+Sv6W/uD+3/4n/+X+B/9d/rX+ev5p/nH/Pf+4ADcB0wE1A14DVAR7BFkEigTUAzYDyQKRAb8A+P/M/kf+v/0X/TT9+vwQ/Yj9bP31/TH+ev7r/un+KP8g/xD/pP58/qX+JP4H/yH/6v/9ADYBlQL8ApIDOwQVBEEE/wNaA98C+AHnAFsAIP9E/uD9Kf31/Pf86vxa/Y/96v1B/rT+9P4U/3H/Xf87/+T+dv6l/jD+yP4l/7H/3gB3AZQCHwPKA0UEOQROBOYDbQPYAggCBwFUAEn/bv78/VH9DP0L/QD9Mf1y/Y399P04/lX+4P7V/tb+1f6f/ur+nv5t/6P/OwA+AbABuwL9AqQDOwQTBEsE+gN7AyQDNAKDAbUAoP/b/hj+mf0a/fP81/wO/TL9aP3v/fT9Xv6k/or+pP6U/s/+rv4i/5L/6f/0ADUBOQKnAgMDywOkA+ADtQNKAwwDYgLRAQcBMgBq/8b+IP6e/Xv9Nv1V/Yf9lP0X/ir+eP62/pf+sf6I/pf+m/7Q/if/fv9OAKEAdQHuAUYCAAMAA08DKgPdAskCGQK+AQEBPwCb/+b+fP7v/Z79Zv1f/ZH9oP0A/jH+ef6f/sb+vf7A/s3+y/73/jP/pf87AMMAjgEgAnMCCwNQA2sDYwMPA+sCVwL+AVUBmwAUAFn/6f5V/vr9tv2O/ab9mP3S/f/9Mv5Z/nP+gf6o/pP+w/7T/hP/iP8IAJwAQAH+AVAC7QInAz0DUwP9AuYCZgL6AWoBrAAUAGL/7/5r/gD+xv2g/bD9s/3b/Q/+Ov5e/nf+p/7I/t3+F/8w/1//2P8+AMUARgHsATkCmgLxAucCBAO6ApECYAKwAWkBpgAFAIL/5P6S/gX+1v2p/Zf9rv2z/ef9B/48/iz+f/6I/rL+4f4H/zj/m/8uAHgANQGbAUICdALoAhEDAgMIA7UCkQL8AZoB7QA7ALH//f6M/hD+9P26/a79tv3E/ff9Dv45/kD+if6G/qv+8/7+/l//pf8oAHoACgF4Ae0BPAJrAqsCwAK5Ao8CbAISAqcBQwGXABsAgP/+/oj+Sf4q/vP9Av75/Qr+F/4u/l/+cP6l/sn+EP83/3D/0f8wAJkAAwF4AeABNwJJAoYCbAJmAjQC5wG0ATkB2wB8ANj/cP/4/qH+Xf4p/jL+Jf4x/jj+b/5a/ob+i/6i/sj+x/4L/xv/Uv+o/yAAgQD1AHAByAFOAjICewJzAkMCLgKxAYoBEwGqAFIAvv91//D+u/5Z/ib+F/72/Qv+Ff5B/l7+of7S/gj/Wf+J/87/JgCAAN4ANwGlAbwBDQLzARYCBwLDAbIBVwEhAcAAgAAVAL3/iP8H/+3+nf6F/mH+aP56/mf+ov61/tr+Af8m/17/cf+f/7z/+/8yAIYA5QAhAWMBdgGZAX4BfwFRASEB+QC3AHcAMAD0/57/h/8y/wX/BP/g/uv+1f7v/gD/Hf89/1j/iP+p/8f/3P/6//n/IwBWAG8AqQDSAOgA6gAAAfQA6gDWALQAkABnAEgAIADo/7r/qf9//3H/Zv9g/1X/R/9R/1z/cP9+/4n/pf+z/8T/y//W/+7/EQAtAEwAegCXAKMAtACnALEAqQCQAI0AaQBMADAAAwDc/8X/qP96/3H/ef9r/1z/bP9n/3//j/+J/7D/wP/J/9L/1//q/woAKwA/AF8AcwB9AIQAlACNAJgAiwB8AHAAUwA7ABgA8P/S/8D/rf+U/5H/k/+P/5D/kf+U/6v/v//a//f//P8IAA4AFgAdABUAJwAZAB4AFwAqACYAHwAoABwAIAAbABsADQAGAAkA+//+//H/6//w/+D/0P/O/8D/xf/P/83/2f/k/+P/9f/+/wUAGgAWAP7/EAAMAAkABQABAAMABAD9/wYA//////j/+P/5/+v/9v/d/+3/9f/q//r/+P/9/wAAAAD+/wYADAAQABYADAAYABYA+f8BAOv/7f/5/+H/6f/4//H////6//z/+P/w//j/3f/x/wEA/v8KAAkA+f/u/wkADADy/w0AGAASABYAEwATAA4ADwAQAAYAAADx/+r/2v/g/9r/3v/g/93/2//c/+H/6P/t/wMA+f/7/wkA///7/wUAAAAAAAAABAALAAkAAAAEAAAAAQANABAADwASAAsADwD6/wcACAD2//D/4v/g/+L/6v/f/+P/9P/t/wQA/f8AAP//AAAIAAQACgD0////BQD8/wYAAgAAAAEABwAAAPv/BwD1//L/CgANAAYACgAEAPz/AQD7//n/+P8AAPX/9f/5////8//2//v/9//2//r/7//1//f/8f/5/wEA+P/4//f////4/wgA+v8AAP//6//8/wgABQD5/wkADQD2/wYA9//8/wEA7f/z//f/+P/5//r/7P/t//f/CQD7//b/+v8BAPj/+P/1/wUA//8EAP7/+v/6/+7/+/8BAPr/9P/6/wAA+v/x//T/CAD+/wAABAACAAgAAQD///j/+P8BAP//+P/y//j/9//0//H/8f/r//D//P/5//n/+P/2//X////2////9v/4/wUA/f/+////BQARAAkA+/8AAPL/9f8BAPL/+v8BAPH/9//1/wYABAD5/wgAAQD6//X/+f/z//z//v/y//j////4//D/AAD4//T//P///wEA+v8AAAgAAQD//wUABwDz//v/AwABAAoA/f/9/wEABQACAPT/9v/4//3/9v/w//r/8f/1//b/+v/3/+7/8f/w/+//9v8LAAMA7f/w//H/+P/2//7/BQDu//T/BgD5/wAADAAPAA0ACAAKAAIABQAIAPz/AQD6//T/AwAGAP3/AwD+//v/+P/1/+//8P/3/+r/8f/x//T///8BAA4A//8NAAoA+f8JAAgABAD2/wEA9f/v//P/9v/5/wAA/f/u//v//f/4//j/9P/p/+z/+v/4//X///8GAAIA/v/5//j//f8CAPv//v8AABAACQD7/wQABAD8//7/AgAFAAIAAQD8//f/9v/o/+n/6f/o/+j/8v/2//z/+//8//z/AgAEAP3/CgALAAQABwAIABEACAD7/wcACQD+//n/9v8FAAIA/P8AAAUA/v/w//n/9f/x//T/8f/x//n/AwD9//H/+P/+/wIA/v/3//X/9//z//r/CwAOAAIABQAIAAIACAD8//X/BQACAAAA+P/8//T/8f/4/+//9v/3//f//v/9//b/9f/1//P/9/////f/8f/2////AAD6/wcAAwAEAAoAAwD7/wEADQAEAAMA/P8DAAcAAADu//j/8//w/+//7f/4//n/7//0/+//+P8GAPv//v/7//z/CAABAP7/AwAFAPj/AgD4//D/+v/8//P/+P/4//X/7v/2//X/6//y//L/+//y/wEA/P/4//j/9v/+//j/9//4//3/BgD6//r/BgAMAAcADgAMAAsACQAGAA0ACgAAAPz/9f/6//7////0//X/8f/x//n//f/1//7/9v/q//r/7v/w//L/+P/3//D/AwD3//b/AAAGAA0AAQACAA8ABQAMAAwAAgAAAAEA+f/6//r/9v/9/wAA/f////f/6f/0//n/8f/q/+z//P/z/+3/8f/x//P/+/8FAAgAAAAKABAABAANAAgABgAEAP3/+f/5/wEA+//z//b/+v/z/+3/7P/1/+r////t//P/+//0//b/9f8BAPb/+P/x/+b//v/0/wUA+//0//f///8FAAcAAwD//wMA+f8JAAEA//////7/CAD8//n/AgAIAP7/AAAIAPf/9////wAA+/8CAAIAAQD+////DAAGAPr/AAALAAsA+//2//v//P/3//b///8HAAcA///8/wkABADx//T/8v/r//j/6f/q/wEA9v/4//X/+P8IAPr/AAAMAAYA+f8BAP3/+v8BAP7//v/q//f/9f/2/wAA9P/8////+P/7//v/AAAAAPf/BwAHAP3/AgAAAAMA+//8//n/+v8AAP//+//4/wkA///4//7/AwAEAP7//P8CAAMABAAEAAQA/v///wIA+P/5/wAA+f8AAP//AAD4//v/AQD4//z/7v/2//3/9//9/wUACAABAAAAEAABAAAAAQAAAAMAAgD///H/AQAGAPL/9P/8/wAAAADs/wAACAADAP//CQD///f/AgAEAP//BAD9//n//P/9/wAA/v/9//j/7//x//z/+v/+//f/BQD4//b/9/8JAAAA/P8BAAUA/f/8//r/BAAPAPj/+v///wEAAwD5/wMA//////r/+v8EAP3/+f8DAAYABQD//wAABwADAP7////+//X//P/3//n/BQD9/wAABgD4/wAA+f/0//f//P/4//P/+P/0/+3/7v/4//v/8//4//P/9P/9//L/9v/2/wEA8//w//H/+v8BAPb//f/1/wYAAQD4//n/9//9/wMA//8CAP3/BAD9//T/+f/9/wwA9//3/wAABgAEABMAFQAUAAcACAAHAAAACAABAAUA//8DAAIAAAD+//L//P/0/+f/6v/q/+//7v/1//H/8//x/+z//P/5//z/9v/6//T/9f/v/+z/8f/4//j/7P/v//r/+P/z//v/AwD4//X/BQADAPP/+/8NAAIACAACAPn///8BAP//AQD7//T/9v8BAP7/8P/+/wIA/P/+/wMA+//6/wEAAwAGAP7//v8PAAIA+//9//L/+P8DAPz/BAACAP///f/9//7///8MAAQA8//6/wcA8//x//T//v/6//L/8f8AAP//8v/v//n/+v/6//H//P/2//H/BwDy//7/AAADAPv/+P8DAAQACQAAAAAACwAFAP///f8AAPv/9P/0//j/6f/0////+v/5//z/BgDu//3/AAABAPr//P8CAPn/7//4//7//v/1//j/BwDy//n/BAD2//f///8AAAEAAwAKAAgAAAAEAAQA/v/4//n/AAD7//H/9//7//H/9v/9//n/9/////7/AgD1//n/AAD2////9//9//b/7f/2//b/8P/y//P/7f/1//r/AQAAAPj//P8CAPz/AwD9//b/DwAAAAgABgD6/w0A/f/3/wAAAAD8/wMA/f/2/wIA+//9//f/7f/5/wUA+P/r//7/AwAMAP//BQAAAAAA+P/y//j/+P/w//z/AwDx//L/8v/4//j/AQAEAAAA+v8AAAYABQAEAAUAAQD7//z/9f/6/wAA7v/2//f/5f/l/+j/AAD//wYAAAD9/w4ADwALAAUADwAIAAIA/f/8/wMA9v/o/wAA+P/4/wAA8v/0/wkABgD5//j/CwD9//n/AAD4//H/+f/4//H/9//9//H/8f///wAA+f/8/wsACwD5//T/AQAAAAUA/P/+//j/8v/+/wAAAADq//n/+f/t//T/7f/6//3//P8DAA8AEgATAAMA9/8DAPz/7f/5//P/8v/6/wIA/P/7//v/+//7//3/BgD9/wUAAwD8//z//P/5//n/8v/5/wIA//8AAPj/8f/+/wAA8f/1//z/CQDt//r/AQD0/wIA+P/+/wYABQD4//7/9P/q/wUAAADy//n/AAAAAAYAAAAGAAwAAgACAPb/9//s//n//P/7//z//P8JAAMAAwADAA0ADQD//wwAAgD8//3//f/2//n///8MAPH/AAANAPn/+f8AAAAA+f/6//j/AQADAP7/7v/2/wMAAwAEAAwABQALAAcADQD///f/9v8DAOf/7//9//j////5/wgA/f/3//3/7v/w//b/5//u//b/8/8IAPz/9/8MAAwAEAAJAAEABgAEAAAA+v/z//f//v/3/wwACgD//wAA+f8FAAoA/P/1//H/+P/w//r/AAD7/wIA/f8FAPn///8LAAoACQABAP3//P/9//T/9P/9/woAGgAXAA8ADgAQAPn////2/+T/6v/3//X/8P/5//7/BgAIAAkAAAAMAA0ABAD1//T/+//t//j/BgAMAA8ADwADAAMADwATAAAA9//1/+P/2//s//7///8BAAUABwAJAAoA/P8HABIACwACAPz/5v/p//f/AAD7//7/BgAVAB0ACwAKABIACQD0/+z/8v/7//v//f////r//P8EAAoACQD8/wAABAD0/wAA9P/t//3/9/8OABAA/f8MAAwABAAUAAoA+//5/+r/6f/i//j/+f8BABEACQAKAAQABAADAA8ACgABAPr/8v/y/+j/9v/7/wkABwAAAAgAAQAAAAcA+f8FAAUAAAD5/wAABwAHAAMA/f8DAO7/6f8DAAMA9v/p//v/AwD+/wwAFAAYAA0ABgD3//b/AQD///j/6f/s/+r/6//3/wYADgAGAA0ADgAGAA8ABwAGAAQAAAD5//n/+f/0//n/9f/2/wYAFwAWAP3/9f/+//X/9P/0/+3/AAACAAUAGQATAA8ABwD4//3/+//z/+3/6//1//X/8f/1/xsAHgAcABgADwD8//7/EAAEAPX/7P/j/9X/5f/6//7/AAAJAAkAAAAGAP7/BAADAAgAAAD2/wMA+P/7/wQADgASABEACgAFAAsA/P/y//7/7f/q/+T/4P8KACAADgAPAAcABgD9/wEA///0/+r/6//q/+n/7f8OACEAJAAfABcAGAASAA8AAQD//+3/3P/Y/9r/5f/5/wUACQAKAAIADgD+//f/+v/+//T/6v/n//D/+//9/xYAHQAiACkAHwAVAAcA/v/l/+b/7P/p/+D/6/8DAA8AHAAiABMACgAGAPz/4//p/+f/6f/Z/9j/BwAPACMAJwAhACAAEgAAAAIA/v/z/+r/4f/s/+H/8P/+/wwAHwAdABsADAAAAPH/8//o/+j/7f/g/+f/7f/4/yEALQArACYAJQAZAA0A9P/3/97/1f/W/8z/7f8CABYAKAAiACAAEQAGAPv/8P/t/+f/3//h/+//BQAVACgAJgAcAAgACwD6/+//5//d/+b/3v/h/+7/CAAjACQAGwAbABQAEAD2//L/7f/s/+n/2v/f/+T/7v8GABMAKQArACgAJQAlAAoA//8AAN//0v/V/87/8P8LAAoAFAAYAB0ACAD2//X/6v/u/+L/3P/q/wQAEgAuADYAJgAoABwACAD7/+f/3v/a/9X/z//c/+3/9/8FABkAKAApACcADgACAP3/+P/t/+b/6//i/+P/6v/2/w8AEgAaACcACgAfACIAEQD4/wIA6v/b/+b/7P/3/wgADAAAAAcADAABAPb/+P/b/+H/5f/p//n/DAAkACkANQAkAB4ADwADAP7/+f/u/+T/1v/Y/97/7//6//3/BwAKABkABQAMABIACQAKAAAA/v/7//H/7P/z//P/5//8/wwABQAIAB8AIAAkAA0A/v8BAPf//P/6//L/5P/X/+z/8//5//L/9P///wIAAwAFABoAFQAVABsABAD9//z//P8RAPz/AgACAPv/+v/y/+v/9v/+/+n/9f8DAAsA/v/w/wwABgAOAAAAAQAVAAkADQD8//H/5//e/+H/5/8AAA0ADAAVADEANgAYABIADQAHAP//7f/O/9r/6f/c/+X/8P/6/wEABAAVAA0AGwAhABsADgADAPP/6v/s/wAACQAAAPT/+f/5///////1//X/8//q/+r//f8FABYADgACAAsAGgAWABUADgALAPr/7//e/+D/7f/r/+7/9f8AAAsAAAAeAC0AHgARAA0A/P/j/+r/9v/u/+//7v/q//j/CQAWABgADgAOABoAFAD+//z/+//z//r/+//8/wMA9/8EAAMAAQAAAOL/8f/i/+L/7v/z//7/CAAFABYAJwAdACAAHwAbAAoA9//t/+X/3P/l/+f/4//p//H/CgANAB4ALQAfAA8AEAAFAAgA8P/u/+z/6P/w/+v/8f8BABIACQAYAA8ABwD5/+7/DwAEAAQABAD+/wQABAD+//3/AQDy/+n/5P/m/+3/8f/z/woADgD9/w4AGAAcACMAIQAXAP//+//3//T/5P/q/+H/5v/p//f/BwARAB4ACgAUAP//+v8aAA4A+P/9/wQA9//x//j///8GAAAADQAGAPf//f/8//T/7f/1/wAA9f8FAA4AGgAbABgACQADAAAA/v/t/+D/5v/p/+P/8P8AAP3/AAAFABgAIAAGAAQACQD///3/8//y//X/6P/t/wQABwAUAB0ADAAMAAsADQALAAIA/f/0/+n/6f/0//3/+P/5/wEAEAAQAPn/9P8BAAAABgAFAP//9//4////+f8BAAEADgAPAAQAAwACAAEA+v/5//L/6//v////BgAHAAEAAgADAAMA/P/7/wAABgD3//b/+P/x//j/+f8HAAIABAAFAAYAFQAKABEAEwD+//z/9P/5/+7/7f/0//L/AAAJAAMAAQACAAoAGAAYAP//BAADAPv/8//k//X/9f/n/+z/+/8DAAQABQANAAYABgATAA8ABwAGAAkA8v/z/wEA8v/v//j/+P8GAAAA+v/2//3/AwD1/wkACQD0//v//P8CAAIACgADAAQADgAHAAcAAAAAAP//9//3//7/BQDx/wAAAAAOABIA/v/3//7/BAADAPz/AQD6/+X//v/3//j/+f/9//f//v8TAA8ADgAOAPz/AgD0//f/9//p/wUADQAAAAcAAAAAAAAADgD2/wAAAAD4//H/+P8CAPz/AgADAAMABwAAAPn/AAAAAAAABgD5//n/BgD5/wAAAAAAAAYAAAD5/wAABgAGAAYA+f/y/wAADQAAAPn/AAAGAAAABgADAPz/AwDu/wAABgD5/wAA+f/r/wMAAwD8/woADQAGAAAABgAGAAMA/P8CAPz/7v/5//n/8v8DAAYA+f8AAAYABgAGAA0AAgD8//z//P/y//n/AAAAAAYA6//r//z/AwADAAIAAgAJABAAFAAQAAoABgANAAYAAwADAPX/7v/y//L/7v/n/+D/6//5/wAABgAAAAAAGwAQAAMAEAANAA0AAgADAPz/9f/1/wYA/P/y//L/AAAAAPX//P8KAA0AAAAGABQACQD8/wIACQAGAPL/7v/u/+v/7v/r//L/7v/1/wIACgAXABQAIgAYABcAFAAYAA0A/P8DAO7/7v/2/+D/5f/r/+j/6//5//n/+f8DAAkADQAbABcAFAAGAAkACgADAAMA/P/1/+7/+f/5/+v/9f8CAAIA/P/8/woACgAGABQACgAKAAoAAADy//X//P/8/+f/4P/u/+7/8v/8//z/AwAXABQABgAbABcAHwAbABEACQAJAO7//P/8/+f/4P/n/+f/4P/r/+f//P8KAAoADQAbABgADgAfABsAAAD+//7/9f/m/+L/7P/l//D/8v/1/wAAAgAEABQAGAASABkAFAAMAAoAEgAMAO7/6P/1/+3/4v/p/+f/6P/r//j/CwARABQAFQAhAB4AIQAcABMAEQAEAAEA///n/97/2v/S/93/5f/u/+3/8P8HAAoAFAAkACwAIgAbABoAFQABAP///P/r/97/3//o/+H/2v/o//H/+v8DAP////8WABwAFQAsABYAAAAdABMACwD7/+v/8P/l/+f/6//i//L/9P/0//b/GwAVABMAGgATABwAEwAUAA4A9v/m/+7/8//j/+f/4P/i//3////7/wUADwAfAB4AFQAVABgAEAAAAP7/AQDw/+r/5//o/+D/4//q/+//+P/s//r//f8GABcAGQAeABsAIgAWABwAFgAJAAAA/f/s/+P/+v/k/9f/6//3/wAA/f8GABAADwAVAAcAFAAHAAQACQACAOz/4P/p/+n/7P/u//b/+f///wEAAwANABkAGwAXAB4AGgAYABUA/v/7/wAA6P/i/9n/2f/g/+H/5v/z//b//P8NAAgAFQAlABUAFQAbAA8AFAAOAP3/+v/3/+7/8P/2/+7//f/w/+v/8f/z/wQABgAIAB8AHQAIABIAHAAFAP3/AAD+/+z/5v/e/+L/5f/j/+z/8//+/w4AJgAkACIAHgAdABwAFgAMAPX/+f/e/9v/6//j/+b/4P/l//L//P/x/wIAGgAWABEADgAcABwAEAAGAAsADgAHAP7/7f/r/+r/7f/t/+//5v/p//f/AAADAA0ADwAbABwAGAAoABwAFgACAPH/7//p/+D/3v/l/+z/8f/y//z/BAAGAAIAEgAiAB8AFQAXAA8AAwABAOr/8v/x/+//8f/r/+3/+f/6/wMABQAHAAgA/P8RABcABQALAP3/AQAGAPb/9P8AAPn/+P/4//H/8v/w//L/+/8EAAAACQAKABkAIQAdABIAEwAKAAgA+//y/+z/8f/b/97/4f/i/+7/7P/v//X/EwAOACEAIwALABkAHAAYAAEABgALAPj/8v/w/+//6v/j//X//f/3//L/AQADAAYADwAJAAoADQANAAQAEAABAP7//P/7//n/6v/x//H/+v/q//P/AgD+/wMABQAVACAADwAdABgAFwAUAAsAAQD4/+j/4v/o/93/1v/e/+f/9P/2//L///8kACMAGgAiABcAGgAZAAwACQAAAP7/3//d/+z/6P/o/+z/7f/2/+7///8HABEAEwARABIAFgAcAAcACQAUAAUA8//q/+//8P/o/+n/7v/3/+//BwAJAAwAGQATABcAFQAXABUACAD//wIA8v/p/+//4P/a/97/5//p//D/8/8AABEAEwAmACAAJgAiABIAIQAQAP///P/y/+H/2P/i/9v/2f/l/+v/AAADABQAFAAdABsAIAAgABQAEwANABEA8v/o/+j/5v/h/+P/6v/o//D/6P8AAAkADwAZAB8AIAAeAB4AFgAUAA0AAwDz/+f/6//V/9j/3P/d/+//7v/y/wAACgATAB8AIAAcACUAJgAZABIACAD3//T/1v/X/+H/2//Y/+L/7P/z//7/+v8ZACoAGgApACgAMgAhAAYAAgD4//T/4//d/97/3f/W/+L/7//r//n/AwAUAB8AJQAnACEAIAAmABYACQD5//L/9v/e/9//4P/c/+P/7//x//P//f8IABIAHAAiACAAGAATABoACAD//+z/7//m/+H/6P/W/+L/9v/v//P/BAALAA4AIgAtADAAJAAbABQAFAAIAPf/7P/i/9X/1//Q/9X/1P/i//H/+f8EAB0ALgAjAC8AOgAyACUAEwATAP7/8v/u/9X/1v/e/9T/zf/a/+7/+v8EAA8ADAAlAB0AJgAjAB8AGQAQAAkA///0/9//3//k/97/4f/d/93//P////z/BwAZACcAIQAkACsAGwAQAAkABAD7//D/5v/k/9n/2f/U/9r/6P/z//j/EQAOAB8ALwAzADYAIwAjAA0ABQAGAN//3v/U/9X/2P/S/9j/3P/1//r/BgAgACEAJAA0ADEAJQAfABsAEwD3/+T/4//Y/9n/2P/b/9z/2//7/wsA//8IABoADwAbACcAEgAfAB4AFAAEAPv/9//0/+r/7P/x/9j/3P/k/+b/8//s//T/FgAgAB8AGQAdACsAJQAYABQAAQD+/+v/2v/Q/9P/1//d/+D/8/8GAAQACQAbACUALQA3ACsAHQASAAYA+v/Z/+b/1f/W/9n/2v/c/93/9v8BAA0AHwAYADAAJgAjAB4AEQAUAAoA/P/u/+v/4v/d/93/5//s/+7/+//2/wYACAADAAsAFwAJABEAFwANABIADQALAAkA9v/0//r/5v/l/+//4//v//H/9P/6/xkAEQATABwAGAAeABkAEwACAPf/+//i/9z/3v/T/+L/5//g/wAACgAHABEAHwArAC8AIQAfAA4ABAAOAP3/8v/p/+D/2f/g/+n/5//q////DwAKAA8AEAAYABQABQAEAPz/AAANAPD/9v8DAPb//f/v//r/DwD///////8AAAAABgAHAAAABwAFAAwADAACAPn/9/8EAPz/+//z/+7/7f/p//D/7f/u//7/AwAPABEAHQAeABQADQAPABcABwD3//T/8v/t/9//4//h//H/AQD3/woAFwAYAA4ADgAUAA4ABAD7//L/9//k/9n//P/2//H//v8AAAgADgAhABQAFAAXAA4AEAAHAPj/9v/0/+b/6f/w/+b/7//z//X/BAD/////CQASABIAAAAAAAUACwAFAP//AwADAP3//v8EAP7/9//z//n/8v/7//v/AQDz//P/BAAIABAAAgAKAA8AAQAJAAwABQAEAP3/9f/7/+n/6P/r//L/AwD3//j/BgAcAAwAFAAXABQADAAIAA0A+P/w//b/6//r//L/6P/t/+7/+v8PAAkABgAGABoAFgAHAAYA+//6/wcA+f/z//r/+//x//n/8//3//7//v8LAAMAAwAKAAYA+f8AABQABgACAAIA/P8DAPX//P8DAPX/+f/y/+f/AwD1//L/+P8AAAYAAAANAA0ACQAYAA0AFAAbAA0ACgADAPz/9f/g/+D/5//q/+r/9f/8//n/AAAGAAYAFAAYABQAFAAUAAYAAADy//j/8f/1/+f/5//1//X/9f/5/xQACgD8/xEAEQAMAA0AAgADAAkAAgD8//z/AwD8//X/9f/u//L/+f/8//z/9f/1/wYAAAAAAAYACgADAAMAFwANAA0AAwAJABAABgD5//L/5//n/wAA6//1//z//P/8/wMAEAAKAA0ADQAAAAYACgADAPX//P/1//L/6//u//X/AAAAAA0AAwACABEAGAANAPz/CgARAAAAAAD5/+7/5//r/wAA+f/1//b//P8CAPz/AwAJAAkAAgADAAwAAAAAAPj/DQANAAIAAwAKAAIA/P/8/wMABgDr//X//P/n//L/9f/1//X/AgAKAAIACQAJAAMADQAXABEAAwAAAPn/9f/8/+7/8v/y//X/9f/8/wMAEAAQAAYABgAAAAYAEAAKAPz/5//5/wAA+f/y//n//P/u/wkAAwACAAkA/P8JAAYAAAD5/wAAAADu//3/AgACAAMACQAGAAYADAAKAAIAAgAKAPn/7v/1//X/8v/y//X//P8KAPz/CgAKAAYADQAKAPz//P8CAPz/6//y//n//P8DAAIAAwADAAMABgANAAYAAwAKAAMA/P8DAPX/9f/y/+v//P8CAAMA/P8JAAYAAAAGAA0AAgAJAPX/9f/5/+v/9f/8/wMA/P8DAAMAFwAUAAYA+f8RABQAAAD4//n/9v/u//X/+f/y/wAA+f/2/wkAAwADAA0ADQAGAAMA9f/5/wAA6//1//z//P8DAAMAAwAJAA0AAAAAAAYADQAAAAAACQD8//X/8v/y//n/AwAGAAAABgAGAPn/AAAGAAAAAADy//L/7v/y//n/AAAGAAYAFAAKAAkADQAUABsAGAADAPz//P/1/+v/5P/u/+v/5//1//z/AwD8/wMAEAAJAAwAEwAJAP3//f/9//z/9v/y//j/+f/5//z/AwAKAAYABgAGAAAABgACAAMA9f/8/wAAAAAAAPn/AAAAAAAA+f/5/wAA+f8DAPz/9f/1/wAACgACAPX/AAAQABEABgAGAA0AEAAKAA0ADQDy//L/8v/1/+f/8v/5/+7//P8CAPz/AwACABcADQANAAoACgADAPz/9f/1//z/8v/q//X//f/8//z/AwACAAIACQARAAUAAAAGAAYABgD5/wYAAwD8/wIA9f/5/wAAAAD5//n/+f/u//z//P/y/wAAAAAGAAYAAAANAAkAEAANABQAFAAJAPn/AAAGAPn/8v/u/+7/9f/5//L/AAAAAAAAAAD5/wYABgAAAPL//P/8/wMA/P/1/wMAAwADAAMAAwAKAAYABgAGAA0AAwD1/wMA/P8DAP3/9v/8/wMA9f/5/wAA+f8AAAYA+P8AAAAA8v/u//z/CQD8/wMA9f/8/wkACQACABEADQAGABAAAgAQAAYA+f/5/+v//P8DAPX/9f/8//z/AwD1//z/AgD8//n/8v/5//n/9f/8//z/+f8AAAYABgAKABEAAwADAAkADQANAAkA/P/1//X/+f/y//L/AgAGAAAAAAAAAPn/BgANAAYAAAD5/+r/9f/1//z//f8AAAAAAAAGAAYAAwAKAAoAFAAGAAAABgAKAPz//P8DAPX/7v/y/wAAAAAAAAAAAAAAAPj/BgAGAPH/+P8AAAAA9f/8/wMA/P8DAAoACgAGAAAABgAGAPn/AAAGAPL/+f8AAAAAAAAAAAAA+f8GAAYABgAGAAkAAgD1/+7/8v8AAPL/7v/8//z//P8KAAMACgADAAMADQAAAAwADAACAAIAAwD8//b/9f/1//H/+f/5/wAADQAAAPn/BgAAAPn/AAAAAAAAAAAAAPL//P8DAPz/9f/8/wMAAwAJAAoADQAGAPL/AAAAAO7/AwADAAoAAAAGAA0AAAAAAAYAAwAJAPz/9f8DAPz/7v/5//n/+f/y/wMACgAAAAAAAAAGAAAADQAAAAAABgD8//n/+f8GAPn/+f/4/wYABQAGAAAABgACAP3//P/8/wAAAAAAAPn/+f/5//n//P8DAPz//P8CAAoAAwACAAYAAAAAAPn//P8CAA0AAAAAAAAAAAAGAAAAAAAAAA0AAwACAAMA9f/u/wAA+f/y//X/9f8CAAIAAwAXAPn/9f8KAA0A+f8AAA0ABgD5/wAABgD5//n/BgD5//L/DQAAAPn/DQAAAAAA+f8AAAAA+P8AAAAA+f/4/wIA/f/1/wMAAgACABAABgD5/wAABgAAAAAAAAD5/wAAAAAAAPn/BgAGAAYABgACAPz/AgD8/+7/+f8AAPn/+f/1//z/AwADABEABgAAAPn/AAAGAA0AAwD8/wIA9f/5/wAA+f/5/wAA+f8AAPn/AgAGAAAABgAAAAYAAAD5/wAABgAAAAAABgAAAPL/8v8GAAYA+f8AAAAABgAAAPn/+P8GAAAA+P8AAPj/AAAGAPn//P8GAA0ABgD5/wAADQADAPX/+f/5/wAADQD5//n/AAD5/wYAAAAAAAAA+f8AAAAA+f8GAAYA+f8GAAAA6/8GAAYABgAGAPn/AAAGAAkAAwD8//z/AwD8//z//P/1//z/+f/5/wAA+f8AAAAAAAAGAPn/+f8AAAAABgAGAAAA+f8GAAYA+f8AAA0AAAAAAAYA/f/9/wMA/P/8//n/AAD5//n/+f/5//z//P8CAPz/AwAKAAIACQAGAAYADQAAAAAAAAAAAAIA/P/8//z/AgD8//X/+f8AAPL/9f8KAA0A+f8AAAYABgAAAPn/AAAAAPn/AAAAAAYABgAGAAMA/P/8/wMA8v/y/wYA+f/5/wAAAAAGAA0AAAD5/wAAAAANAAMA/P/y//n/BgAGAAAA+f8AAPn/+f8GAAAA+f8AAAwABgD5/wYAAADy//n/BgAAAPn/BgAAAPn/+f8AAAYABgAAAPn/AAAAAPn/+f8GAPX//P8DAPz/AwAKAPz/AgADAAMADQAGAAYAAAAAAAoAAwDu/wIA/P/y//n/8v8AAAYAAAD5/wAAAAAAAAYABgAAAAAABgD5//n/+f8AAAAAAAAGAAAABgD5//j/BgAFAAAAAAAAAAYAAAD5//n/BgD4//n/AAAGAAYA+f/5/w0ADQD5//n/AAAAAPn/8v8GAAYA+f/5//z/AgANAAAAAAAAAAAABgD5/wYAAAAAAAAA+f/5/wAABgD5/wAADQAAAPn/AAD5/wAAAAD5/wYABgAAAPn/+f8AAAYABgD5//n/DQAAAAAAAAD5//n/DQAAAPn/BgAAAAYABgD4/wAAAAD5/wYAAADy/wAA+f/8/w0A+P/2/wMACQAAAAAAAAAAAPn/BgAUAAAAAAAAAPn/+f8GAAAA+f/5/wAABgAAAAYA+f8NAAMA+f8GAAoA9f/y/wYABgD5//L/AAAAAPL/9f8CAAoAAgADAA0A+f/5/wAABgAGAAYABgAAAAMACgD8/wMA9f/u/wAA+f/5/wYAAADy/+7/AwACAPb/AwAXAAAA/P8UAAYAAAAAABAAAgACAP3/9v/8/+7/8v/y//z/AwAKAAAA9f8CAAkABgAGAAYA+f/5/w0AAAAAAAAAAAD5/wAAAAD5//n//P8DAAYAAAD5/wAAAAAAAAAABgAGAAAABgAGAPz/+f8AAAAAAAD5/wAAAAAAAAAA+f8AAAAABgD5/wAAAAAAAAAA+f/5//z/AgD8/wMAEAAAAPj/BgAFAAAABgD5//n/BgAAAPj/BgAMAPz/AAAJAPz/9f/8/+v/+f8GAAAA8v/8/wIACgAAAO7/AwAJAPz/9f/8/xEACQD8/wkABgAAAAYA+f8NABAAAwD1/wMAAwD8//z//P/1//X/AAD5//n/6/8DAAMA/P8QAPn/AwANAAAA+f8AAAYABgAAAAAAAAD5/wYADQD8//z//P8DAAIA9v8DAP3/6v8AAAAA+f/5//3//P/8/wIA/f/8/xcADQAAAAAABgAQAAoAAgDu//X//P/r/wAAAADy//X/AwACAAIAEQAGAAYAFAD8/wIACQDu//z/9f/y//L/9f/8/woA/P8CAAMA/P8KAA0AAAAGAAYAAAAGAAAAAwACAPz//P/1//L/+f/5//z/BgAAAAAAAAAAAAAAAAAGAA0ACQADAPz//f/1//n/+f/4/wAA8v8DAAYA+f8AABQABgAAAAYACgAKAAMA9f/1//z/AgD1//X/BgD5//n/+f8GAAAAAAD5//L/AwD8//z//P8DAAIA/P8KAAMA/P8DAAkACgANAAYAAADy/wYADQD8//z//P8AAAkAAgD8/wMAAgD8//X/7v/5//n/AAD5//n//P8CAAMA/P8CAAIACgAAAAAAAAAGAAYA+f8AAAAA+P8GAPn/AAATAAoAEAD8//X/AwADAPX/7v/5//n/8v/8/wYA+f/1//z/EAANAPn/BgD5//n//P/8//X/AgD8/wMACgAQAAAADQAbAAkABgAAAPL/AAAAAPn/7v/1//z/6//n/+7//P/5/wAABgANAAoAEAAUAAAAAAAAAAAABgAAAAAADQD8//z/CgADAOf/AAAAAAAA+f/4/wAA6v8DAAMAAgACAAYABgAAAAAABgD5//L/9f/u//n/+f8AAA0ADQAJABEAFAAXABEABgAGAAAA+f/y//L/7v/n/+v/9f/1/+7/AAAGAAYABgANAAoAGAAUAAoACgD8//z//P/1//z/7v/5//n/8v8CAAYA+f/8/wkA/P8DAAIABgAGAAAADQACAPz/AwD1/wMAAwD1//L/+f/y//z/9f/1/wIA/P/4/wYAEAAPAAwABQAUABAA/P8DAAYA+f/y/+7//P/1//n/+f/5/wAA+f8GAAYAAAANAAIA/P/8//z/AADr//L//P/u/+7/AAAGAAAADQAUABEAFAAUAAIAAwD8/wMACgD1/+f//P8DAOv/5/8KAAAA9f/8//z/CgAKAAMAAwAGAAYAAAD5/wYA+f/y/wYABgAAAA0ABgD5/wAAAAAJAAMA7v8AAAAA8v8AAAUAAAAGAAAABgAAAAAAAwADAPz/7v/y//n//P/1/wMA/P/8/wMAAwAKAAoADQAGAAAAAAD5/wYAAAD5//L//P/8//z/9f8KAAoADQAGAAYAEQARAAAA9f/1/+7/5//5//X/7v8CAPz/AAAKABEAEQAUAAMACgAKAA0AAADy//L/9f/u/+v/+f8AAPn/AwD1/wIAEAANAA0AAAD5//f/8f/0//v/9f/4/w0AAwD6/wcACwALAAsABwAGAAAABQD//wUA9//w/wUABgAAAPn/AAAOAAQA/v/9//3/AwDu//H/+P8FAOr/9P8WAAUA+P/4/w0ABwAAAA4ACwAEAAQAAwADAPX/7v/0//D/8P/0//v/+/8CAPX/+f8OABIAGQAPAAcAEQAKAO7/9P/7//L/6P/v/+j/5f/6/wIA+//9/wMAAAAAAPn/8v/+//j/9//9//L/8v/6/wgA/P8DABIAEAAXABQAEwAPAP3/8f/w//b/5//g/+j/9v/0//X/+v8BAPr/+v8PAAsACwANABMAAQAHAPn/+f///wEA9P/2//7//f8NAOn////z//P/BgD3/+X/8v/4//L/+f/z//r/AgAKAAgABwAWAPT/5//0//r/7f/p//j/4f/t//r/AQAEAAoACgAQAAcAFQAVAAcA///1//T/5f/w/97/5P/h/+n/6v/m/wAAAAABAAcAIQALAAkADQAFABAAAAABAPn/8//t//X/7v/r/+z/7//2//3/9f/t/+//9//8//z/AwAHABAADAANAAsAAAD4/wEABwD5/9v/7f/l/+3/2v8AAOn/7f8DABMAHgAOABEADgAFACUACQAEAAQABADq/+L/3f/h/+D/6f/s//P/9P/7//3/CgA1AAcABwDv/xIACgD+////6f/t//z/+v/w//j/NQDq/9b/4f8FAOv/8//6/woADQDm/w0AAwA7ASoAa//t/8z/tf8P/9n/d////5H/8f9lAC0Alv8bAFsAIgBKAC4AUgAjAO7/iADIAAgAdwBY/6T/pP+G/8X/FQCT/7X/dQDV/0MAOAA/ALsAkwC1/30AiP9X/+n/hwDG/8r/u/+R/+D/dP+1/5UALQDd/yAAAADk//r/6v9yAGwA3P8iALn/n/9G/67/4v/8/+z/zQA8AM3/8f+Y/+X/2P///ywAawD3/+z/aQB+/9f/9/+s/+D/5//g/+n/DwBh/+3/tv/u/yUAPgBHAE4AMgAAAD8AdQA7ACYAVgDn/8z/AwCk/yEAOgB6/+j/zf85/2X/t//o/o7+0P7Z/XT9FP7t/sr/1QCfAVACRgN4AzwDFQMAAzsCcgE6AYkAnv/5/sL/o/7e/g7/bP5o/oX+S/7y/ar9bP0w/QH9kvxf/Cr9zP1g/v7/rQEMA1YEHQWeBa4FMQVdBIEDYAItAVkAfP89/xX/2f5J/wgAMAAnABYAzf9z/6v+3f1d/RP90/wW/Bv8NfwJ/IX7E/y9/IP9w/6iAHUCMQSUBaAGqwZjBqQFbgTyAmgBRAA1/4n+jv6U/rr+Vf8WAJkAsACCAFMA6f/m/gj+Wf36/Bz8Jvv7+rv6Svqe+oP7fvxz/hsA/wHWA3AFdwazBpAGCQYQBc4DeQImAQcAK//J/mX+jP4s/7//ZADHAO0AAwHEAAcAOv+R/v79OP1f/BD8pfv7+l37Nvuo+7P8QP7V/zUB8AJvBF4FLwYyBt4FTQVaBDYD4AGNAGf/hP75/Xn9jf0k/sn+kv8mAOgAOAELAacAJQB0/8z+IP4Y/Un88/tE+1z7KPtv+4H84P2U/wABjAL8A/gE1gXHBXoFDAVfBFoDGQL/AOH/Mf+w/j3+Qf6j/hn/m//i/20AmABMAPT/jP8r/7v+Qf6v/TH9Bf0y/Cf84PvM+5H8Yv26/lUAqgHbAt8DyQRLBVYFrQRFBFsDhwJeAUQAgv8Z/7r+bv69/jP/vv8IADoApABqAO//iP8R/6L+O/7z/XD99/xz/Cz86vvk+wz85PzM/YX/IQEsAj4DXwQXBWgFYQWsBDUEQAN+AkYBFwBp/wP/tP5x/sX+PP/R/yIATQCkAGUA+f91//H+QP60/VX92Pwt/ML7pvuG++/7e/x6/Qz/FwESAwcEzASWBTAGSwaXBWMEbQNlAkwB3P9q/rz9sP3C/QX+df6H/7gAZAGcAYwBIQFNAG//mP6n/Rz9o/wX/H77IfsU+zP7Svvf+0j9bP+9AWkDHgS6BJwFZQZ3BnQFBwTgAhMCLAGk/zP+sP3l/XH+3v5I/1EAVQEMAioCewF4AHf/sP7c/eb8PPzO+477S/sq+z/7Ufup+7383v5OAf4CDQS5BLQFbAaHBrUFSAQgAzECWgEDAMv+//39/Vb+uv7M/lf/pADwAWAC+gEeAScAeP/L/r39p/wL/Kv7Vvv++tX6zvrs+rn7oP0yAEsCqgOYBKIF1gZgB7EGLwW1A5ECZwHa/3j+n/2C/fX9cP65/jD/dgAHAtkCqwLkAcYAr//Y/tX9qfzr+3v7Uvs3+y77+vrL+iT7ofyT/zUCpgM2BNcECgY8ByAHkwWsA3ICvwF1ANn+eP3i/Dj95/1u/qn+pP9zATIDpgPaAqABVwAr/yb++/zw+3D7fvu9+9P7gPsG+6b6MPtS/eYAkANgBGcEDwWuBpQH3waiBJkC0AFOAf3/Ff7l/P386f3d/kf/Sf9kAFgC7wPDAz0C4ADo/zr///2M/IX7YvvA++f7xftJ+836gfpI+6X9CgGZA1EEpgSrBUwH9AfJBoUErwLxARYBYP9v/ZD86fzc/cH+Mv+I/8wAjgKXAxADpwGhAL7/xP5o/SP8cvuM+/n73/u++537dPsE+5b77P3sAJMDXASuBKgFQAf+B8cGpwTDAusBEgE8/z39Y/zK/Jv97f1s/k//KwHLAnED2wLDAR4BMwDU/jX9Cfym+7/72vuR++37VvxL/G77IftH/QUBjgP9A8wDaAWaB0cItQZ+BB4DewJ4ATb/X/0b/dL9ZP4t/mb+v/+qAeoCAAPbAmgCfgH2/1z+EP0w/Jn7PPtU+4D7BPyr/MD8m/ui+pj7GP9hAiIDwwLbA6UG3AekBpUEvAN7A2gC8f/B/ZP9Nv47/rL9yv1b/ykB/wENApUCZwO/AqsAwP4d/pP9fvx6+2b77/tT/KD8Av3Z/PT7Qftc/Nr/twIHA+0ClwQ3B9YHMwZ6BAcEpAPoAS3/fP3C/Tn+sP1l/XD+HwBBAaIBAAIMA4IDxAF7/7P+iv5f/aD7YPth/OT8YPw3/PL85vx5+3n6N/wEAA4CzwGIAqAFCwhtB3IFGAV7BdQDtwCx/ov+e/5I/a787/2o/00AfgBeAbICaAOjArwAjv+C/8b+5vyh+xb86PyU/PP7avyA/XT9Pfwk+7j7Bf6NAKEBUwKrBB8HugegBgsG9AWaBCsCBAAW/2/+aP2i/FL9sP5Y/77/7QA5AuoC9wJMAhEBCAAV/8P9hvwC/BX8T/w//Gv8/fxb/dD80/vl+uD7rf7ZAD4ByALRBWkHDwdfBnoGtgWvA5MB7/+n/pv9yvzp/NH9xP5i/7EA8gGcAt4C3wL+AXYAWf9T/h39Jvzj+yj8bvyI/On8dP12/en82vvv+uT7i/7PAEgB/wLiBWAHAQeIBvwGHgbDA6MBZAD7/l/9e/y+/LD9R/70/oAA1gFPArQCQAOXAhAB8v/L/mX9Kvwo/CD8B/w0/Oz8bf0//ff8S/z1+pL7QP5gAB4BCwNCBY4GgAb9BucGtAWnAyUCvgDy/pb9Y/1g/cH9Rv46/4UAfAH0AWoCEgNLAvAAGQD+/mr9Zvwc/Mz77fuL/DH9rv0R/jP+q/09/Ob77/2w/34A8wFKBOgFIwYFB4sHkgavBDMDrgF1/6X9GP2s/B/8/vwY/lD/VQB7AWwCDQPzAt4B9wDS/4n+Uf28/FH8a/yh/O78Yv30/Qj+0P2D/Tf8cPw9/kX/9f+0Ae8DxARoBY0GkAZLBQgE0gLpAB//Dv6g/dX88PwG/sD+iv+3AJgBKgLyAqgC0wH/ANv/ov51/c78SPx6/KT81fxj/QH+Jv7u/d/9qPxh/OP9Lv/O/1cBnAPEBGsFTwa4BqIFSwQJA1cBk/9j/uz9RP05/Rj+u/6M/6EAdAHFAakC4AL4AU8BewBB/wD+N/2X/ID8vPzL/Cj9y/0i/uL95f0r/QP8u/x1/lb/SACBAlEEFQX4BckGWAYRBe4DKgJkANr+CP5d/eX8hP0y/uj+LABBAaQBNAKTAukBDAF5ABf/B/5u/ZT8afy2/Ov8XP2v/SL+Uf4u/gL+IP1x/I/9/f7P/2gBdQOnBIAFWQaIBsoFHgXCA4gBzP8N/xb+EP0j/aP9GP7o/goACAGIAf0BRwLdAQ8BZQBe/yf+sP3p/Kf8uPzY/HH9v/3a/WP+NP66/Zf9evyh/Hr+Pf+2ABcDhASaBb8G/gZxBuYFpwR/ArsAQf8Q/j79p/zK/JP9HP45/5gAYgHjAXUCcQKzAekAEwC6/tT9Mf3T/Nz86Pxs/f39Df5i/qH+/f13/bf8v/vS/Db+8v4UAVEDiQTjBf0G9QZUBqUFIgT1AZgA8P69/W39+Pw3/SH+yP65/+AAegGoAVQCQAIdAYMAoP8y/mH98vy9/Nf8H/10/d/9U/5c/mv+Ev6P/cD8cPxL/Tn+b/8NAcQCIwRHBQoGQwYRBkwFVgS3AjYB4P9g/gT+kv1X/RP+i/6Q/0wAkAHkAecBcgJoAU8A6/+b/lH99fyG/GD8zvwc/Wn9N/4t/j/+SP7D/Rn9YPwj/b794f7JAP0BwQNlBTsG+QYSB1wGpgX+AxsCswDG/vP9Rf2t/GH91f2h/oD/yACbAcQBrQLQAdgAkgDz/rz9Yv0z/CX8gvxZ/PL8s/3o/Sv+mf7E/ZH9pfxa/H/9FP7a/2QBBQPfBDYGsAYqB7kGHAYZBTkD2gEtAKb+MP5T/UD90v0y/gD/z//oAFwBkQFQAlQBhwBeAIT+0f06/Rj8V/xQ/EX8Av2W/bD9c/42/vP9a/32/HH90f0w/1wAsAGjAwAF7wXbBuQGjAZIBpcEKgPRAfP/z/4W/hL9PP2P/eT9wP66/wQBKgEeAlwCQQEfAQEAVf5N/vX8Z/zR/C38k/xG/RX9qP3X/WT9X/2C/NT7p/y0/F/+y/8+AcUDIQUbBsoHgAdEBw8H1wSWAyQC5f8c//X9Qf23/dr9FP71/pH/fwCvAC4BiAGXAIAAcv8i/hz+7PyT/AT9Zvz9/JP9bP0q/j3+9f04/jL9zvxk/V79Dv4YALsAvAK9BN0E/QYmB4sGMwdKBSAE9gKyAND/lP55/bn9nP3A/XP+J//G/98AFAF/AT8BegDw/0D/Fv7p/Uj9Cf1M/QX9ef2x/af9+P3B/Yv9dP06/LX8ZP0g/T//fgBPATkE4wQbBlgHqAbQBsMFCQTtAhIBn/+t/sn9kf1v/W/9F/7H/oz/PACwADkBHQG6AHkAqf/7/on+5f2q/Yn9SP1M/cT9mf37/ST+/f1W/ob9g/1M/nb9Cf9BALAAVgNKBBUFxQbBBqgGngZXBR8E1wLvAJT/eP45/cv8sPzV/Cn9zP3k/lX/NgCUAMYA8QBJAAMAef+e/lz+5P2H/cn9yv2x/er9B/7u/R/+I/7X/XT9ov39/d/9h/97AKcB5QOeBKoFzgaXBlkGDAZYBEYD2wHZ/yv/+f3o/AP9uvzt/KL9Iv4Q/8n/NwCIAMcALAAJAH3/w/7g/vz9CP4Y/sn9A/7h/fT9Bf7m/f799P3A/eT9MP4t/n7/lgAzAXADKgTMBDcG9AXVBeQFZgSCA3UCxAAAABb/1/3N/Xv9Rf3r/UP+5v6h/yEAmgDfAMMAcAAMAGH/Ff+O/vv9Hv6o/az9pf1e/aT9df2i/bj9tf2n/en9IP5b/sz/iQCiAZMDHAQwBUQG+gU4BtkFaQSnA1cCzAALAMr++P3U/Un9Lv3L/QL+jP4n/6b/IwA3AD4ABgCv/2n/5/53/kP+1f3K/Yv9WP2X/Xf9xv3n/ev9/f04/jD+oP5Z/zAAFwGLAoMDjgTLBeAFQAYPBl4FtQR6A00CMAEKAA7/SP63/WD9Nf1Q/bX93f1F/tz+Kv+V/7j/wP+3/6b/Yv8e/9X+c/46/tH9m/1v/Vr9dP2T/bP94v0o/lT+w/53/yAACAFRAvMCNQTsBEUF1AVsBTkFggSIA7cCjQGLAKX/2P45/s79k/2y/dP96P1m/rb+Dv9V/17/o/93/2//Nf8Y/9L+l/5v/uT9+v2i/XT9fv1v/YH9s/3L/dj94f4A/ysAcQHsAaMDUQTdBPkFngXNBY4FWATqA8ICnwHhAKr/+/6G/tX91/2o/Zn9/f0h/pb+6/4k/4j/jv+r/47/eP9A/xb/tP6Y/iL+rf20/ZH9dP1T/XD9Sf2l/Wj98P3W/hH/ygCpAbQCEATvBIgFCgYPBr4FQwVBBF8DTQI3ATkAkP+U/hz+2/2C/ZD9lP3B/Q/+kP6v/hb/ef9t/9L/wv+A/5b/Mf/0/s3+K/7Q/bX9pf15/Wv9gP2F/cz9xv1r/hn/qf8rAdgBwALUA5YEKAVVBWIFAwWRBJ8DAgPiAeoAMQBc/6P+Lf7e/Yz9c/2b/cT9Cv6Y/s7+L/+n/5n/7P/f/5H/pv86/+7+zP7y/c/9Y/2P/Zj9Wf3Y/e/9WP6I/un+lv/R/1gB8AGjAigEwwSfBacFbAVABZQE3QMjAxsCRwF7AK//AP9A/rr9Yf0x/R/9Mf1n/bz9Af5I/rj+2P40/1//NP9w/z//Lv8O/3X+Yv7r/Sb+Qv79/XP+P/6W/qj+6P69/zf/SgFZASICEwT6A3sFWAUKBU8FNwTsAy0DFQKUAcQAu/9x/2P+9v2r/R39Y/3U/E/9bv1z/f79AP59/tP+1f5X/yX/W/9l/wX/7f6W/kj+dP5o/l7+v/6a/hv/7v5T////m/+AAasBTwIgBNYDXAUmBcsEZQUgBBEEUQMlAskBkACo/yb/EP6g/W793Pws/df8MP2J/Wr9C/4M/mH+uP7N/lf/M/9v/4b/Nf8Y/77+l/6o/qH+rf7m/uf+Nv8m/2X/4v8FACgBxQE5AmsDsANfBIsEMgR9BN0DmAMRA0wCngHiAAoARf+e/tr9vv1e/VL9Xf11/cj97f1Y/o3+3f4i/0//mP+L/5r/a/8f//3+fv5r/mj+Wv57/oH+k/7H/rT+6v5H/6P/swCCASQCJwOoAycEigRZBGAEHwSUAycDdQK0AR8BKACV/+3+K/4L/qf9gv2A/Zr9u/0G/jf+eP7j/vj+XP9b/3T/hf9D/zP/9f6n/pz+hP6E/nv+d/6G/qz+zf7Z/nD/fv+oAEUB/AEAAykDBQRVBCEEhQT5A58DUANRAs4B7QAAAHv/wP44/tX9hf1H/U79XP1+/c/9C/59/rD+Av9J/03/fP9i/0P/MP/2/u3+tP6d/qP+gP6j/o/+tP7R/g7/cP/F/8gAXwEuAvICLQMKBDQELgR4BPsDyQNkA5YCKQJIAVAA2/8Q/3n+J/68/ZL9hP2X/cX92P0f/mb+f/7Z/gP/KP9P/zb/Nv8g/wL//v63/sX+q/6c/qr+mP7Z/v/+Pv+o/wkA3AB5AS0C7gIZA9cD+APzAxcEygODAyQDbQLeAQoBGwCg/+/+UP7s/aT9a/1B/WD9af2Y/dn9EP5t/qf++P43/0P/a/9g/1T/UP87/yb/Kv8F///++f4K/yn/PP+g/9P/aAAIAYwBSAKeAhcDgAOiA8kDpAN/AzADtAIrAo8BvAAwAIb/4P5X/uf9q/1W/VT9TP1v/aX9zf0R/kn+lP7T/gz/KP9Y/1j/Xf9f/0H/VP9A/zH/LP8p/yH/X/9z/7T/PgC7AG4B9QGiAggDbgPNA+EDEATvA5gDUAOqAhcCQgGUAAQALP+Q/iX+wv1n/WL9Av09/UH9Wf2s/cz9Iv5k/qn+wP7w/gz/Ev8Z/wn/Gv8T/wv/Ev8H//n+Ov86/23/4/9nAAgBiAEnAqYCCAN2A6wD1wO+A4kDVQPSAlgCowEPAYgA2v82/8v+af4O/s/9kv2V/Zz9qf3x/Q/+UP6V/rz+3P4B/yP/Pf8o/yz/Kv8O/w//9/7o/hn/7/5E/5f/CgCjABEBtwEsApoCBwNAA4MDVwNjAysDzQJwAtUBcAGlACgAk/8f/77+PP4g/s79w/26/aT98/35/UD+aP6Q/tH+yP7s/u7+EP8N/xT/Ov8z/1n/U/9i/5T/ov/6/yQAsAAVAWIB8AEoApwCsAL/AigD6AL9ArwCgQIUApYBTQGdAC0AkP84//X+e/5b/gD+6f3j/dH98f3p/Rv+MP5e/oT+iP62/rb+1f7i/vD+Ef8m/0D/Tv9p/4f/rv8FAEoAtgAmAX4B2QErAogCtAL+AhID9QL7ArACggIVArIBOwGpADEAsP9M/9P+ff4t/vH9zf2u/bT9uP3Y/en9B/4o/jr+UP5o/oz+tv7k/gL/Fv8+/2D/hf+7//D/HQBjANIADgFUAakB6AEdAkgCcAKOAoQCiQJyAj8CAAKvAV4B+wCQACcA0f9x//f+t/5f/jb+//3U/df9zv3Y/eD9/P0e/jj+d/6f/tf+Bf9F/3//p//d/wgANgBYAIcAtQD0AC8BVgGKAawB7gH3AQ8CGQITAhMC3AHKAY8BTwERAdIAlgApAPL/mf9p/yX/5P66/mv+Xf4z/h7+/P3o/fL99P0T/i/+Wv6X/s7+DP9F/4D/wf/5/zsAeQCiAOIAGgFHAWUBkgGmAb8BzQHGAdYBuAGrAZIBcgFQARwB7gCrAI8ASQD1/8T/eP9G/wX/0/6h/m7+UP4x/in+H/4P/hb+I/5F/mn+kP7F/u/+Of94/6v/+f84AG8AqADnAAcBMgFWAXEBigGfAawBmAGYAYQBZAFNASYB9wDZAJ8AeABMACgA9v/Q/7v/jv93/2L/Nv8w/xb/E/8J//3+9f7s/uf+6f7l/tL+4P79/gz/Mv9V/37/rP/K/wMAIgBaAIQAsADZAPMAFQEpAUABPwFDAT4BIwEKAeQAwACqAHoAQAAcAPz/0f+n/5T/f/9t/3P/Zv9U/1D/Sf84/zT/Pv86/y7/JP8s/zH/Mf8c/y7/S/9X/3P/if+x/8b/7/8TADwAZAB/AJ0AvADcAPQA9QAMARUBBgH1APQA3ACvAJcAfQBNACkAHgD7/+f/2P/C/8r/vv/B/7//rv+k/6X/rf+o/5P/lP+c/5P/e/93/3n/d/9x/3H/fP+B/5j/s//N/+z/CAAwAFMAcQCIAKgApgCqALMAsgC0AKgApQCEAGIAUwAzAA0A+//n/8j/vf+z/6v/sP+w/6v/pv+h/5//s/+k/6D/sP+6/7j/qP+5/7X/wf/c/+L/5P/2//7/BAAQAB8AKwApACsAKQA1ADUASgBUAFsAXwBWAGQAXwBVAEUAOAArABkADADz/+n/4P/N/8f/0P/D/8H/yP/d/9X/0f/Y/9X/2f/o/+j/7P/v//T/6//w/+//3v/h/+H/7v/o/+f/+P8CAB8AIwAjACYALAAuACEAJAAXAAkAEwANAAkADgAMAAAA9v/r/+L/5f/h/8z/zv/L/8j/2P/U/8X/2v/e/+P/6P/o/+j/6v/8/wcAEwATABIAEgAQABoAHAApABgAFgAdABcAEAAYABAAAwAWABkABwAIAAQA/P/2//b/+f/7//j/+v/y/+b/6v/o/+n/6f/s/+T/4P/j/+X/4//p/+v/5v/v//P/+P/4//L/9P/2//j/BQAHAAcADwASABIAHQAKABIAFgASAAAA/P8NABIABwD3/wEADgADAAEACgD9//b/7v/p/+j/6//j/+v/8//e/+T/8//z//P/+P/+/wQA+P/3/wMA/v/6/wUACQAGAAUACAABAPn//f/5//3/8f/9/wkADwAJAAQA/f8EAAIA9f/2//j/+P/o/+P/8//4//7/+P/z//j/AQD4/+7/+P/y//j/+/8KAA4A+/8AAAIAAAABAAQACAALAAcA9//y//r/+f/w//z/AAD2//r/AwAMAAoABgD///7/AAD8//T//f/8//n/AgACAAwABQD+/wUAAAACAAAA/f/9//n//v/8//j/AAAAAPz//f8DAAkABAD+/wcACQABAAkAAAD3//X/9v/9//X/9P/8/wMABAADAAwACwAKAAYA///4/+//6//8/wMA/f/8//7/AgD6/wQAEgAJAAMAAAAFAAIAAQABAPr/8v/4//7/AwD7/+n/+f8HAAgABgAIAAsAEAAIAPz/BQD1/+j/7//1//r/+P8HAAUA+/8BAAkAFAAQAPz/9v/6//n//f///wEACQAKAAUAAgACAP///P/8/wAA+//1//7//v/6//z//f/9//7/AQAGAAEAAgAIAAUACAAMAAoAAQD6//X/8//6//3/+f/1//z/AAAAAP//CwAWAAIA/P8AAAEA+P/7/wYA//8CAAAABgADAP3/BQAEAPz/9//2//n/8P/0/wAAAAAEAAYA//8AAAgABQAHAAQAAQD//wAA+v/z//7//f/9/////v/8/w0AAgADAAgA///8//b/AQABAAAABwAHAP3/9P/9/wIAAwD//wAAAAD7/wEABQD3//v/+P/5/wEAAAD4//z/BgACABEABwADAAgAAgD4//r/AgD8//b/+v/6//3/BQAGAAMA9P/7/wIACgAEAPj/AQD8//n/+v/+//b/9/8CAAUABAAFAAsACwAGAAIA///7/wIA+v/3//b/+v/9//3/+/8AAAwAAQD9/wIAAQAKAAYA///6/wYABQAAAPn/AgD6/+//+/8BAAAA+//3//r/BQAJAP//AAABAAEAAAAFAAMA8v/7//v/AAAAAAQAEQACAPj///8AAP3//f8HAAIA+f8FAPz/AgD///3////2/wAACQAJAAIA+/8AAAYA+/8CAAUA9v/3//v/9f/+/wAAAAAJAAgACAAAAPv/AAD7//3/AQD9//f//P8LAAwABQD///3/AAD2//f/+v/7//f/+P8EAAcACQAHAAoACAADAA8AEwD6//P/8v/t//z/9//r//b/AAACAAcADAADAAYACgACAPn/BQALAPz////9/wMA/P/4//v/8f/9//7/BAACAP7/+v/8/wMADgARAP//9f/x//r//v/6//b/+P8AAAAA//8EAAMA+f8KAAgA/f8AAAYABQD8/wQABgD8/wAAAwD8//n/9v/y//f//////wgABwAAAAYAAQAFAAMA//8BAPz/AwD9//f//P8AAAIAAQADAAAABgD7//z/+v/x//7//v/6/wYADAANAAoAAAAJAPX/9f/5//r/+P/u//3//v/1/wAADgACAAUADgD//wcACwAAAAgAAAD5////8v/8//j/7//1//z/AAD//w4ABAAAAPr/BQAQAAcABwD6//v////+/wEA9f8JAAQAAAD1//j/BQABAAoAAAD9////AAD5//3//f8GAAIA+f/9//n/AAAFAAQAAAD///n/CgADAPr/AwD+/wAA//////n/+f8DAAQA+v8DAAMAAAD/////8//8/wsA///3/wMA/v/6/wEAAAD4/wAABgADAAEA/P8FAAcA/P/2/wEACQD7/wMAAAD6////9f8AAP3/CAABAPb/+//7/wAAAwABAAIAAwD9////BwAGAAYA//8BAAAAAAD4//b/BQACAP3///8AAAAA///w//3/BwD6/wAAAwAAAPn/AgABAP3/CQD9//n/BwD7//7/AwD+/wIABgACAP7/CAADAAAA+f8EAAQA+v8BAAEA9P/5/wQABQD6//n/CgAFAPT/BwAFAP//+v/z/wQA//8BAP3/AQADAAEA/P8AAAIABAD8//7/AQD9/wAAAwD2/wAABAD///r/BgADAPz/BAACAAQAAQD8////+/8CAAEA+/8CAPb/+v/4/wEACgD9//z/AwABAAAA+v/9/wkADQAAAAUAAwD2//z/BAABAPf//f8EAPr//P8BAAAA+v/8/wQA9//+/wAA//8HAPj/BwD+//n/AgAFAA4AAAD3/wQAAAD8/wEABAACAP3/AAADAAQA+//9/wAABwADAPv/+P/8//n/8f8BAAEAAQADAP//AAD9/wcA///5/wkAAAABAAwA//8EAAwA/P///wwA+//+//3/AAD7/wcABAD9//7/+f8GAAAA+v/6//P/AAD//wMAAwD4/wIA/v/8/wIAAgD7//7/AAADAAQA9f8AAAcACAD//wEAAAAGAAoA9v/x/wMA9//7/wQA/f8AAP3/7f8FAA0A/v8FAAAA9f/6/wIAAgD//woABQD6/wAAAgD7/wUA+P8BAAMA/P8EAPn/BgAGAAAAAAAAAPj//v////P/+/8IAAIA+v/7//r/BQACAAUAAgAAAPz/9v8BAAkA///6/wIACwABAP7/AQD8//v/AAD+////AQD8/wEA/f8AAAAA+f8GAAEA/f8CAPf/8f8FAAYA+/8DAAMA+v/7////AQACAAEAAAAAAAUA9//2////CAD///b/BAAGAPv/AAAEAP3/+f8CAP3/8v8JAAkA+v/9//v//P8BAPH/CQAFAPn/BAD+////AwAEAPz/AQABAPv//v8HAAoA/f/7////AwD9//7////5/wIA/v/9//z//v/9//r/DAAEAAIA/v8BAAMACAADAPr//P/6//f/BQABAPf/BgD4//r/AAAEAAQABwD9//z/BAABAAIABgD///7/+v/5/wAA+f8HAAAA+P/7/wAAAAAHAAIA/P8AAPz/+/8EAPz/BAAJAP7/+v8QAAMA8v////n//f////j/AgAEAPX/5/8AAAIABwD7/w0ADwD8//P/AgAFAAIABQAEAAAAAgABAAYA9f/7/wcA+f8AAAAAAgD1//r/AwD6/wAA///3//7/+/8DAAUA/f/+/wcACAADAAMACAAFAAQA+v////////8DAAUA+f/2//r//v8CAAIA+P/6/wEAAQAAAPn/+P8BAP7//v8GAAAA+v8BAAAAAAD5//z/AQABAAEAAgAAAAcACAABAPr///8JAPz/9/8HAAQA//8CAP7/+f////3/9f/6/wsAAADz//z/AAAEAAEA/f8LAAcAAAD8/wUAAwACAAYA///6//z/AAADAPv/9/8KAAYA/f/8/wUAAAACAAgAAwDz//X//v/5/wIA/f/7//v/CgD9//j/AAAHAA4A8//5/wUAAAAAAAAAAAAFAP7//v///wYAAQD8//v/BgAEAPz/AgD9/wIA9//7/wIA+//6////9v/9/wMA+P/+/wYAAAD+/wIAAAAGAAAAAAAIAAkACQD6/////f/8/wQA+f8CAAkA9P8GAAQABAD4//L/BwAAAAAA+v/6/wAA+P8CAAUAAAD4/wUABQD5/wEA+/8IAAYA/v/8//z/BQACAP7/BAAHAPz/AAD7//n//f////X/+//+//f/+//4/wIAEwAKAPr/AAAHAAYACAAJAAgA///+//7/AgD+//v/AAAAAP/////5//r/AAAGAAAAAAAAAPn/BQAEAAQAAwD///j/AAAEAAAA8v8AAAIA/f8CAPj//f/8//f/AAAKAP3/+v/+/wgAAgAGAP3/BAABAAQAAgD2/wAACQANAPf/9//8/wMA+f/8/wMA+v/+/wQA9//3/wwADADz//r/BgD4//f///8AAPj/EwANAP3/AQABAPz/BwACAPv/AAABAPX/9P8AAAQA/v8BAPf//f8EAPn/AQAAAAUA9v/+/wYA/P8RAAkA9//7/wcA+f/7/wUABgADAOn/+v8GAAIA+v/+/wQA+/8FAAMA9v////n/+P8GAAYA+v/7/wEA/P/6/wYAAAD8/wwACQD7//n/BAAEAP7/AAAAAAEABgAFAPj/AAD///n/+f/5/////////wAA9v8EAP3/AwAJAP////8MAAAAAAAAAAAAAAAFAAUA/P/8/wAAAAAAAPn/AAD/////AAD5/wAA+f/5/wAAAAAAAP//AAAAAAAA+f8AAAAA/f/8/wIADAAFAAAAAAAGAAYA+f/5/wAABgD5//n/AAD//wUA+P/5/wcA+v/6//3/AgAHAAQAAAAAAAcAAAD5/wAABQD4//n/AAAAAPn/+f8CAAIABgD5/wYADQAAAAUAAgD8//3//f/9//n/+P8FAP//AAD5//r/AAD5////BQD4/wAAAAAAAAAA//8FAPn/AAAAAAAAAAAFAAAABgAHAPn///8FAAEAAwDw//v/+v8FAAQABAD3//n/AQD0//f/9v8IAAAAAAD8/wIAAgAFAPn/BQAGAPj/BgAAAAAABgAAAPn/AAAAAAYA+f/5/wAA+f8AAAAA+f8DAAYA+f8AAAYADQAAAAAAAAD5/wAAAAD5/wYABgAGAAMA9f8AAAoA/P/1/wAAAAAAAAAA8v8AAAAA8v/8/wIAAgD8//z/CgACAAkAAAAGAAYA+f8GAAYA+f8AAAYAAAD5/wAA+f/y/wYA+P/8/wIA/P/9//3/CgACAAcAAwD5/wQABAD1//7/BQAAAAcAAQD9/wMA///3//7/AQAFAAkAAQD6/wAA/v8AAAEAAwD5//r/AgD7/wYA/v8EAAAA/f8CAAgA/v8AAPz/9v/8/wAA8v////v/+/8FAAAA/P8BAAUA+f8AAAAAAgADAPP//v///wAA+/8BAAwA+//z/wgABwDv////CQAAAPf/BQAAAP//BgD4//b/BwAHAPz/BQD+//z/CwAAAAEA/P/2//n/AQAFAPn/BAAFAPL/AgD+//X/+/8BAAUAAAAAAPf/AwABAPr/+v8GAPr/AwAGAP//BwAAAAQADAAHAPn/AQD+/wAA/f////X/9v8DAPn/9f8EAAQA9P8GAAAA+/8AAP3/AwD6////CgACAPf//P8KAP3/AAD+//v/BgD///r/AAADAPv/CwAGAAQACAAAAAcACgD+/wMACQAEAP///P/4//n/+//r//L/8P/y//r/9v/2/wAAAgD7/wYAEQAGAAAABAAIAAAABwAGAAcAAwD//wUAAAAAAAEA///y//D/8//q//7/AQD1//v/BwD8/wAA//8AAAwABgABAP7/DQAAAAIAAQAFAAQAAgAIAPT/+/8BAAIA//8AAPv/9/8DAP3//v8AAPj//P8CAAAAAQAKAAIABAD+//j/BwD7//X/AwACAPv/9v8GAPT/9/8CAP3/BQD9//v/AAAHAAAADgAOAP3/AwAFAPf/+/8HAPz/9f/3//n/+//8//3/AAAMAP//BwAPAAkACgD//wEACwACAPv/+//1//3//f/q//3/AAACAAAA/f8BAPz/CgAAAAAA//8EAAsA+////wAA/v8AAAYAAAD9/wAA///+////BAADAAQABQAAAAUABQD9//r//v8DAPT/+//4//T/AgAFAP3/+/8IAAAAAAABAP7/AQACAAYAAAD9/wAA+//4//7/+f8JAAMA+/8CAAwAAAAAAAkAAAD8/////v/+/wAA/f///wMA/P////b//v8CAPn/AQD+////CQAAAAIAAwD//wEABAAGAP7/AAD3//j//P/3/wAABwD3/wAACQADAAUACgAHAP3//v8EAP3//v/9//T/+v/+/+//////////AQAAAAYAAAAAAAkAAAACAAcABwAAAPb/AAAAAPT/AAD///7//P8DAAIAAAACABAAAAD2//7//P/+//r/+P8AAAEAAAD8/wEAAgAHAAEABgAEAPz/+v8AAAAABwAEAPn//P/5//n////+//z/+P/7/wYAAwD9/////P8AAAIA/f/9/wIACwD8/////v8AAAUADAAAAPb/AAAEAPn/AAAIAP///f/3/wEAAwD9/wcA+P/8/wAA/f/3//r/AAD7//3/AgABAP3/AQAIAAgABgABAAQABQAAAPv/AwAEAP3/AAACAAkAAwD+////BAD///z/BAD3//z//f////v/9P/4//v/+P8FAP//8//8/wIAAAD8/wAACQAGAAIABQAHAAAAAgAEAAUA///7/wIAAQD9//r////9//v/+f/0//3/AQD7//b//f8BAAIABQADAAYAAgAAAAQAAAD+/wMAAwD+/wEAAAD///3/AAAAAAQAAAD8/wAABwAHAAAAAwD5//z/AQADAPn/8P/9////+f/2//r/AwACAAIABwAKAAoABAD///7/BgAUAAkAAgD///z//v/9/wEA/f/6//7/AAD7//T/+P/7/wAA/P/+//3//v8AAPn/AAD///n/AgAGAAkADgADAPj/AAANAAEA/P8BAAAA//8AAAAA/P8FAAMA/P8AAPr/AAAEAPv/+P/7//7/+P/3/wYAAQD7/wgADQAGAAMADAAJAAMABQAFAAIA+f/4//3//v/6//7/+v/4/wAA9f/0////BwABAAAABAD6/wAAAgD9/wAABQD9//X////9/wMABQAEAAYA9f8AAAYACAAAAPr/AAD3//3//f/8/wQA///6/wIACgD///z/AAD4//z/AwD+/wAACQD+//P/+v/7//f///8GAAIAAQAMAA0ADAALAAIA///8//7/AAD6//b/+//7//v//f/9/wAA9v/y//3/AQD7//f/BAAHAAMA//8EAAQAAQACAPn/AgACAP7/DQAGAP//CAAAAP7/AgD7/wQA/f/3//v/+v/7//H/9P/9//z//P8EAPz/+P8AAPn//P/9/wYADgACAAAABwAQAAwA/v8DAAkAAAAAAPr/+f/6//f/AAADAP7/+P8GAAgA9P/7////+f/6//z//f//////////////AAD8/wUAAwABAAgAAAACAAUABgD6//f/BAAJAAAA9P/7//r//f/8//f/+f/2//n/9f/4//z//f8DAAAABQANAAUAAQACAAMAAQAFAAUAAgAGAPz/AwACAP7////x//v/AAADAAQAAAAGAP7/AAAAAPP/AAAAAPf/AgABAP7//v/7/wcAAQD6/////P/9//v/+v/9/wAAAQD9////AwAJAAIABAALAAEABQAKAAAA//8AAP7//f/4//n/+//6/wAA+f/6/wIA+v/4//3/BwAGAAIAAgANAAUA/P8IAAUAAgAAAP///f/8//z/+v/8//7/+f///wYAAAD5//3/BAD6//j////9//r/9P/+//j/+v8FAP////8DAAUA/v8CAAsABwAHAAIAAgACAAAA/v8EAAAA/P8FAAEA///8//n/+//9//3/+f8BAAcAAAAAAAIA/v8AAAAA+v///wMA9//6/wYABwAIAAAAAQAFAP7/BQAIAP7/+P/5//X/AgD9/wAAAgD7//v/8v/1//z/BgD4//3/AwD2/wEABAABAAEACwAFAP3/BwAEAAIAAgAGAAUACQAFAP7////z//r//f/0//j///8EAAQA/P/9/wQABAD3//b/AgD7//7//P8AAAQA+/8LAAwABwAGAAAA///7//P/9f8AAPb//P8EAAAA///8/wYAAwD9////AQD7//n/BgD7//b/AAABAP7/9v/6/wIA/f///wQAAQAEAAMAAAABAAQABwACAAYABgADAAAAAQAJAAAAAAACAP7//f/3//X/9f/0//z/AAD6//v/8//9////+P8DAPn/BgALAAAAAwADAAgACgABAP//DAAJAAcABAAAAAgAAgD///z/+v/6//n/8f/3//j/8/8DAP/////9//X//P8BAAEAAQACAAAAAQAEAAYABwAGAPv/AAAGAPv/+v///wYA+//7/wIA+//7//n/+v/6////AQD7/wIAAAADAAQA9//1/wAAAgD3/////P/7/wUACAAIAP3/BwAOAAkABQABAAAA9//9//7/8//8/wMA9v/1//j/9v/4//X/+P/3//z/9//z/wMAAAABAA8ADAAFAAgACAAHAAYAAwAFAP3/+f/9/wEABAD+//n//v8EAAcAAQADAAoA+//+////8v/3//f/8//z//P/9P8AAAcAAwACAAEABQADAAMADQADAP7/BgAGAAAA/f8FAAAA8f/3//z/7//w/wAA/P/+//r/8//+/wMAAwAAAAYABwAEAAIAAQACAPz/AgABAAIAAAD8/wQABQABAAEABQABAAgABwD6//v//f/9//n//v/9//n/+//5/wAAAgAAAAAA/P/4/wMA//8CAAAA+/8HAPz/AwABAP//BwD0/wAABgD9/wcAAgAAAAQA+P/4////AAD1//X/AAD9//7/+P/4/wQAAwD4//f/BwADAPv/AgAMAAMAAwAVAAoAAAAIAP//8//7////+////wAA+v/+/wEA+v///wAAAQACAPn/AgD+//j/BAAAAPz//f8AAAAA/////wEAAgADAAAAAwAEAAYABAAGAAUAAAABAPn/AAAAAPr//v/7//n/9v/1//j////9/wAAAgAAAP//AAAKAAMAAAACAAMAAAAAAPz/+P8DAPr/+v8AAP7/AAACAAIABQAHAAAAAwD//wIAAAD9/wEAAAD7//T/AAD7////BwD9/wEA9//2//3/AgAAAAQAEQD+/wUADgD7/wAACwAGAPf/9v8HAPn/8/8CAPX/9v///wAA///4//n//f/8//v//f8CAPn/9v8AAP3/+P/6/wcACgADAAMAAQAIAAQA+v8IAAUA//8GAAAABgD///n/AgD6//r/+f/6//////8AAPv///8DAAAABQD///3/BwD7/wAABQD4/wIACQAAAP7/BAD///v//f8GAAkA/P8BAAIA+f/9/wAA/v/8//v//P/8/wMAAAD3/wQA+v/+/wUA+P/1/wIACQAAAAcACAAKAAgAAwAFAAAAAAD7//v//f/7//v/+v/4//j//P/3//H/AgD9/+3/AgD//wAABwABAAQADAAEAPn/AgD+/wAA/f/9/wIAAAAAAAcABgACAAAAAAD3//r/BQD8/wAA+f/4//z//P/0//z/AAD5//r///8AAP7/+f/+/wAAAwD2//n/BAAAAP3/AgADAP3/BgAFAAYACwAFAAAA+/8GAP///P8DAP7/AwD///v/+//4//j//P8CAP3/9P/6////AAADAP7/9/8MAAMA+f///wEAAAD+/wAA/P8FAAgA/P8BAAkABwACAAcABgABAP7/AQD+//z/+//x//v//v/z//n/+P/+/wcAAwADAAoA/////wwA/f/9/wwAAQD//wMAAAAFAAIAAAD//wIA+//2/wEA/f/5//3/BgD///f/AAACAPT//P8AAPv/AAAEAAAA///8/wAAAQADAAIAAgAGAAoABgAAAAMACwABAAAA/f/8/////f/5//r/+v/7//f/+P8DAAAA9f///wQABAAFAAAAAQANAAEAAAAAAAIAAQD///v//v/7//z/AAANAP//+P///wMA+v///wIA+//+////+//1//v/BgADAP7/AAAJAPz//f8HAP3//v8DAAMAAQAAAAcAAwAAAAUAAAD2/wEA///8//X/+f/+/wcAAgACAAYA/v/8//3/BQABAAAA/v/4//j/AgD+//7/AAD///z/AQAGAAAA//8FAAcAAQACAPz//f8CAP3/+P/8//v//P/9//X/AAAEAP3/AQAEAAEA+f8IAAkAAgAJAAAA/f8AAAAA/f/9/wcABQD+////AgACAP7/AAD+/wAAAQD+//T/AQD/////AQD//wAA///5/wAABwADAP3/AAD6/wMA9P/9/w0A///8/wAABAACAAEA+v/9/wEA+//8//X//f8FAPz/AwAEAAwABAACAAYAAQAIAPn/+//6/wUA+f/7/wUAAAAAAAIABAD+//3///8IAAAA9//+//7/+//2/wMAAQAAAAcA9//9/wEA+v////7//f8AAP7/+f/9/wQAAAABAAcABAD//wUABAD//wEA+f///wkA///8////AAD7/wAA+//+/wAA+f/7/wAAAwD///7/AgAMAAUAAAAIAAAA/f8BAPv//v8KAP3/9P/6/wEA/P/2/wUA/f8DAP//BwACAP7/AwD4//7/+f/4//z/AAAFAAAAAgAJAAEAAAABAP3/+f8FAP//+/8AAP///f8BAAQABQAEAPn/AQD+//3/9f8DAPn/+/8DAPf/+P8HAPf/AgASAP//BwANAPr/AgAJAPj/+v/9//3/+v/8//P//P8AAPn/AwANAAIABwAEAAAABgAEAAQA/P/7/wMA/v/5/wAAAQAAAPb/9v/5//7/AQD+////9v/9//r//v8AAPz/AQAAAAAAAgAGAAUABgALAAgAAAAIAAkA+P8FAAAA//8CAPf/9P////f//P/5//b/AAAAAP//8v8DAAoA/v8CAPv/AgAAAPv/AAD6/wYA//8GAP3/+f8GAAAAAwAEAAAA+P/+/wcA+v/1/wkAAgD8/wEA+////w0AAgDz/wQA/f/3//f//P8BAPr/+/8FAAYAAwACAAUADwAEAAgAAwD+/wYA/P8CAPn/+//0//P/+//0//z/9P/9//r//v8CAAEABAAFAAYAAAAEAAQA///6/wMA9v/9//7/AQACAP//AwAHAAMA+//+/wIABwD+////BQD+//7/BAAAAP7/AAAAAP7/9f/9//X//f/6//f/AAD6//3/BQALAAwACQAHAAwADQAMAP7///8KAPf/AAADAPr/8P/3/wAA8v/1//n/+P/x//j/+f8AAP//BAALAAYAAAAIAAkAAwD9//n/AAACAPz///8BAPr///8CAAwABAD9/wsADQABAAAAAAACAPP////8//b/+P/z//P/9//x//X/+f/7//j/+v8FAAUACwAJABIAFAASAAQADgAPAAoABAAFAAIA9v/5//z/9f/3//3/5v/w//D/8v/6//n/+/8DAAAA/f8HAAUACQAHAAwADAAFAAwAAgD+/wQAAQD7//7/+v/9/wMA9v/8//3//P8HAAAA/P/+//b/+//6//v/7/8FAPv/7v/9//r/+P/+//b/AAACAAcACgANABEACQANAAsACwAGAAIAAAD+//7/8P8AAPf/9v/5//X//P/w//v/+//8//P/+v8EAAAAAwAFAP//AwAHAP//CAAIAAAADQAMAAEACAADAPn/9v/4//n/AAD4//f/BAD9//7/BAD//wIA+f8AAAQA9//6//v//P/y//v/BAAHAAUAAQALABIABgD7/wUAAwD3//7/BwD4/////P/8/wQADQD+//L/BwAIAPv/+v8GAP///v///wAABgD0//f/8//1//T/9f8AAP//DAAIAAYACgAQABQAAwAOABMA/v///wAA9v/y//n/+P/7/+//9f/2//L//P/+/woA///5/wEACQACAP////8IAAkA+v/9/wUABAD9//z/9//8/wQA+////wgA/v///wwAAAAEAAcAAAAAAAQA/P/6//7/AADz//b/8//y/wAA/v/2/wAAAAD+/wEABAAFAAQAAwAIAAkAAwAJAAMA//8DAAEA/P/3//z/+//9//7/AgAAAPr/+f/3/wAA9P/6/wAA+f8AAAAAAgD9/wQAAgAEAP//AAAFAAMA/v8AAP3//P////v/AgABAP//AgACAAAACQADAPj/AwD7////AgD9//n/+//8//r/+v///wMA+v///w4ACgAAAAAAAAAAAAIAAAACAAAAAAAKAAEA+P8AAPj/8//8/wAA+P8GAP///f8EAP3///8AAAAAAgD1//7/AAD1//r/CwABAAUAEQAAAAEAAAAEAPz//v/9//7/AgD///3/+f8BAPX//P/9//z/8v///wQA+v8BAAEACAAHAAEA//8EAAQABgD7//n//P8DAPX/9v8BAPf/AQAAAP//CAAHAAYADgANAAkA/f/8//v/AgD3//D/9//1//j/+v/6//v/CgAAAP7/AAAFAAQAAgANAAEADQAGAAYABQABAPX///8GAPT/8v/1//f/+v8DAAEA/v8GAAAACAACAAIABgAJAPj//P8GAPn/8v/1//z/AAD2//3/BgD5/wkABwD6/wQABgAAAP//BgAFAPn/AQAHAP///v////v//P/6//X/AQD5/wEABgAAAP3/BgD+/wIAAwD8/wcAAwAHAAIA9f8CAP//AQAAAPn/AAD6//7/AwD5//7//f8DAAUA/P/+//v/AwAAAPT/AwAKAPH/BQAFAAIA/v8GAAYA+f/7/wEA+P/8/wQA+//8/wAAAwD8////AgD+/wgAAgAMAAAA/P/9////AwD1//r/+v/5//v/+v//////+P8GAAAAAQAAAAQAAAABAAAAAwAEAPX/BQAAAAAAAAD8/wgAAwD6//7////5/wYA/v/5//3/AgD9/wAA/f/3/wEA//8CAAIA/f8DAAAAAAAGAAAA+/8PAAQAAQD7//r/AQD4/wAA9f8CAP//8/8BAPz/9/8AAAUAAQAKAAIA///9////AQADAP///P/+/wEAAgAGAAQA+P8BAAUAAwD4//b/AwD9/wAA/v8EAAsA+P8AAP3//P/9//L/AAAFAPr/9f8HAP3/AAALAAcAAwATAAEAAQD6/wYAAAD5/wkAAADy////+//v/wQABQD3/wAAAwD+//j/+/8EAPr///8GAPv/AAAKAAUA9f///wcAAAD8//v/CAAIAP3/BAAIAAgA+/8FAAYA/P/5/wMACAD3//3/+f/9//r/9//0//n//v/0//n/BAAAAPz/CQAJAAYADQAJABEABAAEAAQA/f8CAPv/7v/9//3/+P/+////+v/7/wAA/v8DAAUA/P/8/wUAAgD9/wEA7v/9/wAA+v/9/wQACgAFAAYAAAAAAAUABQAGAAQA/f8CAAEA9f/+//b//////wAAAAAAAAUA///5//r/+f/2//7//v/2//z/BgAAAP3///8EABAABAAFAAAABwAIAAEABgD2//z/+P/9//3/AAD7/wgABgD9/xEAAwAAAPn/AQAEAPn/8f/3//v/9f/7//v//v8GAAgABgD9/wIABQD9////AQD6//j/BAAGAPr/+v8FABIAAgD8/woACgD+//b/AAD5//X/7v/q/wIA+v/6//z/AwALAP7/CQAAAAsAFQD0/wYADgDz//L/8/8HAP////8NAAAABwAKAAIACQAFAAAA8v/6/+j/6v/3//H/9f/+/wQA/P8IABYAAAABAAcABQAFAAAA+v/5//j/+P/2//b/CQAQAAUADQANAAMA/f/8/wIA+//1//z/+v/s//j/AQD7/wQA/v8DAA8ABQAAAAAABgD4//f////v//f//f8CAA8ACAAMAA4ACwAKAAoABQAAAPn/6//1/+z/8f/v//P/CQD9//7/DAAOAAcABwABAAAA///9//3/9v/3//j//P/8/wQADAAJAAoACQAPAAMA+v8AAPn/7P/v//3/AwAFAAEAAwAKAAMAAgAFAP7/+P/3//b/5//r/+7//f/+/wcAEAAUABsAFwAXABIABwAAAPD/9f/u/+v/6P/q//z//P/9/wwADQAHAAcADAAGAPn/8f/9//v/AQD2/+3//f///wAACQAQABYAEAAHAP//9f/s//D/8v/6//7/9f8AABYAGwAeABUADgAKAP7/+v/o/+X/3v/h/+r/5//w/wgAEwAkACQAIQAgABkACQAEAPn/4f/c/9z/4P/w//j/BAAQAA4AHQAaAAwAAgAAAAIA+P/v//T/7f/y/+3/7//7//3/AAACAAIAFQAMAAMAAQAAAAAA8v/v//f/+P/8/xMAFgAWABoADAARAAgA8P/y/+3/5v/b/9n/5f/y/wcAEAAcACMAIgAlACAABwAPAAYA4v/f/+D/z//b/+3/7P8CABUAFQAlACIAHAAKAA0ABADk//n/7//p/+v/7//2//P/CwAHAAIAAwAEAAgACwAEAPz/8//x//T/6P/5/wEACgAeABwAGgAPAAQACQDy/+//8P/m/+H/3//e/+v//P8FAB0AIwAlACIAGgARAAYABQD7//H/4f/d/+H/6v/w/wEADAAIABUAFgAIAAAACwAAAAQA///3//L/+f8AAPb/8v/8/wMABAAFAAQAAwD6//r////v//X/9f/+//P/8v8PABUAFwALABUAFAD9/wcABwDw/+T/8f/q/93/9P/9/wYACQASAB0AHAAOABgAFQAHAPj/9f/k/9z/4v/n//D/+//+/wcADwAWABkACQABAPn////+//7/CwAIAAIA/P/8//b/7/8AAAAA+v8AAPP/9v8BAPn////3//j/8v/4/w8AFAAeACAAEwAEABAA//8BAAEA8f/k/9r/4f/n/+n/BAATABAAEwAQACEAGwAPAAIA+P/0/+7/7f/u/+X/9f////r///8GAAYACwAAAP//AAD5//z/FQAPAAcABAD8//v/AAD5//L/+v/3////+P8AAAYA8f/4//v/9P8CAAQAAAAHAB0AEwAMAAQACAD7//T////v/+f/5P/t/+///v8IAA8AGQAbAB8AFAAZAAwA+/////X/4f/t//T/9f/b//L/AQD0/woA9f8KAAoA+v/v/wQACgAYAAkADwAAAA4ABQAKAAUA7//y/+n/8P/k/+T/5//3//j/6//v//T/EgAMAB0AEgAZABQABwALAPb/8//o/9H/1P/N/9T/5f/x/wEA+P8JABIAGgAUAAUAEQAMAPz/8f8FAPz/AgD3/+j/7P/+/wIA7f/3/+n/9v/v/wQABgAUABEACgAKAAAAAgAFAAwABAD1//z//f/8//v/6//r//P/1v/i/+v/7P/7//7///8QAAEACgAcABMA/f8AAPL/6v/r/+v/7v/2/+j/9v/+/wIACwAWACAAFwAMABIAFwACAAAA/v/z/+r/4v/d//H/8f/1//j/9P8CAAYA8v8AAA8AAQD6/w4AAgD6/wEAAwD1//3/+/8QAAAA9//o//j/8P/n/9//5//j//j/8v8IAAgAGAAVABwAGgAQAAIABQDd/9T/+f/2/67/6v/g/+T/6P/4/yIACAAZABoAFgAJABEADgD6//H/3f/c/+r/6f/x//7/+f/1//7/FQAIAAgACgD5//L/BwAMAPL/AAD7//T/+v/4//j/6P/u//v/6v/x//3/8P8BAPP/CQAMAAcAEAAcACcAGAASABMAAQD4/+z/2v/T/9X/1f/P/9//8f/7/wUA+/8MAAsADAAaABoAFAAOAPr/6v/v//T/3f/f//X/0P/U/+j/+f/z//v/BAAAAAcAFgAIAA8ACwASAAkA+/8GAAQA+P/2//D/6f/c/+P/6f/r//X///8aAAcAAgAfADIAJQAYABoA///s/+j/4//d/8D/y//H/87/7P/y/wUA/P8NAB4AHQAeACEAKAAbABEACwABAPf/7f/y//P/5//1/+P/6P/q//L//P8CAAwACQATABoAKwAVAAwACQADAPr/7//7/+X/2//M/87/zv/i/+3/CAD8//j/EAASAB4AHQAmAB8ADgD8/+D/5f/V/9j/0v/f/93/6P/y/wQAEAAFABYADwAxABgAPAAZAAgADAAAAOD//P/v/+X/5P/Y/87/0v/y/9z/9//v//r/EgALAA4AEgAmABEA+//5/xUA6P8EAPP/6P/f/+f/6f/m/9v/9//7//f/EgANAAcAHwAnACIAFgAQAAIA///u/+P/2v/c//H/uv/m/+H/FAD1//n/CwAIACIA+v8tAPn/AAD8//T/8f/x//D/3//9/9z/7P8CAPv/9v8fABgA6f8CACwA7f8jAE8AAgAcAB0A4v8FAPr/6f/R/+r/8//Q/+D/6v/4//r/CwALAAcAEAATAA0ADwAeAAEADACo/0YAYQCM/8v/DADg/7n/sv8RAAUAuP+z/yEAIQAFABUAIgBGAP///f88AOL//f8PANX/uf/S//z/9v8YAB8ABQDq//v/CAD7/w8ADQDf/xkACgD9//f/9f8CAPH/9f/h/8L/8v8IAOr/7P8oADkANQBHAFoAQwAbABoA+v/9/wQAMAAPANv/1f/F/8D/qv+7/9n/xf+0/9v//P/c/wwA8f8aADgAHgBfAF8A6/9m/+D+nf7C/ab9N/7c/o7+x/6f/w0C2wLuAmME5wRCBMwCiQHXAJj/f/47/4n/Wf9XALgAtgBRAI7/a//g/qv9gv2l/Tz+gf5k/pr9FP0T/A/7jvve+537Kv2MADkDywY9CAsJNglqBswDjAFN/wL+Ef1R/aH+xP/UAAgCKQLCAeAAzv83/yH+L/07/Wv95/1W/hD/2v5l/nP9vvwD/a/8//s4/Jv8UPwG/Bj9RgA9A4QGOQj1CEYIVQWEAmwAxP6s/tX+6/96AfABbwJkApQBPwDr/hX+Z/5f/qv+Pv/T/ygALQA9AL3/6/7d/eL9Q/4U/qv94/xb/N77sPpV+jf7M/6wAnEGFgmsCYQICQX5AKv+4P0g/lP/6wDgAl4D/gL6AgkCoADu/mz+7f4+/33//v8wABIAqP+8/pL+Dv5+/bz9a/7L/n7+rf1+/L37Gfs4+lH6L/sJ/5YDpQc/CeUIvAalAt/+ff0z/Sz+QADNAkAE8AP3AkUC3wAs/yL+hv57/ycAfQCqAEMAsv/Q/ub9+/1g/t7+/P5b/0n/m/6J/Yf8mfuo+9z7E/wE/KL8YP9uA9UGqAfzBuoEuQEf/3D+O/9nAEAC3QMGBMACoAB8/wH/kv7k/gEAOQELAVEA4v9N/wP/B/8k/6f/Xv+K/4j/0f70/U39t/wj/WT9Sv2T/bP9HP3Q+077lf75A7oHnQjaBkYEfABe/e79ZQB9Ah4E/ARPBOIBxv5x/Q7+v/6B/7sAPAEJAVIAgP7h/Sf+r/6G/w0AUgAb/w7++f2c/X79qf3z/fz+Tf+Z/oX9n/wo/Kb7aPyyAPwFEgjWBvkDdwGuAJMAUgHoAaUBygFDAej/i/9h/3z/4v8FAC8ATgAkAO7/wf+o/7D/pf+l/7b/rv+v/6H/k/+Y/5b/nP+m/5//of+3/7r/xv/E/87/zP/c/+r/4v/0////7//f/97/6f/m/9n/4v/i/+z/6//u/+3/6//7//r/+f///wMABQACAP7//P8AAAIACwAAAPv/DAATAB4AJwAgABcAFAAdAAwADgAaABIACwALAAIACQAMAAYAAgDv/9L/yf/g/+D/5P/m/+j/5//y//3//v8HAA4AGAAWAA4AGAANAAIACAAOAA4ADQAMAAAABQAAAAIAnQATAu0BZAFLAJ3+LP4P/54AGAFtAJP/4v6T/tj+dv8sAGYADwB+/xv/Pf+1/yAAZQBo/8H+2f5O/oP+P//X/vz+Kf9g/pv+Ff/g/lP/8P7h/kkB3AQuBhwFVgO9AML/6QAnA/4DGwQHAgQAcf+m/j3/CAE2AjcCQQAp/sL8DP2U/u7/UwCQ/z7+cf14/Yj9H/+EAIUAuv4D/RD9Q/1K/qH+df7O/sv+lv1S/oT/hf8Y/j/8mPx6AngI6wieBQQCm//w/x8CoQTmBUUF0QES/wf+JP5yAP4BVwKCAav/Bv6+/ED9PP+gAJ0AOf+6/ED8+PzY/R4ADgEGAKX9BPyJ/Nv93f8dAMT/2/81/8f+3/5F/sP+6P4+AB0ELgjLB8sDVACw/o7/zgH+AmoDagLb/3D+cP3b/bgAPAJEAtkAS/7e/J/8Af4xAOcAaAC3/tL8AP4q/xkA6/9i/xj+bvzf/Fz+l/+CAKj/iv83/3H9iP7yALwAcP/L/Zz/3QTlCI8H/QLv/73/oABvAfcCPARfA08A4/0q/Zb+KwEKAr8BbABA/qb8af2o/yABCwBp/uX89vxh/hH/ZP87/2z+XfzE+yD+OQAjARcA2P45/wP+Lv0D/2oAvgCl/nv9kQG8ByMKPgW6/5n+WQE1A1oD/wLuAo8BO/+Q/az+mAHKAsgBvv8E/nz81Pyz/jkBaQGh/wv9Pfy2/fn+hv9X/4D+sfxO/Bn+xP/FAAgAQ/7F/Xr+9f95AGn+D/2s/If/mgQLCekJBAXN/r38Ov+/AjoEMgRFA4gBkv56/HP9tADhAl4CUwAB/qj8+/yl/rgASwE7AED+Rv07/cj9NP9cABoAM/7A/GP9xf4ZABMACv/r/kn+zv3k/dL9I/+z/+wBhAV6CNsHqAJT/un+pQICBd8DFQJQAe3/k/01/LP+bgJ9A8YAif3i/Af+Rv/m/0YAiACn/yX+J/0Y/X3+ev9R/yv+E/1+/Xr+MP8j/0j+zP5o/6n+g/2u/Kn9zP8HAgwFoQdOCAwF2v+X/hwBmQQBBcUCXgHvAKD/Iv38/BIAAQM1AxQA+vyI/ND9eP9BAGAADQAG/+v9E/13/dT+nv8P/7z9df1r/cL9h/7Q/lr+n/2F/cr+mv4q/tv9dQAIBScIFQglBN7/cP/bAM8CQgPDApwC5QHw/2P9bP0+AMgCIAPQADD+UP36/XX/hQDcAFYAOP8q/jH9Z/15/lX/8v7z/Y79D/1r/Zv+2f6+/gX+yv1o/of+Z/7j/ZsAEwYXCoUJwwNL/iP+dwGlBMkERgNsAqEBYf8X/cv9kADRAgICRv/8/Xn+Ef+J/4f/4v/w/1f/Cv4S/Zn9qv4L/0T+p/0A/t39pP3u/Pr87f2h/g3/9P3//Sf+XQCsBEQINgnABaMAhv5LAJoDIwUMBGUCCgGv/1v+fv61/0UBXwH4/3j+pP0x/gn/kv90/5n/gv/e/u/9h/37/Sb/Uv9y/q79RP24/a/9V/1w/fT9nf4S/s39qf3m/6QESghmCV4FDgCr/r0AwAN0BD8DKgKfAbAAUf9s/vj+rgBAASsAXf6s/WH+QP8u//f+Zf8QALv/kf6A/ZD9fv7W/h7+Sv2X/S7+9f0w/Vj88/xh/eH9+P0g/5kDrAe+CYYFpP/J/f//8APmBGYDEALLAbgBfQAX/9X+WwDaAXgBHv9L/YH9NP8yACIAxv9s/5//RP9f/pr9uP1w/mf+8P1p/Qz9Kf1N/Rv9Kv0Q/TD9eP3V/zEEEwc7CCIFkAHP/0sAiAICBGwEgwMsArcAn//K/08AKgFnAZoANP/w/cj9kv5m/wEAHACj/0T/yf5a/gb+9v0d/ij+KP6C/dT8u/xH/Gb8ify9/B79wP4FA1QGzQfdBeMB+//m/0ACbwOoA38CRgJzAtwB6QC2/6r/mAAgAXEA6f4O/gD+jP4E/9//LABRAAsAHv+2/WL9/P3G/v3+N/75/Jb8b/xf/Hf8e/zh/DX+agKiBpcIaAfkAo7/1/77AHIDxAOkAoQB5QHoAXEBOQBb//b/3gC8AFn/Bv6U/Vf+Nf8wAG8AcwDN/33+6/2m/d79jP6I/k/+6v3B/Oj7mvsL/O38zv52AtYF7weJBqkCUP8l/gkAVAJPA5EClgFkAQMBmwCp/23/CADDAP4AGwC3/rD9gP3a/kMAPAECAdH/Gf+U/i7+Hf7q/R7+Pf5o/R78Jvs5+xr8+f0ZAVsE7QbWBkAECwHz/lb/4QAiAqsCTAIZAnUBBwFiAO7/AAAXAF4AGwBW/1b+rP2C/s7/SQGmAcgAnf+F/sP9nf2q/QX+P/5Z/XP8c/tg+/37q/3GAJEEWgdDB68EZgFG/57/qwCRAdABlgGsAWgBKwE+AIj/Wv/R/6AAsAAKANj+Sv5t/jD/RACOALEAQgCU/33+4P3H/Sr+4/1J/Vv8wvvx+zH91v9PAzYGwgZJBZ4CUgDI/zkArQDXAM8A8wBHAW0B+wABADz/Ef9Q/4r/Xf8Y/6D+nf40/7P/MQBzAG8A9f80/4f+EP6K/d78VfwK/Ez8Wv3d/9EC0wW+Bo0FeAP+AOz/9v9BAJQArACFAJgAqwB/APb/Zv82/yb/Mf82/zz/5v6l/u3+RP+I/+z/IADp/3z/Hf+m/sr9K/2N/Fz8evxm/aD/pAKoBfgGKAZOBPgBbQA1AB4AhADqAPcAFgEjAeQAKQBp/9j+vP7T/tj+uP4h/gr+Yf7E/kj/uf/e/83/cP/N/vf9Iv0//OD74vvL/MD+uwHsBAIHzgYfBegC7QBDABcAUAD4ADABeQGZAXYBxwDQ/xD/uf4M/zP/Iv+b/gf+AP49/rn+1/4u/3j/w/+T/+r+9f1B/Iz7KPve+7L9bABUA0AGRwdMBokEQAK4AK4AiQDuAC4BGQEtAT0BeAEbASQAOP+d/o3+r/61/qb+kv53/j/+Qf6w/gj/P//w/n3+NP3c+yz7HftV/IP+VAEzBIUGpQaPBbYDfwHEAH4AhQAGAVUBkAGNAZsBeQHGAAUAQP/o/qH+kf6j/sv+9f7S/tD+2f73/iX/+f6r/qj9bPyT+1f7Jfzo/YwARgNgBQwGTAWQA6IBgADN/5D/FgCNABoBYgGGAXYByAAuAIj/Qf8I/9/+5f7J/tj+tv6Z/rH+4P4h/wH/6P4N/rb8uvsM+3z7H/3S/xUDsAXgBmkGtwSCAukAAwCb//3/cADxACwBPwFrAQwBsAD9/3v/9f68/s/+9f4C/8/+tv65/uX+D//9/rP+s/2z/KL7Ifue+4v9aQCZA/MFqwb6BSgEQALcAOz/h//z/2UA6wAVASMBKgHAAD8Agf/w/mT+UP6S/uP+EP/r/tz+5P4b/yH/9/5r/mb9Z/xv+y/7hPwW/1wCWAXPBssGkgWjA34BBwD5/t7+mP95ACcBWwGYAWYB5wAqAEL/pv48/lr+sP7w/g7/Ev9D/23/g/9X/9n+2/28/JX7xvpb+7T97wA4BB0GeAaXBR4EJAJjABL/av4M/wYA5ABpAZ8BwgFgAaYArP/l/pL+iv7M/v/+Cf8G/x3/Zv+B/1z//v40/h39yfuU+o/6hPzP/2ADggVJBswFtQT2AuoAa/+4/kD/HgCMAP4APQFWARsBcgCQ//7+1f7h/ib/Qf84/zf/QP9o/5L/dP9Z/+j+Av6S/Fj7TPv4/Mv/wgKQBJ4FmQXCBBAD/ABJ/9L+FP91/+T/jAApAYUBLQE8AE3/wP48/hj+SP5//vD+d/+T/9H/w/+S/2z/2f7s/aH80vtQ/Dn+vwAnA5wEjwWmBb8EBgMSAbz/M//z/sL+Hv/r/7UA/QCrACoAs/87/5T+OP4W/ir+mf7r/lH/o/+x/8r/c/+R/kP97vtr+6D85P6JAe0DRgXxBaEFTgRiAqgAjf8L/9f+AP+3/6MANwEtAdAAQgCx/+j+Kf7x/Qj+X/6y/uT+Of9n/0v/Kv+Z/s790PzV+1L88P0sANMC1gTwBWEGvQUxBEoCsQBt/63+kv7n/sn/sgAKAQcBsAAYAFb/ef7R/ZP91/0n/lf+qf4N/yP/Mf8B/1n+lf2O/Ef8V/0b/4cB6AN/BUIGFAbRBCoDcQHp///+3f7z/qD/gAAGAUEB3QBKAG7/gP66/WH9U/3D/Tj+sP4y/0//Pf///nv+2/0M/Wf88/x4/nUA2QKxBOAFOAaEBRQEZgLOAHP/4v7M/v/+7/+JAAwBDgHSABIAGf9Z/qX9iP2n/df9bf67/tj+4f6t/i7+h/3P/Kr8bP3O/s4A2wJsBJAF2AVKBSgEvQIyAfL/R//G/vD+eP8MAH4ArQCRAPD/SP+F/vH9vP2k/df9Kv5S/nb+kv5b/gT+Rf2k/Ir8M/3Q/uMA+QJgBLoFEAa9BdQEagP3AbMA0P8z/zv/if/6/5QA5ADiAH4A4/8H/1X+4/1z/V39kv25/eH9Bf4H/ub9Zv3q/Oj8dP3V/sYAqQIcBEAFtQV5BaAESgPOAY0Al//0/tv+CP91/w8AbwCOAFAAyf8i/4P+Hf7D/aj90P3//S7+VP5I/gD+df0D/QD9t/0C/7wAjAILBBYFiAVoBaQEfAMeAsIAs//e/pX+vP4Y/7D/LgBwAHcANQDF/zH/w/5a/gH+/P0A/hf+LP4g/un9hP1C/Vf96v0I/20A+AFfA2wEEQUoBcAE7gPMAocBRwBG/6r+Wv5k/rT+EP9o/6z/vv+Z/2f/Df+w/lj+Jv7r/d391/3S/bv9fv2P/fD9uf6v/7QA2AHFAsQDQwSCBEkEzgMiA0kCdgGaAOb/Sv/h/qv+f/6F/of+mP6z/tT+8/4G/xH/E/8f/xr/KP8z/2b/k//C/+v/CwAeADYAPwBNAEQATAB5AK8A2wAdAV8BgAGnAaYBggFNAfsAoQBCANj/g/8s/+/+v/6g/pr+nP6u/sf+7v4V/y//Yv96/5z/s/+p/7n/qf+r/77/sP+3/9P/2//s/xsAbAC+APIAMQFhAYwBpgGaAX8BYAEhAcsAgAAuAOj/lv9W/zP/FP/8/un+6v7i/uj+9v4O/yz/RP9v/4b/mv+y/8T/1//5/wIAEgArAF0AjwDAAM8AAAEZAR8BLwElARYBAgHQAJgAYgA6AP3/0P+e/3D/UP80/xf/Cf/+/v/+DP8X/x7/O/9Q/1T/dP+C/5n/tf/W/wAAIABTAHoAqwDCANkA8AD/AAAB+wD+APEA2ADCAKQAdABWACoA8P/J/6f/kP9u/0X/Of89/yz/LP8x/y//Rv9G/0f/af91/47/rP/A/9P/7P8JAC8AMgBDAGIAeQCJAKMAqQCzAMMAzQDEAL0AoQCHAGsAWAApAPb/4P+6/5f/fv92/2z/YP9h/4D/hf+S/5z/pf+1/7L/q/+1/7D/tf++/83/0//t/wQAIgBDAG4AjACdALIAvQC9ALQAnwCBAHgATAAhAAQA6v/H/6P/lf+F/3j/fP96/3j/if+O/4z/lP+e/5z/lf+Y/5D/lf+a/6r/xP/X//n/DAA7AF4AfQCIAJkAsAC+ALgAswC9AKUAogCDAGUARgAsABMA+v/z/+v/zf+//7v/s/+m/6X/m/+L/5D/kv+O/5z/pf+w/8r/yv/e//H/9/8CAB4AKQAmACsAPABAAEMAPAApADEAKwAbABgAEQANAP7/AwABAP7/9v/t/+L/zf/A/8H/r/+p/6D/ov+h/6H/q/+y/8f/3//h////CQAfAC4AMgA1AD8ATgA6AEAAQAA/ADsANAAuACwAHAAVAA4A+v8BAPb/3//h/8z/t/+9/8T/wP+4/8f/1v/V/+L/8P8CAA0ABgAKABAAFAAZACgAIQAoACgAKAAgACAAKwAmACAAJQAiABwAFQARAAgAAAD6/+3/6v/b/8T/wf/G/7j/u/++/8v/y//P/9//7f/t//j/AgD7//f/+f8JAAkABwALABEAFwAXACIAKgAlAC4AJgAhABcAFAAVAPr/AgABAPz/7//q/9n/zf/U/8n/yv/P/9T/3P/m/+//6v/v/+v/9f/2//T//P/5/wYAEAAgACAAHgAYACAALgAoACIANgA0AB0AGgAXABMAEAAIAP//5//m/+j/3//Q/9P/0//E/8n/x//O/9b/5v/k/97/8f/5/wMABAD8////AgATABIAEQAjACEAFAAaACsAIQAZAB4AGgAAAA8ACwD9//P/AgDv/+D/9P/i/97/2//Y/9r/1f/X/93/1//l/+3/6P/n/+z/+f/u/wEADAD4/w0AFwAcACAAIgAqABsAFAAaABgADQAVAA0ADAAOAPv/CAALAAMA+P/x/+//4//n/9X/3P/c/9//6v/p/+3/6v/k//3/9v/y//z/AAABABAA+f/5/wcA+P8HAAQA//8XAAMAHgAKAAAA+v/5//P/8v/y//z/4f/t//3/9f/2//3/4P/0/+n////z/+z/BQAAAPn/AwASAPj/6f/+/xIABgAgAAcA8f+SAI7/7f8AACoA3P/8/wMAvv8DAO3/EwDg/w4A8//4/xIAAgAWAPD/CwDy/5wApQD7/+f/8v/1/+b/KwH9///+3v5V/+P/fv8xAJL/tP+g/yYAYgBBABEAFQBeAD4ATQAuAEAA9v8cAPT/+f/j/+z/7P/g//3/4P/a/73/tP/0//j/DwD3/wcAAwAWABoAEAAOAAgAFQAHAC4AEAD///D//v/3/8n/+f/s//j/DwD9//L/EAAHAPn/AwAJAPj/8P8NAAIA+f8HAPj/6v/w/+//9f/M//L/0v/O//T/DgD///T/QgA7AOX/1P8ZAL3/wv/y/wQA8f/1/xgACgBOADsAOgBqAEYANwD6//P/9f/i/+P/5f/f/87/3f/U/93/7//r/6X/wP/T/53/xP/o/1YA6/8LAF8AfgBVAIIAmgCJAE8APwB4AEYAKwA9ACgABgDO/77/n/92/zX/7v6j/tH9ef1Y/QT9WP3z/VT/4QAlApwDmwT/BAIFNASIA0sC+ADh/9r+lv5E/lP+n/78/nv/qf/X/9f/g/9S/8v+/f1g/TT8lftO+7b68frU++f9NQBmAvYE3QYWCAkINAclBt8DmQGi/xD+KP23/A39wf1x/nf/XQDYAOoAqAA4AIP/Z/5o/V38RPto+sH5YvnC+Qj7ZP3WAKYDfAbzCCoKywnACM8GAQQsAZr+8PwB/Gz7h/yq/Rn/rwDaAYACUgKbASYBo/8Q/tD8+/v7+ir6KvpR+nD6/fok/WAAKAN2BZAHBAmjCCAHrAVvA7cAoP4p/YH8/vuA/AX++P6LAAIC2wKzAg4CdgFBAKH+P/3N/M37BPu1+rn6j/p9+j77Xv1gALwCJAULBw0ItQdTBioFDgOqAF3/C/5l/Sn9nP3O/ln/tQD5AU8CHgKRARcB/P+K/rH9cP2Q/Mz7avtB+w37FfsA/EH+BQH6AlUFFgcYCI0HJQbqBK0CVwDY/pv9KP0a/Zr9vf5x/3IAlQH0Ab8BFwFzAI7/Sf5U/QT9kvzm+5n7h/s/+zT7nvvc/JX/yAEQBMYFFQdvBz0GWAXwA9UBEgCf/ur9bf1U/Tn+6v69/+kATgGcAToBswAwAAr/CP48/QD9V/zH+8/7hPt7+7j7o/w+/zIB7AIwBX0GNgdwBrAFtASIAsAAVf9P/rv9FP15/R3+oP6i/8wAXgG7Ae4AjAABAAH/GP5W/bH8jvzy+/X70fs4+4v7M/zN/sAAOwKWBNcFtAZQBv4F4AScAVIBcACB/4r/Of/D/7j/8//FAMYACAH6AP3/fgAUANz/kf9L/zT/y/76/vD+//4h/zn/eP+I/7D/4P/n/+//4//i/9H/x/+2/6D/eACEAF0CuQH5/7H/xv5B/n3+w/7h/rv/dwAYAQIBCAH2ALQA1f/w/jv+6v30/Cz81fsz+zf7dPtj/P3+tABjAjQEaAU6BkkGRgbNBWwEegP9AdEAzf9//ur9xv2y/dn9mv4r/+b/0v/v/wwA8f9g/xz/ZP7b/bj9h/2Y/Zf9EP51/vz+0v+NAPwAgAHpASQCAQIBAl0CzgEDApQBmgFpAbkAhgAcAND/nv9L/7j/if9U/63/rP+z/5P/qv9k/0v/Rv8S/x//9f7Y/rT+lv6C/m7+cv6Z/sj+Dv9x/9j/MQDNADUBlAH9AWICiQKaAp8CegJNAtMBjAFIAckAaAD4/7H/PP/M/m3+TP4P/uv90v3b/d/93v33/Qj+z/3R/d/94/0b/mD+xP5s/xkA1wCFAVUCEgOKAxgEbwSkBJIEGASkA/YCHwI3AVoAlf+//hr+if0v/d/8xvy5/K780Pzp/B39GP0k/Tv9SP2F/ej9Rf7p/tH/tQC7AZgCkQOHBCkFlwXZBfsFlgXwBEYEWwNMAi0BDAD9/vL9L/2N/Br8xPu3+7r76vss/IL80/wK/S39UP1X/X/91v0k/qP+b/9OAFoBOAIpA08EJAWsBfwFUQZABscFDAUrBD4DCAK+AIb/af6Y/cT8K/zP+6r7ifuc++j7KPx0/MD86vwT/Sj9OP2U/eL9dv5e/0oAdAGJAnsDlQSBBe8FPwZpBkgGuwXqBPADxQKNATAA2P7R/Qr9O/y7+3r7Y/td+4P7vPsQ/E78lPzo/CX9Wv1g/Xj97v1I/tz+4f/PABgCOgMsBFAFDQaDBrIGuAaABugFBAXiA7ICbwEnAMz+5f0q/Wv85/u0+5n7iPul+8/7HPxd/Kf85fwl/XT9Vv10/dT9Mf7D/rT/oADbAQYD9QMbBegFYQafBo4GSwa5BcwExAOYAmcBJQDg/t/9GP1Q/N77g/tN+0L7jfvA+yn8mfzq/Ez9hv2f/Yn9j/3//Uf+zv65/70A4wESAwMEAgXnBUoGeAZxBigGtgXsBNoDzAKZAXEAK/8U/kr9iPwC/KT7XftA+1j7nvvj+0j8j/zZ/Cz9aP19/Xj91P1Z/tT+mf+GAI0BrwKpA7IEdQX8BXAGogZhBvwFYwWDBJwDYwIdAeH/sP6w/YD8y/tQ+976o/qc+tv6HvuX+yf8yfxp/eX9af6w/uL+0f7U/j7/kv8vAEEBNgJNA2sEMAX4BXQGegZBBvQFKQVNBD4D/gHGAIL/Y/4v/TX8nvsA+6T6iPqu+t/6Qvvh+4v8SP3h/Xv+7f4p/zP/I/9t/8P/TAAeAfABBQMdBPcEpgVSBp4GbwYxBqUFtwS4A3UCMgHZ/33+QP0Y/Ev7rvo5+hT6QPqM+v36q/t7/F/9Gv7D/lP/j/+m/23/Ov9r/6f/NAD+AO0BBgMNBN4EkAUWBkAGEAbnBUMFZwR+A1ECKQHb/6X+cP1T/Hz79/qI+l/6ovrY+lP7APzH/JX9P/7u/lD/dv9u/yb/FP89/4H/8f+4AKsBxgLqA9wElQUJBkMGSQbgBSsFZQRoAyoC+ADD/1/+Lv0j/Ff7wvpf+l36l/rr+of7NPwI/cv9eP4O/1j/d/9X/w3/2f7j/v/+ev9YAHYBzALqAxAF4QVbBpEGuAZJBo4F0gTKA4ECVgHn/5f+YP1O/Hb76/qa+pz6zfoy+7/7dPw0/dj9df7j/jz/Sf8w/+b+kP6D/mD+tv5b/1EAhAHvAhoE4gShBQEGOgYRBqYF2wQPBA0D0gGpAFD/H/4L/Rb8Ufvw+r76zPoj+5v7L/zj/KD9Uv7w/mD/wf/7/+z/uf9u/zX/F/8q/6f/TwBeAbwCyAOUBD0FwAULBvsFqgUUBUIEMwP6AbkAgf8y/jb9XPyd+z37B/sF+0r7pPsG/KT8Tv3v/X3+/P5n/7b/wv+4/4X/Sv8x/0H/nf81ACgBQgJOAygEuwRtBagFvAVtBdQEJwQpAwoC7QDF/4X+e/2o/Ab8r/uI+2j7jfvd+zz8v/xy/QX+jf4O/13/uv/k/8D/h/9A/xX/Pv+Y/zAACgEeAigDAwTKBKAF8wUKBgUGZgWjBIoDLgK4AC7/Af6O/Af8fPt0+6T7qPsI/H783Pxm/Qn+b/7O/ir/Wv+K/zj/1f5u/u/9gP3F/aD+3f/GAbADbQWNBvgG6waPBmUFJAQPA4EBQAA7/0b+6/18/Yr9Y/2Q/df92P0X/uH9wf21/e79IP6N/uj+PP95/4L/j/83/zz+d/2y/FH8kfs9/Fz9/P+cAisFTwdHCG0I8QfkBvMETgOoAdj/uv6y/T/9UP10/dz9Tv7w/gT/DP/k/j7+s/2C/ZD9uv04/rD+Mf82/y3/Kv9Z/k/9r/wP/Eb7ivpZ+xH9lwDxAwsHPQnXCV4J0Qc5BuEDLQKaAH7/9/5q/nn+ov7V/h3/df+7/2r/J/9o/tL9Df0A/UX9zf3+/tP/agBWACAA0v98/kL9l/wW/DH76fqD+/38wgByBMIGVwnECbAIlwY/BO4B5P/A/n3+tP7Z/kP/tP/P/9b/EADB/y3/mf7D/Sj9gfyv/Ij9Qf7B/8AAMwH3AF0A8P9//pn97fyl/PH7ZvuY+zj80/2+AdkE+wbiCIQIIwcLBfkChQEqAKb/1//m/9T/zv/Y/53/Sv9O/83+SP7f/Ub9//zM/Er9F/7q/jIArwAXAYYA+P9+/0z+0P0E/bj8c/za+zz82fyf/8MD+wUWCL4ILgdWBSsDLQJ1AdAAHAEsAagAIAC//2j/yf6i/u7+ev5I/mj9rvwj/Fn8ZP1G/rP/rgD8AMwA4v9g/9P+Nf4L/r79Jv39/ED8wPtT/Kf9DwIgBlsHegioBwcFZgLVABYBrwD3AOgBjgGpAJr/3v5O/hb+eP7P/pL+B/5u/ef8xfzi/Zb/3ACpAbIBeAAs/zD+jP0O/VT9lv1g/V39hPx3/OH8K/8YBUoHQgc1CPAF5gLNADoAKAESAeUBYAKBARgAP//B/mz+3f4t/zP/nv6Q/fP8lfwt/aL+QAA3AUMB9wDR/53+Ff50/S39iP2D/aT9xvwU/HP8ivyBAUIGcAbVB5QHDQXAAnIAtQBlAX4BswL1Ai4Bs//l/hD+Hv6p/jj/P/9Z/o/9Sv1F/aX9J/+JAM4A8QClAIj/ov7w/b/9Av7r/Sn+5f1l/Ob7z/uE/aYDTwbTBkkIewbKA3kBCAAgASsBjgHvAtcBcgCw/53+VP6G/tD+Ov8z/3r+EP4s/sD9Ef52//v/qQAqAeD/0f7j/dv89fwh/Wb9+/0V/e779vsK/LkAYwYbBloH9wdVBIkC+QA8AOsA6AAnApYCHgH//xr/Kf5v/aX9vv5x/zj/ef6F/tr9kv0F/+L/HAEkAs4Aov+e/if9jfyv/Bf92/1L/ev81PwS/fAB8gb9BQAH6gcwBPwBygCr/1YApwCxAWACegFLAHH/z/7A/fb9C/9e/6L+Uv7L/c38Zf2V/qv/bQGdAfoAXQDq/rL9Jv0I/aX9xf1a/Q39k/wM/5gDMAWFBXkHpwV/AjgBlv/U/7gAWwHDApECPwEHADf/SP6b/XH+bv+g/yH/qP6b/fj8v/18/gQAugDgAO4ARv9M/sP9+vxV/U392PzE/JT8PP1aAXIFawWWBiAHmwOOAQkAVv+jAAsBQgJKAx8CwADI/4j+Cv6z/TL+yv6k/vn9D/4h/mr9If63/+n/2ADKAPP/5v+r/tD9o/2l/ET8rfzp/Dz/gQTbBW4FpwYhBWACBAE1/4j/aQCeADkC7QISAsEB9ACl/7H+i/5W/hT+r/3V/WH+zf0c/vD+RP/s//P/f//O/xD/JP7r/QD9Xfyg/Kj8nv21AmYEqgNWBt8FdwOnAqIAx//bAMr/iQBCArQBqAFnAR0ARP/f/ov+R/7g/Qj+K/6o/U/+hP7G/sT/pv9p/83/Jv+M/lb+cf3W/B79AP3H/QQC6gPjA/UFMAZQBAsDQAEkAGIAYf+o/8YAigA8AT8B8wC3ACb/mv79/VP9gf1b/ZD9LP5L/ub+sv9t/2v/rv8o/8P+kP7m/XX9GP3A/Jj+iAG2AiIEDQYlBvMEoQPqAdYAHAD2/kX/4f/n/zoAuwDuAD4Axv8m/57+Af5A/S79Rf1G/e79sP7y/mT/w/+p/3//O/+t/qP+Tf5A/rH/HQH4ASMDPgT7BBgFZASfA74CzAG6ALn/U/8D/yj/g/+P/63/x/9y/xX/gv4H/sj9e/0s/Xj9zf34/Wn+t/4y/5//q//N/97/tv/2/xAAQwABAdgB3gFVAuUCwgKfAk0C4wF+AfMAaQAzAO//dP+D/1n/Qv8t//j+7v7c/sL+wf6g/pP+r/7B/ub+JP8p/4D/zf/b/zUAYgBhAH4AUQBAAEsAQgBQAFkAcQCcAJkAugDJALYAoQB6AEkAJgD0//H/8P/b/wgADwDh/+z/2v+r/3z/Nf9I/zX/LP9d/2j/jf/3/wUAEwA2AEoAVAAzAAAA+v8EAPn/x//c/wEA//8RACoAOQBGADsAPgAvABYAAQAkADsAPwBoAHYAgABMABwAEwDm/73/rP+w/8n/5P/l//j/EAANACQAIAANAAIA6v/Z/9//9f/4/+j/7P8EAAMA7//H/8D/4//c/5j/ov8IAB4A1P/b/yYAOQADAAAANgAwAPL/7/8vABoA2P/g/woA///R/9//BAD2/9//9v8JABMA+P8JACUAFAD8/wcABAD0/+j/5f/y//j/7//Z/9b/7f/5//j/6//+/wkAEQALAA4ACwAQABEADAANAAgABAD8//v/9P/k/+f/5P/j/+T/4//m//D/9//v/+///v8DABEACwD4/wUAAgD0/wAA9v/1//b/AQD+////CQARABcAEAASACkAFwAQAB8AGAARAAIAAgAEAOb/5f/q/+b/2f/V/9P/z//Q/8r/3//u/wQA8//4/w4ACQD9/wwA/v8DABEAAgACAAkAFgAYABAADAAXACMAEAAXAA8AFAANAAwACAD///7/8v/o/+X/5v/o/9X/2P/l/9//2P/Z/+z/5P/6//j//f8KAAUA/P8JABEACgAOAAQA//8BAA0AFwAdAAYADwAQAAIAAwD//w4AEwAMAPL/9/8JAP7/6f/r/+v/2v/Q/9f/4f/h//H/4v/1//j/8//x//j/AwAEAAAABQAIAAQABwAQAP///P8JAB4AEwABAAIAEQAIAAUADwAIAPf/+/8AAEQAkABjAHL/Wv8hAEMAgv9G/9//HQDE/43/6v8gAFQAGwDE//f/CQDq/77//P8TAPf//f8YADcAJQA2AAwACAACABUA///l//b/9f/6/xwA8/8iAPv/AADv/xAA+f/u/x0AAQDm/wAAFQDO/8T/+f8IANj/5f8BABEA8P8bABMAGwC+/+T/LwAHANn/3v/I/wYA/f/F/77/OgB/ALH/0f9/AF0Atv+U/1AAJwBEAMX/UP9dAGYAsv/E/yoAMwDq/83/BwAyAAIAn/90APf/fP8PABsATgCH/8f/gADe/8T/FQAnAOb/qv8IADAA3/9F/+b/vQCz/2r/SwC5ANb/Bf/l/xEB8f/8/vf/NAGI/3L/GgDpACAA+v78/8cA2/9N/wAAtQD0/1L/7/9QACwA2f+f/20AYwA0//f/dQAxAMz/n/90AJgAVf+w/3MAhQCA////FgDg/+b/mP82APT/v/8UACwAFADF/+j/XAAhAFX/KQBoAAgAw/+o//MAXADR/vP/FgB1AIb/V/+cALcARf/L/0AAbQDQ/xD/cACQAID/rP8hAO7/yf9A/3gA5P8BAEn/FADDAHX/WADg/zwA7//d/18A+P/m/5IAH/9fAFIAwv8oALP/HgCBAEn/EQARABoA1P8xAB8A6/84AF3/bwAaADoAx//P//P/jABf/2b/lgAoAOD/kf8iACcABwDD/0wAAQBOALr/BQAbAOz/CADG/xwAGwDm/wYA4v8TABQAyP/v/14AEQDA//T/GwD//+D/gP+uAMX/1f+t/1cA3f/Q/53/LwAcAOL/jwA3/7EAIACf/yMAoP8pACkAlP87AA8Asv9KAM3/IAD1/8D/MwDl//X/DADI/wIA2//w/2kAg//Z/1QAzv8dALv/ngB///H/IQD+/zwArv9fADEAvP8iANr/8v8mAMb/HQDo//z/HgDY/woA8v8GAP3/+P8MAOf/BQDz/z8Arv9gANv/FACZ/yMAVACH/wAAEAATAOT/uP8xABAAsP84AMr/NgAoALD/MgD7/8j/HwDv/zAA2v/m/ygAyv8CAPf/3//D/yQA9v/s//b//v9QAML/KQAfABIAuP/w/4QAsP/U/+7/AwD8/9n/BQAQACwAwP8hACwA/f/6/+v/CAD+/+z/0/8iACMAqf8TAAsADgCy////OAD8/wkA4/8iAPn/4P/X/y8A//8GANb/EgAJAOn/z/8iAA0A7/+//xkAHgDm//T/CgAYAOT/z/8jAA8A4//y/xYACgALAN7/DwD//8b/IADz/yAA4f8WAMz/QAAXANT/FAD0/wMA3/8XAOj/9//t/wMABQDj//3/IgDa//j/CgAAAN//7v8CAPP/9P8bAPX/+v/v/9T/HADq//H/MwC8/yQAy/8xAB4Ax/83AMj/8v8NAOz/9f8UAAMA+P/7/+//BQDv//r//v/y//3//v/m/xIA6f/y/w8AAAD9/wYABwD6//z/9f8PAEcAmv8bAAIA1P8QAOT/EwDk//n/9f8rAM3/CwAgAP7////9/xUA8P8NAOr/OADf/8H/IwAoAMb/+f8RAPT/vP/+//X/KgDZ/xEA5/8DAMj/GgAIACYAAAAWAAcA4v/m/9L/IwAOAAMABwDU/yEAiP9aAOP/+v8QAMP/GADw/93/AAAgAPv/BADS//L/8/9IALX/XwDt/wQA9/8aAAAA4P8RAOP/KgDT/+b/EAD2/wIA6//1//n/6P/x//T/AwD7//j/7f/3/+D/NQAMABkAAQADAPL/9f/9/yAA8P8OAPH/IwDJ/wYA/f8CANf/8v/s/wgA9f/4/wUA+f/Z/x4A4P8NACIA3f88AND/CQDs/wcA8P/s/wIA7f8QAO//CQAWAOj/DgAFAPL/9f8JAPv/+P/1//P/+P/2//j/9//7//X/AwD4//L/+//3/9//EADQ/woA2v8aAAUA+//u/w4AAADr//3/9/8RAPL/4f8kANb/HADW/zoA0P8vAPD/+v/w/wsA4v/9//n/CgABAN7/HADu/wMA+P8BAAcA7P8QAOT/EQDu/wEA5/8FAAoA6P/1//r/CAD2/woA1P8aANP/GgDf/xYA+f/4////BAAEAPj/8/8CAPr/CwD1/wMA3/8cAM3/HwD3//b/AAD4/+3/+//5//j//f/x//v/CgD1/wYA4P8YAN7/DAD2/wYAAAAMAPT/FwDw/wUA/P/w/woA9P/z//7/AQAGAOr/+//h/wUA9P/+//7/+P/s//j/AAALAOj/AADz/xIA5/8PAPL/AAD2/wgAAgD5/w4A+P8AAPf//f/0/wsA9f////z/BAD2//3/AQD1//j/8v8CAPv/CQD1//z//P/4//v//P8HAPP/AAD3/wAA7v/6//H/7f8AAPb/CADu/wAA+/8EAAEAAQAAAP3/CAABAPj/BQD8////AQAFABoA5//0//X/+////wUA+P/r/+z/+v/7//j//v/w//3/+P///wEA9P8DAAMABAAHAP3/AAABAAAA/f/2////7//8/+z/AAAHANH/BQDr//3/CgDv/w4ACgD3/w0A5P8FAAIA5/8DAOv/5v8HAGoAkQDg/rIA3f6bAMj/EADN//v/if8lAD4ABgDR//b/DgAhAPr/BgASAAIA///6//H/BgABADEAEADt/+//9P8GAPn/IwCY/zQA2/8aAAMAAAAHADgA5v80ANb/bACp/0AAvv8qANX/6v/1/9//BQDV/wQA0v8NANT/AwAAAP///P/s/xgA+/9P/1sAzf8/APD//P/+/97/CQD0/ygA3/8SAOD/CQAIAIEB4v8m/9AAK/+DAEgAcgDw/nn/8f8FAEMAwf9AAKr/+P9R/0IAVv/rAO3+EwHl/ggB/f/f/0EAsf9ZAIT/SQC8/5b/SgC+/zsA6v8NAA4A9P8AAP///f8JAOf/BgDB/+IAaAD//jsByP5SARz/WAD6/58Ae/8BABYAcwCT//7/Qf/wAC//NgDU/+D/5f+1/xcAuv8QAAn/nQCT/ycA2v8oABUApv8XASD/lQDp/k4BRv89ATD/PwDl/xAAHACR/2b/nQD3/ikBKf9VAM//6P9l/wYBKv9M/8IAbv9WAJf/dgDO/w8AvP9uAL//8/90ANr/hgCm/ywAEgAaAFz/9QBm/24Ahv+HALf//P+a/zAAcwB3//D/CgAnALX/BgBAAKr/TABQ/7YAWf8yABMAOgDo/8//TAAPABsAvv8IAJQAM/9aAIH/YADK//n//f8FAAAAkP/5/x0A+v/i/63/rAC1/8T/HAAJAAgABwCg/3QAk/+x/2AABwALANb//P/C/1UA9f8rAPn/cwDN/4f/iADd/+n/5/9wALn/BQDZ/x8AFAC6/xwA+f8HAPP//f8CAAUA/P/4//7/9f/+/wQA8P/3/wMA8/9IAAAA6P/8/+//EADj/0AAxf/0/+//QAC0/0gAs/9eALv/KwBw/4YAtP/q/+3//P/I//P/KwC4/xUA3f8VACAApf8VAOv/BgDU/wsAuv9gAMn//P8LAM7/+v/Y/ygA9P8QAN7/JQDS/1gA0/8AAAEACgAYANr/AAD3/xoA6f8QAPL/vv8kAOb/BQAFABEABAD1//b/9f8RAPz/1/8KAEMA1P/d/xAACwDw//j/EgD0/yIAtP8oAM7/FwDy//z/+P8uAPP/+P8MAB0A+f8fAKz/HwDL/w8A2P8pAOb/HAD0//P/+/8AAO3/EAD6/+P/8v8iAPX/AAD8/9n/EAAiAPr/3/8IAPz/7P8AABQAzf/t//n/+f/2//v/AAD5/9X/AAAAAAAA9f8eAOn/FgD6/wAA3/8WAPj/8P/z//v/BQDw/xsA6/8cABcA7f/y/9X/BgDx/+P/AQAHAPb/8v8GAPT/+//7/////P/6//3/+//7//X/9/8MANL/8f8AAAgAAgDk/wkA9v8LAPz/DwADAP7/IQD4/wIA+f8YANn/CwD6//3/9f8CAPv/9f/f/wEAAgD7/wMA+/8XAPD/GAD8//b/9P8KABAA6P/y//b/5v/2/woAAAD5//3/CQD1//j/CQAHAPf/1/8QANr/JgAOAOj/CQDi//T/7P8CAPf/AgAAAPj/CwAZAPn///8BABMA8v8QAOf/5//w/+j/7v/8//j/7/8IAP7/AgAOAAcA9v8DAAsA/f/u/wcA+P/1/wUA8v/k/+3/FADu//L/AAAQAAEA5/8AAAsA/v/+/wAAAADh/wkABQDu//f//v////v//v/+//H/AAD+//7/6P8JAA8A9f8PAP3/BADZ/x0A5v8QAPX/BQD1//3//f/x/xMAEgD3//n/7v/6//X/+f/1/wAAAADu////7P/y/93/7P8FAAcAAgD//w8A6f8OAAMABQD9/yAA9//u//z/GADv//j/+P/9//n/+v8NACIA8v/4/wcAEQAWABwA8P/x/8z/7P/y//D/9v/h//T/2//8////9P/9/wMA/P8OAPv///8BAPL/AADe/9H/6P/4/+j/BwAIAAcA6P8YAA8ACgAdABcAGADh/+r/AQD9//b/CgDy/9j/FAD2/+r/FAADAPv/AgD5/woADAD9////5P/3/wIA8f/V/wMAEwD4//D/AwD+/93/BAAZAC4A4f8IAPz///8JAOT/CQAHAOX/CwDw/+//FwDt/9X/GgAOAB4A/f/m/+7/BgDz//b//f/x/+z/5v8oAP3/zv/+/yYAEQABAPj/BAD3/8L/5v/q//b/6v/W/9H/NgALAOD/BAAhAAgAHAAlABgAGgAdABIAEQD0/+b/BgD6/+T/BADs/9r/BAAbAOX/6P8eAPL/x/8bAAYA6f/3/wMA0f/6//r/8P/z/wAA6f/5/xUA9/8LAAUAGQA6ADMA5P+n/7L/pf+V/+r/0/8lAPf/FQDj/yQAGgBlACQAMAARABsAMAA2ABAA1f/R/+H/5//6/+7/5/8BAOb/6v8cAA0A7f8DAAoAIAAQAOH/5f/8/wAA7//9/xIA+f/g//H/AgAQAOj/BQD5/+//1f/k/+D/+//U/9b/4/8RACEADQA2ABwA6P/+/xcADwAMAAgAl//+/wAA+P/1//////9AAEoAAgCQ/1H/vv/T/w4A8v8lACYAGQD+////IwBLAEMAHgAPALn/wv8JAGAAHgD9/9P/FwAHABAA/v/2/zoAQQDk/9X/zf/r//r/DwD7/+j/5v+k/9r/0v8NABYAGQA4ABAAw//R//n/NAAvAAAACAAtABEA8P/k/+7/8v/z/xgA9f+0/87/6//j//3//f/t//3/+P/7/xgAEQAAAOf/kf/N/83/qv+q/7H/FwBdAFAABQDX/wwAVgB3AHsACQB9/2MAFwFoAtUCuQF0AEoAv/+A/w//9v6Y/5P/TQDl/2D/+v3N/Xf+WP4G/hX+vv2j/pv+aP2N/Ej71Pvq/QYBGAWTCJgJNAiLBKAAF/4E/av9X/8EAVgCVwPoAqIBWAAG/7r+qP6k/un+D/9I/23/Wf8x/+j+1P5I/hj+M/62/nb+cf3C++b65Ppk/Pv+iwIsBl4JiQnBBj8CCP4f/Hz8Zf7JANkCEARKBPgCvwDI/r/9Dv7Y/gwA2QANAcgA2v/U/vr9Dv5z/hX/rf/9/+7/uf6Q/Of65/kz+mD7Qvzh/RUBDQVECbgKEQhEA2D+tPyv/d//4wEBA4YDnQOwAoYAQv5g/Rz+7P9vAewBQgEUANb+8/1Y/YP9yf5FABEBQQB9/iX8+/qD+jD7g/1W/rX+K/3z+tj8NwGCB0AMWAoRBQP/xPsu/Vf/VwE/AocCSwMhAx4BlP56/Qv/ygFtAyEDQQFd/1X+3P2d/Zb9B/+rAEYBuP9x/cb7I/xH/Xb+qv67/gL/9P2h/Kf6nvpF/pUDtQkvDFcIKwJX/K76l/2xACcDtQSGBDcDIgHe/VL9P/6cAL4CTgIKAZf/LP7i/ar90/0h/5QAggEGAQv/Wf0L/R79cv5C/73/Qf9U/nv8gvs2+zL7f/2qAJkE6wjfCB8FzP9++9j8hQBeA/wEUgTHAnQBZf84/qf+0v8hAtwCzwF0ACr/bP6x/qH+B/+b/8f/6//n/qj9Q/2c/T3+9/75/v/+Vv6n/Sf9efwY/Rj9Vv0//8UBfwZrCUwH3QKa/UT8nf9dAmwEXgSBAm0Bxf8z/nf+Yv/3AAECFAGT/5z+1/4o/+/+IP+p/0EARwCV/5T+H/5g/gX/Hf/r/rT+i/4I/nD9FP39/OH9vP1D/e39aADaBbcJTwhuA5/9TPwF/8ABqwO2A2YD2QJPAOb9qv2H/8gCbQNpAQ3/jf3l/Sj/vv8QAG0AgQAIAND+DP6B/jj/Zv/z/hz+6P0Z/kT+EP6w/cf9eP1q/V39Rf1T/j4AEgQrCGcIdATQ/p786P4lAuUDrwMsA3wCCwFI/0L++/43ATECZAG//2X+Xv4y/57/ov/f/9T/b/91/nL98P0A/4X/QP9e/pD9Z/2o/d79Ff5Y/g7+0P07/d/8/v2YAFAFcAmoCKcD5f07/Ov+RAI5BEgEpwNZAi0ARf6s/UH/6gHKAtIBAQB0/lX+H/+r/wUAkQBJAFH/xv3g/OX9a/8SAL3/V/4J/aX8G/1O/if/Of+t/rf9nP2r/TL+kP8VAgYGNgimBaYANf0Q/owBDQS5BAcEiwKTAKX+vv3Y/mkBPAPFApYAa/5w/RH+Zf8nAM8AAgH1/4X+eP0d/Tz+n/8YAPj/5P5X/XT8qPwU/mf/jP/Z/vD9z/0D/gr+3f7IAKUEEghmB+0Cuv7o/VAA9AIoBCIEKQNvAVv/IP5W/jwA+QEtAu0AAf/o/Ur+4/5k/3IAhABm/xX+F/0M/XT+a/+n/4P/Rv4k/br8Q/3B/nf/EP97/hv+dv4E/pj9nv4QAp0HUApdB44BqP3e/VsAgAIaBBkFRgQ/Af/9mPzk/lsBGQJRAdX/wv5b/t79AP6c/8AAIQCS/kz9DP0Z/vL+J/+H/8T/Ov9K/vH8tv3//mr/Pf+p/hj+If0m/Cv8EAC/Bi8KRAhrAhT+gP34/jgBkgM4BewE9QHA/tX9Iv6l/2sBSwI4AuoAy/5u/b/91v6n/wkA5P9Q/73+L/54/eD9CP9yAMQAqf+Q/uj9q/0k/vX+Tv+X/9v+4P2W/fD8Mv5eBAQJtQgNBKr+JP1V/gMAHAJGBBcFQQNy/4j9pv2n/pUA5QEMAnABq//P/Tf96f3h/pX/9P+1/+D+MP5h/WX9lf4XACQBqwA8/8f9Av1+/c7+tv9DALX/F/7W/Jv7dPz4AuYIVgkPBkMBqf5T/tf+IQFsBP0FWATHAIr+OP5c/mD/5QDaAdYBnwDR/sX9z/1O/vD+qP/n/1D/Av47/tf+6f4w/yH/J////vD9w/3w/TX+yv4G/6X+Nv44/a38QwB+BcgHxgaWA00Bn/+X/pL/FQJ0BIwEEQL//yb/ef6u/rv/AAEzAT4Asf/H/y7/Zf7t/ZX+U/8w/xn/Xv/K//b+NP4j/qT+uv+Y/1T/Cf8n/rj94v0g/tH9Vf2V/MD+cAONBkEHxQVUA3UBL/84/jsAzwJRBH4DuAGiAFD/cf7u/s3/PgAxABUANwBc/yn+kv37/Y/+3f5I/+L/FwAG/1f+M/6D/mj/Ov9t/y3/VP4A/rj9+/3Q/X79MP0M/1ADrQWHBpwFqAPlAb3/l/4xAJsBAQP3AqoCLQLfAJj/cf9m/73//P99AJ8Aj/+f/vn9/f3b/eP9fv5u/5T/Ef/Z/p/+Wv6W/jX+jv6M/jf+Lf4s/jb+sP0x/XH9GgC/A9cFiAauBYYDkwG8/wb/xv9NAY8CUAMcA3kCCgHA/0X/DP9c//D/ZwCVAKb/o/6U/UP9tv0i/vz+xf/l/2j/4P74/Yz9WP1s/YT93v0J/kb+Kv66/W39zv07AJwDlAVXBroF9QM3An8AiP/U/0YAGAH3AdoChgIfAk0BHgAx/7f+9f40/8z/7v+3/+b+XP42/jP+lf5L/6P/2P+b/1n/i/7m/Y39bv2R/cr9F/4P/s39T/2I/W0ADgPHBCAG0QWTBOMCEAFWAPz/AwCeAJ0BSwIjAkcCjwGdAOL/aP8k/xP/Z/9+/yv/tv6F/ln+N/6J/nv+jP6s/tH+h/4X/uP9z/18/YD9vf3E/cD9b/1q/d//RgJKBDMGbAbEBR4E/gHaAAEArv8gALgAjwHwASwC7wEpAXQAKABr/9n+7f7S/rH+av5I/n7+Tv6R/rL+ff6o/sf+rf5a/h7+HP7m/fP9SP5h/gD+sv0i/dj+9ADIAhgF/QUfBkkFpQMVAm4AS/8Y/1D/NAAjAecBlQJUAgwCOQESAJT/C/+Y/nf+V/58/nn+hv6g/lj+Vf5x/gj+9/3R/ef97P3w/Tn+W/6x/Tz9Qfxc/a//DQF5Ay4FwwXTBcME0wNOAuQAVgDs/+//cgDmAKcBCQJAAigChgEYAXUAq/8U/6j+g/5I/kT+ef44/jr+H/6w/YL9V/04/VL9av3Z/cj9mf1e/aT8gf0p/xsA7AH7A3wEwATEBEgEMQMNAngB2wA9ADAAaACuABgBegGwAY8BOAG+ABQAbv/a/pL+Uv43/lD+T/5g/nf+Nf4K/uz95P31/fH9Qf5S/hH+A/56/aD93/6//9wA3ALYAxgEcARABI4DvwIHApkB3ACCAIcApACoAKQA6QAEAcoAmABOANL/Wf/h/nP+LP4V/gf+Iv45/iX+Jf4s/in+LP79/Tv+Kf7Z/Qv+uf36/VH/EAD0AFgCJgOJA70DqQOBAwkDQALSAVoBxACuAJ8ApgClAJsAtQCKAGAATgAJAMX/d/8N/8b+XP4U/vb97f0Q/h/+Tf6I/rH+wf7X/t3+sv6e/o3+k/4a/5D/8P+VAD8BsAEKAkQCZgJ9AloCEwLyAaoBSwEkAfUAuwCMAGoAWABOABcA/f/a/5T/cP8S/9L+lf5d/jT+Jv4z/kH+WP5+/p/+0P7u/hP/J/8z/0j/W/+J/9n/7P8xAIYAqQDYAPkALwFoAXwBgwGwAaIBigF3AVQBMgH/AMoAjgBnADMAEAD3/77/pP+D/0z/Hv8E/xD/AP/z/uj++P4D//z+8f73/g3/Qf84/1z/bv+p/83/sP80ADoAQQCUAKEA0gDxAPkAIAE6AS4BJgEVAQsB6AC5AJwAngB5AGgAaABAACgA5//O/6//sf9n/2r/Vf9M/0f/2v7z/jb/Ev8q/yv/Jf9t/0n/YP9w/67/0P+m/ywA//8DACUAJgChAKIA1QDkALoAyACXAKEAnACxAJEAiQCUAGkARQAnACUAAwDs/wgAEwCK/7X/sv+8/6D/aP+I/4z/jP9U/2L/mP9c/87/kP+j/33/uf/J/77/zf/p//3/EAARAEAAggAEAGYAHABoAGoAEAA4AGgARgAsACAAIQAnABwASgARAF4ABgABALT/PQD1/+z/CQDT/wAA0P+K/4T/sv8mAKn/sP+o/7j/3f9n/7j/8v/x/83/sf8wAPj/6//9/xwAEwAHABgAIwAlACwAVAAiADYAXAAGAC8AIQAwABgAIAAsAPX/DQAAANj//P/R/+T/4v/e/87/qP8PAML/+v/o/+b/6f+9////GwDP/7v/EAAAAPr/FAARACsAFQAcACEAGwAhAEEAGwAjAFsAFAAwAC8AAgAgAAcAAgAHACkA9v/W//z/6P/f/+n/AADB/woAEADG/+b//P/A/+v/6f/U/9r/8v/D/9H/8f/w/+3/6//Q//L///8jAPj/9v8gACAACgAGAAYAHgASAAYAFQA0AAgACwATAPr/BwAFAOv/9P8BAOj/4//t/+b/4//x/+3/6f/n////AgDK/+z/+P/j/8z/8P/z/9j/7P8EAN7/9/8DAPj/BAAVAAIAEgAGAP//DwANAAYA+v8bAAEA/P8ZAAEAAAATAAsAIQAEAAAAIQAXAP7/DQD5////1//4/wYA8f/Y//f/8f/V//j/8//f/97/8P/w/9n/9P/7/wEAAgAJAPj/BgAJAA4ABgD3/wkACgAVAP//BwAoAAUAAwAKAA4AAQABAAAABgAQAA8A///5//X/9P/7/+//6v/8/+D/5f/q//D/6v/1//z/8v/4/+3/+P/u//H//v/z/wgACAD2//j/AQD7/wkADQAAABIAEwATABwAFgANAAgADgD///r/AQADAPj/+P/3/+//6//q//f/4P/g/+n/1//e/+7/5P/g/9//2v/t/+f/6f/5/wUABQD+/wAA/P8QABsAGAARABgADAD8/wIA///5/wYADQAOAA0ACAAAAAEACQANAAcAAAAFAAwAAQAIAAoA+//3//L/7//s/+j/7f/1//z/+P/6//T///8dACwAHgAVABgA5f/I/7r/wP/S/+n/IQA3AGAANQAnAMz/kP90/0j/SP9S/4T/tP/S/+v/7f/g/+D/0//X//r/LABTAHIAcABzAGoAfQB7AI8AkACEAIcAjgCDAHcAbQBXADoALAALAPP/7v/R/8v/yP++/73/sP+d/6P/mP+Y/5n/jv+M/6P/pv+c/6//mv+i/8D/0P/k/+n/GABHAEQATwB0AF0AUAAYABwA/v/u/87/x//Y/+L/BQAFAA8A8f/6/97/iP9k/z//Bv/Z/rf+sv6p/pn+pv7U/gD/PP+w/zwAoQA0AdABVQKxAhgDeAOGA2IDSgMQA7gCFAKYAe0ANwCI//L+TP68/Wz9If3H/KX8mvyq/LL81fwJ/Sf9Xv2i/Qf+Xf7Q/p7/SgD/APkBzwKYAy8E4QQ4BTkFFAXYBEwEhgOjAsEBuwC4/7T+/v1Z/db8e/w8/Ez8Xvxh/KP82/wc/VL9mP3I/dP93v0F/iv+SP6z/lT////cANsB4ALYA4QEOwWQBa0FlQVvBf4EQgRlA5ECigGFAKD/tf7Z/UX93PyR/Ff8Mfxi/If8i/y//OH8Bv02/Vz9bf10/Uj9Zv2d/dn9e/4t/+7/KAFwAooDkwRQBcwFDAYyBjoGzwVJBVMEMwNWAmoBWwBj/2j+df3Q/Gz8Gfzg+6v7zfsg/F/8tfwk/XD9yP0k/lP+Y/5B/j3+cf6Q/s7+g/8iAB4BcQJ/A3IEVwXOBRMGTwaHBiEGcgVwBGkDKgLtAMP/MP4S/TP8hvv++qP6kfrH+jr7mfsj/Lf8Pf29/Tb+ef6V/pX+qf7U/vj+dv8IAJcApgG2AoIDZAQIBV0FmQXRBegFVwWSBLgDzQKXAY8Ai/9W/mX9tPwY/Lj7ZvtE+3773/so/ML8W/3g/Uv+rf7u/h7/4P7H/sn+6f5I/6v/PwA6AUMCUAMyBN0EYgXUBSoGQAatBfwEDQQOA9gBlABK/zP+PP2D/On7Yfse+xX7L/uI+/L7afwR/Zr9/P1R/qv+4P4I/9j+yf7s/hL/iv8bANcA2wHgAtUDqAQpBbIF/gUhBgIGYQWgBKUDpwJjAQ8A2P7B/df8JPyK+wP78voI+0X7uPsR/KX8Rf2r/f39Q/54/pr+oP5H/lX+mP4I/8H/dgBJAZMCyAPbBIoF/wWYBtEGCAdxBrkFrASpA2EC+wCD/zP+Lv1M/Jj75Pql+rj64/pP+8X7Rfz9/JD98P0//nj+pv7Q/pj+bf6G/sH+Sf/t/4sAcwGGApADhQQdBawFCQZtBm4GzwXzBAAE+ALfAYIAHP8M/hP9VPyM++f6pfqt+vb6dPvh+3z8Of3e/Uj+sP70/gr///7Q/pD+jv7E/k//5f+EAIUBqwLbA9MEhwU4BrsGQAcyB5sGpQVmBNYCFQFc/7z9SfwB+y763/nK+Ub6/PrQ+9H83v1x/u/+SP9i/zj/4P4y/rD9Ov1A/Zj9T/5k/+YAjQIYBHsFcAYwB2sHnAflBhwGOgVABLACKAHI/0X+5PzP+zj71fqR+tj6ivtL/DH9gv6o/2EAuwDbAH4A7f8c/wf+3vyW+6/6B/oh+vj6qPy4/vwAhgOFBfoGFQiSCGwI3gexBlgFMQQJA2IB4P+R/lD9Kfxd+wT7IPs8+9n71vyS/Z/++//+AGwBawFBAbkACABB/xj+D/3h+9/6OvpT+iX75fwE/4YBvANyBb8GswcECNsHcQeABg8F0wO4AkMBsv+v/qD9pvzc+3r7rPsU/If8gf1A/gT/HQDRABoBCgG4AFUAjf/b/sr95/z8+/j6Zvog+qP6E/wE/p0A6QLKBFgGIQdxBzoH0AYmBiIFnANbAlwBCgC1/gz+Yv2X/CP8CPw7/KD8U/07/g3/wP/CAEcBXwFEAekANgBS/4f+lP2e/On7NfsU+5j6Avv2+2f9s/8lAl4E7AUQB+IHsAcZB2oGYgWfA0QCYAHv/4j+9P1o/Xf8//s8/Fb8qPx//Zz+m/9ZAHwB8AHjAaEBFAErABf/Tf5I/WX8zftP+0b79/pv+x/8Jf0K/3sBrgOZBREH4AceCGUHfgZvBdsDSgLsAOb/w/7s/Zz9Pf3H/LX89vwv/bD9af5Q//z/pABpAXQBQAHuAJEAuP8B/zH+V/2R/Jb7Svsa+0P7QPvk+wL9cv5xAHcCowQjBtEGZQcSBxcGDAUJBL4CXAGBAM3/5f5g/iT++P2y/dP9HP5s/rv+T//W/yYAkAC4AJMARwDb/1b/rP4z/qj9GP2x/Bz8B/wi/BT8CPzL/Lv98/4NAQwDFAUhBtYGEAdnBlwFYgRjAzgC9QBkAJ7/2f5l/jr+Dv6p/eL9Gf47/pj+J/+o//n/SABcAFMAIAC7/3H/8/5D/sH9Ef14/L77lvvC+6L7XPse/PT8EP71ABgDkAXPBpgH3AfQBvgF+wQZBPoCugEsASoAk/8R/93+bP7u/ej9zP3a/Xz+I//W/0wAkQCYAFQAJgCk/zX/uP4E/nb9zPwj/LL7g/vX+wL8x/sk/M38W/2h/9oBCQTNBZIGawfDBhcGSwVqBJIDSQKjAbQAGQDB/27/Qv/K/lr+Fv4H/i7+yf5n/yUArADLAJ4ARgDx/2D/5f40/p39Av1+/Pn72Pup+/L7IPzz+0H8yvy2/dr/AgIoBNsFmwb6BoAGtwXgBAkEMAP/ARwBRwCi/0P/I/8L/8r+kP4o/k/+bf7B/k//4P9VAFgAXAAzAOb/n/8U/4D+xv1H/bH8MPwX/AD8KfxX/HX8uPwl/b/9UP8kAQcD2wTtBdQGtgacBg4GNgVhBH0DlQJ4AZsA7P9B/9P+iP5Q/jL+8f3O/fv9QP6c/iD/lv/7/wIAAADY/4X/Ov+Y/vj9Sv3Z/GX8HPxO/GT8yPw3/XH91f0j/un+XADCAWgD2wTXBWkGcQZ0BvUFQwVWBHwDZwJ1AYsAv//5/m/+8/2o/XL9YP1d/aj9N/6i/i7/qP/q/9//5v+v/2v/BP9j/tT9b/0o/e/8A/0o/T/9of3e/TL+o/4P/2f/p/9RAEMBOAI4AxoEvgQUBTgFaAU7BdIENwR/A60C2wEUAU0Ag//l/mD+6/2g/V39Ov1Y/Xb9lP3i/UD+aP6r/tf++P4C/8v+of6D/mb+Pv4k/hr+/P0L/gb+C/5D/nP+u/76/oz/OQALAfcB0AK8A2cE/ASNBcIFqgVUBcoEIgRYA3gCjwF7AIj/pv68/R79rfxN/A/8GfxL/Gb8tvwX/XL98/1A/of+3P4j/1H/Z/94/2f/Z/9E/x//Ev/g/rj+qP7R/jj/vP+SAH8BaQJHAzAE8ARwBcYF9AXDBWEFwwQFBBID3wHcAMz/0f7t/S79rPxS/PT74/v7+yD8afy4/DD9s/0E/kv+r/4I/zb/bf93/3f/c/9A/zD//v7N/pH+bf6h/vj+s/+aAHwBbgJ5AzUE9gRIBZ4FvQV4BUAFuAThA/0C/gHzAKX/Zv6Q/dn8SfwI/PP7Gfw+/Iv8Gv10/dL9NP6C/s3+9/7y/uX+8/7Z/rr+l/5m/mD+Nv4n/hb+Bv4g/mD+9P4CACgBcQKsA8sEiQUpBlIGNAbxBT8FiwTQA8IC1QHiAPP/uP6u/eH8R/zw+8j7z/tQ/MD8V/0T/pX+A/9Q/2D/h/9W/xj/vf68/nj+Vf5I/j3+a/5E/pP+e/6A/qf+3/6A/5UA7QFRA6oEswV/BuAGvwZfBuIF5QTHA9UCuAG0AKz/s/71/Q/9evwG/N77wPvb+3r8Gf3B/Yj+O/+Y/+D/4f/Y/6//Jf+g/jf+7f2B/Vn9Uv2L/ZL9Cv6I/rf+E/8y/63/XAAtAWACeAPRBKAFeAaaBmAG7gUBBR4EAQPPAbMArf8j/23+CP63/Wr9Rf0q/UX9Qf2J/Rn+i/5T/7X/HABHADMA9f+2/zf/c/4n/tv9of1r/aL9tP3V/QD+mP6z/tv+Gf8p/23/yv+gANkBRgP5BOEFDAZGBtEF/AQGBDMDTwI9AWkA8f9//wX/hf4T/qn9WP0n/Qj9/Pxv/er9kf4j/8b/MQBTAEIABgC4/wH/gP5H/hL+n/2g/cD9rv38/W/+wP4Z/x7/Uf84/3f/fv/7/88AEQKcA5QEOgVtBT0FhASlA+YCFwJhAZgAKQCr/7D/Uf/6/pL+Sf4Q/tj9zv3X/UD+uP5I/9n/RQBvAF0AcgDY/4j/D/+f/mH+Ov4M/uf9CP7v/fv9Uv51/oz+1f71/g3/P/+R/7H/QgD6AD4CZwMIBIUEqQRwBLgDKQOVAvgBfQEJAYQALAATAKD/Mv/I/kP+6v2b/YD9iv34/YD+Kv+9/xYARQBSAFkA+f+l/zz/zP6s/nf+S/44/j3+NP5G/qL+qP7E/h3/I/8c/1r/rP+5/0wAAAE7AnYDGATTBAcFxwQ3BJsDIwNZAswBcgG4ABMA+/+N/9z+ff4X/oz9Kv0j/VH9lv0h/tb+d//m/0IAQQBlAD4Ayv9z//z+yP6V/kj+E/4E/hD+Av4p/lj+Xf6b/uv+/v4j/4b/zf8HANkAvQH4AtcDMATIBJEEMAStAzwD9gIBAqkBNQFpAB4AzP9h/87+eP4P/p39aP1f/bb9Cf6W/jz/gv/l//P/1f/5/4H/W//3/hD/yP5Q/j/+/v3q/a796/0x/gX+Z/64/tD+Cv9k/7D/qf/NACkCAwNxBN8EggVbBcYEcwS4AykDeAL5AXEBfABAAPj/cv/r/oj+P/6p/W79af2Q/fr9Z/74/m3/o//V/7D/qP9i/wv/sP5v/lf++f3F/bL9ov2w/cr9Jv5I/of+8f4y/4H/1P9IAD4AugAHAs4CwANlBKkE6gRQBAIElwPIAjwCswFdAbIAGgAZAKH/J//S/nj+B/6r/Z79qP3P/Tb+wf5M/4D/yP/V/6//o/9U/yj/xv6t/pP+L/4b/gT+Af4P/kb+j/6g/vj+Dv9F/6j/2//3/44AoQFNAlADBQRsBOMEoARuBPwDLQORAskBRgGNAO7/1v9L/87+ZP40/sT9cP16/Wn9n/0E/oz+UP9x/87/GgDM/8b/hf9o/9f+qv6k/hj+Bf7l/S7+V/6H/vz+Cf9V/2//j//e/wUAKQAuAF8BLwLgAvQDWgTgBJAEYAT2A9cCSAKcARwBcQDw/9P/P/+v/mX+Lf76/Yn9pf2n/cz9Qf7T/lD/lv8IAO7/z/+t/1f/HP+t/pL+N/70/fX93P0e/lf+kv66/vP+K/9P/6j/7v/1/xwAaAFIAhkDJATeBGgF4gTaBE4ESwPJAuQBOgFsAMf/kv/a/on+OP7F/YH9Pv00/VP9m/3u/Vn+6v5L/4b/vv/U/8j/ov9g/0L/4v6n/pX+Tf5M/mD+lv67/vX+Vv+M/9f/FwA5AIwAuQDPAH8BBQJvAv4CcwOyA6YDrQN3A+4CiAL3AUwBswA8ANL/Uv/+/r7+a/4W/vj92/3T/fD9Ef5Y/or+3f4Z/0L/Zv+I/53/qv+K/0v/Jf/y/rD+kP6X/p7+s/7Z/hL/T/+G/8P//v9IAGgAlQAiAYoB5wFPArMC+gIFAy4DOQMBA90CYwLiAWgBtwApAKb/I/+Z/ij+z/2Y/Yf9if2s/eH9Fv5k/qT+1P4a/2X/k/+4/+b/2P+y/5//ff9L/zj/OP9B/1D/cP+H/6T/4P8GADAAXABuALgA+QBFAZQB5gFOAoACqQLRAtUC0AKoAmsC9gGMAQ4BfQDt/1X/6P5q/gn+yf2l/Yv9a/2N/aj9yv0X/lr+tP7x/ij/Zf+b/8v/xf/P/9j/xP/A/67/uf/I/9D/2/8HABkAMABZAIQAtgDaAAcBLAFXAX8BpQHGAeIB7gHqAeoBywGdAVgBEgG8AFoA/v+f/03/9/64/nD+UP4+/iP+H/40/lb+f/6s/u7+Jf9e/5L/wP/z/xYAIQAwACkAOQAqACUAGgAaABwAFwAnACUAQABXAGkAgACRAKgAoACtALcAyADNAMgA0QDMALUApwCRAHoAYwA4ACMA8P/P/6r/gP9m/0f/Nf8o/xb/D/8h/yr/Lv8+/03/X/96/5L/nv+z/8D/wf/Z/+//6v/9/xQAFQAaACYAJAAsAD4AOwBFAFcAZgBxAIgAiwCEAJAAoACgAIUAhgCCAF8ARAA5ABQAAAD5/9L/qv+c/4v/d/9u/2T/WP9W/2n/bP9x/5D/n/+s/8D/z//l/+r/+//6//D//P/4//j/+P/w//P/8v/q//X//v/5//j/CAAXACMAKAA4AEIARwBTAGQAWABeAFsATABHADAAHgAZAAwA+v/j/+T/4f/j/9T/xP/d/9//1v/f//T/7v/+//3/CAAJAAsADAALAAgADgANAAoA//8LAAkAAgD9//j/9v/7//f/+P8DAAoAEAAXABUAFwASAA0AEwACAPv/AwDz//D/8v/o/9X/0//x/+n/6f/z//H/+P/2//T/8/8IAAUABAAUAAcA///6/+//4v/d/8v/x//I/9D/yf/C/8v/0P/b/+L/6P/6/wYAFgAoADcAQQBIAEIAQwA/ADoAIwAPAAQA5P/o/+X/3v/U/8z/3f/g/+f/8//4/wMAEwAUABoAIAAUABUAGQAEAP3/9f/6/+n/5P/s/+b/3v/j//D/7P/n/+3/7v/+//v/9/8BABEAGAAYABgADgAQABsAFQACAAgAAQD7//v/9v/4//v/+v/6//j/+P/2//j/9f/9/wcA/P/w/+//6P/k/97/2//h/97/3f/d/9r/5P/h/+z/8//5/wYACwD9/wYAEQAKAA8ABwAGAAoADgASAP//9P8EAAcAAAAGAAEA9f/7/wsABQD//wsAFQAaABAAAgADABAAEgAKAAcA+//q//r/8f/4/+T/4v/e/9j/4P/p/+z/5f/z//j/+P/4/wAAAAD9/wcA9//6/wcAAgD1//z/8f/x/xwA+P8cABkATAAQAMf/0//i//H/+P/r/+//DQAQAAoABAAEADAAFgAHAA0ABQAKAAYA///0/+j/5P/u/9j/4P/q/9L/1//y//b/8P///wEA/P/3//j//P8EAA0ABQAJAAsA9v/1//H/+P/5//3////8//f/AQD9//j/BADZ/+z/GgB/AIsA/v/h//X/8/8DABgABwCu/7L/tv/P/9L/8P8QAAAA6/8AAOj/+P8iAPL/6f8BAAYAAwABAAYA+f/0/w8ACQAHAAIAAQD9////BQAGAPj//f8JAPj/+P///w8ADgD//w0ABAAMAPv/AAD3//j/AQDx/+z/+f/3//X/AgAPAAAABwACAPr//f8NAPf/8P/5//X/+//9//n/8v/z//r/+//z/+v/AADx//7/8f8JAP3/9P/u/+r/7//9//T/8//2/wMAAAD2/wkA8f/x////6f/2/wEAAQACAPr/AgAFAPv/FgAGAPr/+P/2/wYA9v/8//r/+P8BAAkA//8HAA8A9f/w/+7/9v/5/xcA8f/v/wcA/P/2/wQA8P/3/+n/9v/4/wAAAwD9/wQA9/8DAPz////6/wAABgDr//r/8v/p//r/CQAAABAA+f/1/wIAAgDz/w0A8v///wUA8v/5//P/AwD4/wQAAgAHABgA+P8EAAUABgD1/woA/v/v//D/7f/7//P/BADt////6P/f//7/DAAmAO7/CQD0//r/2/8mAPv/FgDd//n/7/8PAPb/JgD1/+b/7v/Q/wwA7v8IAO3/8P/v//3/JAD9/wQA+//4//P/8f8VAAAACADq/w0A8P8LAP7/IQDs/wcA1P/2//b/8v/4//P//f/k/wQAAADv/xsAAAD5//b/AAAXAPj/BADu/wAA9//9/wgA+//7/+3//P/0//b/AADz//j/BwAFAOX/CgAQAPz/BgDf/wUACgAAAAcAAgDY//n//v8DAAIAAgD1/w0A6v8AAAAA9v/6//n//v8AAAAA9v8QAN7/BwACANj/FQD3//L/AAAAAOf/DgACABgAFgARAOb//v/o//j/AgDS/w8A+/8FANb/DQD4/z8A5f/5/+7/BAADAPH/9P/T/w4A4f8+AOn/IQD4/wgA5P/6/+3/BwD5/yAA6P/x/xMA4P8DAPT/FwDT/y8A0v/3/83/EAD4/woA6P8AAOX/DAAnAOv/CgDo//n/8P8BAPj/+f8ZAOj/CAD0//j/9/8IAM7/EwACAP3/BwD//wUA+f8EAPX//v8CAOH/EAD0//j/2f8SAOL/7/8kAPD/7/8BAAIA8v8IAAQA/v8HAOj/EQDz/yUA6P8QAO3//v8LABUA+f/f/xUA8P8JAPj////h/wQACgDz//z/9//i/xIABQDq/wQAJgDW/wEA8v/d/wAAAgA2AAcACgDu/xAA5P/v//r/AAD2/+T/+v/T/yMA9/8RAPj/CADj//L/7v/6/zUADADn/+f/2//5/w0ABQAOAPj/7P/u//X/+//v/yUA8f8CABQA9f8fAOP/3v/w//v/BAAMAOD/FADC/wkA+f8RAAAA8/8EAOb/9v/2/xoA/P8CAPb/8////wQA//8KANz/8P8IAPX/FwD1//L/DAD8/wAA+P8GAAEA7/8JAO7/AgDk/ycABwD3/+7/9/8BAPv/BADz//v/+P/M/wsAAAARAPr////y//n//f/6/xoACAAVAO3/DwDn/xgADADV//z/5f8XAPP//P/6//j//f/4/+b/DAABABgA4//+/wgA8v/2//j/AQD3/x8Ax/81ALf/PADe/xQAz/8nAAUAzf/v//r/BAAMAPf/CwDu/83/KgDW/x0A7f8NAOz/IAD0//r/+P/q/wgA5/8XAND/MgDI/x0A9v8UAOz/9v8IAOr/7v8AAAsA7P/w/wYAAwDp/wwABAAAAPX///8CAOH/EADg/y8A4f8FAO3/FADv/wEABgDy/wAACwAKAOL/HgDo//j/BwAGAPr/4f/x/xUA5P8PAP//6//6/+3/IADp/wcA5/8IAPn/x/8QAPD//P/y/wIABgD8/w0A4P8PAMj/HQDl/wEA3f8IAAwAuP84AOL/IAAcAOn/FQDe//j/CAAIAP//4P///9D/IwD9//3/CQDq/+3/BAABAPP/CQDx/ygA4//8//3//P/0//T/4/8BAPf/CgD8//z/AAD8/w0AFgDp/xgA7f/6/yAA6f8GAA0A5P8dANv/BQDl/+z/9P8VANP/HADw//f/CgD8/9D/5P8MAO3/5P8rAPj/+P8UAL7/DAAIABIAOgDR/wMA4v8JAAgAAwD8/+r/2f9AAMf/FQD7/+H/5P/w/w0ALwDj/xAA3v8TAP7/AgD//yoAuf8dAPT/8//0////GADJ/x8A8P/4/zQA3f8KAPH/5f8TANj/HgDm/9T/5P8nAOj/FgANAO3/BwADACEACQDy/wAA/v8BAO//EAD+//D/CwD2/woA9P/7/wEA8f/6/+7/DgAIAO3/7v/4//r/9f/6//T/CwD+//H/BAAHAPn/GgDb/wgA9v/s/x0A6P8vAOD/BwDl//j/BwALAPD/CgDs/+X/AQD4/+n/8P8BAO3/7f/7/8z/DgD0//D/EwD9//3/CAAcAOH/HwAMAAgA9f/8/xUApv8tAPT/DwAAAPP/+P/t/wEA4/8IANX/5f8qAOP/BAD9/8T/CADw//f/AgD3/wgA9//1/wAA+/8AAP3/AAAgAN//+v8GABIA8f8IAP7/8P8eAPT/AQD///P/9v/7/wAAAgD0/wMA8v/9/9T/LwDn//b/CgDs/wAA8f8IACsAwv8dANj/9f8nAOH/NgDv/8z/DQDv/w4ACAAcAPL/9/8QALX/8v///9//6P8RAPn/9P/o/wsA9f/9/yoA6v8KAPv/0/8UAPn/BQABAPj//f/b/w0A4P8RAAgABgANAPL/AwDd//r//P8EABIA7P/3/xsAvv8UAOL/+v8SAPr/GQD6/0EA4P8GACIA2f8OAPH/7P8qAOL//v/y/93/AgDr/wUAAADx//3/8f/4/9z/6P8BANH/HgAFAPH/CAD9/wIA+/8AAOv/EQAEAAYADwAAAPP/5v/w/wcA/f/+/wUA/P/8/+3/+//z//3/CADz/wIA+v8dANX/CADl/x0A+P8jAAYAGwDy/+T/AgDW/+r/AQAdADgA7v8FAAsA0/8IAOH/+/8AAPH/BQDj/9H/+v8CAOz/8/8OAPr/7f/5//z/AAAAANn/CwAVAPj/DQAGAPj//P8MAAUA/P////3/+f8AAAgA4P8GAPv/9f8RAPn/AgAdAOz/5f8BAPX/DQD4/wIA4v/6//r/+v8TAPj/8v8GAPr/3P8HAAUAEAD6//X/CgAUAPD/zP8KANv/EQAEAPv/4f8JAAEA7P8RAPL/+v/8/+D/EwAOAPD/BAABAPL//P/7/+7/CgDg/wgA9f/+/wgA8f8AAPj/BgDx//n/+v8NAAEAAAAdAOz/6v8KAMn/BAADAPX/AgD8/w4A8f8RAAQABAAAAOr/AAADANb/BAAVAPT/AQDq//7/BgD4/xgA+f8CAA0A4P/o//3/AQD0/wkAAgDs/xMA7f/S/wEACgAIAPT/AwDb//r/+v/+/wgA+P8GAPj//f8GAPH/8f/o/wgA

YUBO

5 小时前
Yubo code: 6886. Valid for 3 minutes.

YUBO

5 小时前
Yubo code: 6886. Valid for 5 minutes.

Yandex.Go

5 小时前
Your confirmation code is 288111. Please enter it in the text field.

ALIPAY

6 小时前
Login verification code: 3506. Never tell the code to anyone!(Alipay)

+46790642359

6 小时前
Your Sinch verification code is: 5005

TikTok

6 小时前
[#]Doğrulama kodunuz [TikTok] 3746 fJpzQvK2eu1

+37259120382

6 小时前
Your Netflix verification code is 278906.

FACEBOOK

6 小时前
Код подтверждения аккаунта Instagram: 310 687.

audio

7 小时前
data:audio/x-wav;base64,UklGRiRlBABXQVZFZm10IBAAAAABAAEAQB8AAIA+AAACABAAZGF0YQBlBAAAAAAAAAD5//n//P8HAP//9v8BAAIAAQAHAAUAAAAAAAYAAAAGAAAACAAIAPD/8//5//n/8//8/wgABQAAAAYAAAAAAAYA+/8AAAAABQD5//n/BADz//b/9v8BAP3/AgAOAAkAAAD7/wwAEgD9//3/AgACAAEA9v/2//z/+f/z//r/+v/9/wMAAwAMAAYAAAAAAAUAAAD5////BAD//wAABQACAPP/AAAFAAAAAAD1/wAA+v/6//z/AgD2/wIACAACAAgAAAAFAAsAAAAAAAgACAACAPf/9//3//r/AAD6//r/+v/9//3/CAALAAUACwACAPT/AAD6/wAA+v/0//f/AgD9/wIACAAIAAUAAAAAAAUABQAAAAUAAAAAAPr/AAAFAAIA/f/0//r/+v/6//3//f/9//f/+v/6/wsACwD6/wsADgASABAABwACAAEAAgAAAAQA9P/6//r//f/2//f/8f/u//r//f/3/wIAAgACAP3//f8CAAgACAACAAIABQAFAAUADgAIAP3/CAAAAPT/9/8CAAIA/f8CAPf/8f/9//r/+v/0//f/AgD3//3/CAD9/wIAAgACAAgAAgALAAsA+v8AAAsAAgD3//r/BQAIAAIACAACAAUA+v/x//H/9P/6/+v/9//9//n/+v/6/wAA/v8QABAADgAXAAoABQAIAAgACwAOAPf/+v/0//T/6//x//T/9P/3//H/AAALAPT/9P8CAAIACAAFABEADgAIAA4ACwAFAAIACAD9/wIACwAAAPr/9P/x//f/8f/u//f/9//3//T/+v8FAAAACwALAA4ADgACAP3/AgAFAAsAAAAFAAgA9/8CAAgACAD3//f//f8CAPb/9f/z/+3/AQD8//f/+P/7/wEAAgD8/wIACAAOAA4ABQARABMADQAAAAkADgD/////AwD+//f/9//9//D/7f/z/+7/8f/s/+///P/6//r/BgAHAAcACAAOABEACwAOABQACwAKAAcAAAAAAPr////4//L/9//0/+j/6v/z/+3/7v/3/wkAAwD//woABQAPAA8ABwAHAA4AFAALAP3/AgD9//P/+P8EAPz/+//0//D/9v/w////+P/5/wYA+v/8/wIADwAAAP//BQAFAAUADwADAAMADgD9/wIAAQABAAYAAAAAAAQAAAAAAAAA8//z//b/9f/2//D/+f/6//r/7//z/wsABgABAAIADwAJAAcAEwAHABIAFQAFAAUAEAAAAPT/9v/1/wAA+f/s//X/7//7//X/8/8AAAAA+//2//f/CQD//wUADAAGAA0ADQAEABAACQACAAgADwACAPz/+/8AAPr/9P/5//n/8//5//n/8f/3//7/+P/8//3/CQADAP////8FABEACQD4/wYACQACAA4ABwAEAAMAAgAHAAEA/v/3//T/8//z//n/9v/w//b/9P/6//v/9v8FAAMA/v8KAAUACwAMAAkAFQAMAAYACwAFAAEA+//6/wAA+f/u//T/8P/3//H/8/8AAPv/9v8AAAYAAQAHABEACwAAABEAEwAHAAMAAgACAAEA+//1/+7/8f/3//3//f/u//r/AAAAAAYA/P/8//3//v/+////CwALAAAAAAALABEAAgAOAAcACgADAPH//P8BAPv/9f/3//H//f/9//b//f8CAPH/+//7//z/AgACAAMA/v8KAAUAAAAFAA4ADgAIAAsABQAQAAYA+f/z//j/9v/u//L/8f/y/+//+f/5//r/BwANAAcAEAAQAA0AEwAEAP7/AwADAP3//f/8//z/+//1//L/+P8DAP7/8v/4/wAAAAD2//z/CAD9/wgACQD+/wQABwANAA0ACgAEAPn////+/wMA/v/x//r///////j/+P/+//X/BgD+//7/AwADAPj/+f8EAPn/+v/9/wkA/v/+/wQA//8EAAoABwAMAAcAAQAGAP3/AwD8/wIA9v/t/wUAAADz/wAA+f///////P8BAAEA/P8CAAIAAgAFAAAABQALAPr/+v8FAAYAAwD9//3/CAD9//H/+v/6//r/AAD6/wAAAAAFABAA////////AQD8//z/AgD2//r/9P/6/wAA9//3//f/BQAAAAAADAAIAAgACAALAAsAAgACAAgAAgD3//z//f/9//z/6//t/////f/8//z/AgACAP3/AgAIAAIAAgAFAAsABQAFAAIA/f8IAAIA9//9//f//f/3//T/+v/6/wIA/f/9/wIACAAFAAAABQALAAgAAgD3//3/CAACAPH/9P/6//r/AAD6//3/CAAAAAAA+v8CAAIABQAAAPr/CwAUAPf/+v8LAAIA9/8CAAIA9/8CAPf/7v/6/wAAAAAFAAUAAADz//r/CwALAAAA+v8AAAoAAgD2/wAABQD6/+7/+v8CAAIAAgAAAAsAAAAFAAUAAgAIAAIAAgD9/wgA9//3//H/9P/0//3/AgDx//f/BQAIAP3//f8IAAgAAgAIAAsAAAAAAAUABQACAP3/AgD9//3//f/0//r/+v/0/wIA/f8CAP3/9/8CAAgAAgAIAAIAAAALAAUADgAIAP3//f8CAP3//P/2//H/+v/6/wAAAAD6/wAAAAAFAAAAAAAAAPr/BQAFAAUAAAAAAAAA9P/0/wUABQD6/wAA+v/9/wsABQAAAPr/AAAFAAAAAAAAAAsAAAACAAIAAgACAPH/9//6//r/+v8AAPf/9/8CAAIAAgD9/wIACAAOAAAABQALAAgA/f/9/wIA9//9//3/AgD3//r/AAAAAAAA9P/6/wsA+f8AAAUA9P8AAAAA9/8HAAQABQAAAPn/BQAFAAAAAAAAAPr/AAAAAPr/AAAFAAAAAAAFAAUA+v8AAAsA/f/0/wAAAAAFAAAA+v/6/wAA+v/6//f/9/8IAAgACAAAAAAA/f8LAAUA+v8AAAUAAAAAAAAAAAAFAAAACAAIAPH/9/8CAAIA/f/3/wAAAAD6/wUA+v/u//3//f/9/wIACAACAAIAAgACAAQABQD0//7/AgAEAAAABAAAAPr/CwAAAAUAAgAIAAIA8f/3//r/+v8AAAUA+v/6//r/AAAAAPH//f8IAAIA/f8CAAgAAgACAPf/AgAIAAIAAAAFAAUABQAAAAUAAgACAAgA/f/9/wIA/f/3//3/9//0//r/9P/9/wIACAAAAAUAAAAFAAAA+v8FAAsA+v/0/wsABQAAAAgA/f/9//b/AAAAAAAAAAD6//r/AAAFAAAAAAD6/wUABQD6/wUABQAAAPr/+v8AAAAA+v8FAAAA+v8AAAAAAAD6//f//f8CAPf/CAACAAgACwAFAAUAAAAFAA4AAgDr//T/+v8AAAAA+v/6/wUAAAD0//3/CAACAAAAEQAAAPr/AAAAAPr/BQAAAPr/AAAAAAUA+v8AAPr/9/8CAAIAAgD9/w4AAAD5/wUACwAFAAAAAgACAPz/9//5/wUA+v/0//T/9/8CAAIA/f8CAAIAAgAIAAUAAAALAAsACAD9//3//f8CAA4A9//3//f/8f/6//T/AAAAAP3/9//3/wgA/f8IAAgACAAFAAUAAAAFAAUAAgD3//T/BQALAPT/7v8AAAsA9P/9//3/CAAFAAAABQAAAAUAAAAFAAIAAgD9//3//f/9//b/+f/z//b/AgD+//f//f/8/wAAAAAFAAUACAAUAAUA+v8FAAsACAD9//3//f/9/wIA/f/9//f//f/6//T/+v8AAPr/9/8CAP3//f8CAAIAAgAIAAgABQAFAAAABQAFAAgA/f/9//f/+v8AAPr/9P/3//3/AgACAAIAAgACAAIAAgACAAUA+v8AAAsABQAFAP3/9P/6/wAABQAFAPT/+v8AAPn//f8HAAAAAAALAAAAAAAFAPn/+f/z/wAABQAAAAAAAAAFAAUAAAAFAAIA/f/3//r/BQAFAPr/+v8AAAAA+v/6/wAAAAD3//3/DgAFAAAA+v8AAAUA+v8AAAAAAAAFAAAAAAAAAAUABQD6/wAABQAAAPr/BQAAAPr/+v8AAAUABQAAAAAAAAD0/wUAAAAAAAAAAAD6//r/AAD6/wIABQD2//3/DgAFAAAAAAAFAAQA+v8AAAUAAAAAAPr/+v8AAAAAAAAFAAAAAAAAAAAA+v8AAAsAAAD0//r/AAD6/wIA9/8CAAgA/f8IAAAA/f8FAAUA+v/6//3/EQAFAPr/AAAAAAsA/f/0//r/AAAAAAAA+v8AAAUAAAD6//T//f8IAAUAAAAFAPr/AAAAAAUABQAFAAAAAAACAPf/AAAFAPn/9P8KAAAA9P8EAAAA+v8AAAAAAAD5/wAAAAAAAAUACwAAAAUA/f8CAAIA/f/9//3//f/0/wAA+v8AAAAA7P/9//3/+v8IAAIA/f/3/wIAFAAAAAAAAAAFAAsACAD3//r/AAAFAP3/9P/6/wAAAAD6//f/AgAIAP3/AgACAAIA/f8IAAsABQAAAAAABQD0/wAABQD0//T//f8CAAgABQD5/wQABQD6//r/AAAAAAAABAAAAAQABQAAAAAAAgAIAPf/9/8AAAAA+v8AAAAAAAAAAPT/+v8CAP3/AgD9/wIAAgACAAgABQAAAAUABQD6//r/+v8FAAsAAAAAAAAABQACAAIAAgD3//f/AgACAPH/AAAFAPr/AAD6//T/AAAAAPf//f8CAPf/AgAOAAIACAAAAPr/CwALAPr/AAALAAgA/f/2/wIAAQD2//T/AAAAAPT/+v8EAAAA+v/9/wIAAgD9/wIA/f/9/wgACwAAAPr/AAAFAAUAAAAFAAUA9P8FAAAA+v8AAAUA+v/6/wUAAAD0/wUABQD6//T/BQAFAPT//f8LAAUA+v/u/wIACAAAAAAAAAAAAPr/AAAAAAAAAAD6/wUABQAAAPr/AAAFAAAACwACAPf/AAACAP3/7v8AAAsA+f/u//b/AgACAAIAAgABAAoAAAD5/wUABQAFAPr/AAALAP3//f/9//r/+v8FAAsA/f/9//r/+v8AAAAAAAAAAAAAAAD0//r/AgACAAIABQAAAAUAAAD6/wUAAAAFAAUA+v8AAAUAAgD0/wAAAAD0//f/AgACAP3/CAACAP3/AgAIAAUAAAAAAAAAAAAAAAAABQAAAAAAAAAAAPr/AAD5/wAA+v8AAAAAAAAAAPr//P8HABAAAAAAAAAAAAAAAAUAAAAIAAIA8f/0/wAABQAAAPr/AAD6//r/AAAFAAAA+v8AAAUAAAD6/wUA+v/6/wAA/f/9/wIAAgAIAAUAAAAFAAAABQAAAAgA9//6/wAA+v8AAPr/+v8AAPr/9/8CAAgAAgD3//3/CAAIAAIAAAAFAAUABQAAAPr/+v8LAAAA9P8AAAAABAD0//T/BwAFAPr/9/8CAAIA/f8CAAIAAgD9/wgABQAFAAsAAAD6/wUACAD9//f/+v8AAAUA+v/6/wAAAAAAAPT/+v8FAAUAAAAAAAsABQACAAIA/f8CAPH//f8AAPT/AAD0//3/AgACAP3/AgAIAP3/CAAFAPr/+v8CAP3/CAAAAAAABQAFAAAA+v/6/wAAAAAAAAAA+v8AAPn/AgD9//z/BwALAAsAAAD6//r/AAAFAAAAAAAAAPr/AAAFAPr/BQAFAPT/AAAAAPr/CwAAAPr/BQAAAAAABQD6/wAA+v/0/wUABQD6//r/AAALAAAAAAAFAPr/AAAAAAAA+v/6/wUABQAAAPT/+v8FAAUA+v/6/wsABQD6//r/BQAAAPr/BQAAAAAABQAFAAAA+v8FAAIA+v/6/wUABQD5/wAA+v8EAAUA+v/u//3/CwAFAAAA+f/z/wIACwAFAAAA9P8AAAUAAAD6/wUA+v8AAAsA+v8AAAAAAAAFAAAA+v8AAAAABQAAAPr/BQAAAAAAAAAAAAAAAAAFAAAABQD9//r/+v/0/wAAAAD6//3//f8IAAgA/f/9/wgACwAFAPr/AAAFAAUAAAD6/wUA+v/6/wUAAAAAAAAAAAD6/wAA+f8AAAUAAAAFAPr/BAAFAAQA/f/5//n/AAD6//r/AAAFAAsABQAAAPr/AAAFAAAA+v/6//r/AAAAAAUABQAAAAUAAAAAAAUA+v8AAAAA+v/6//r//f/9/wIAAgD9/wIAAgACAAIAAgACAAUABQD6/wUABQD6/wUABQAIAP3/9/8CAP3/9//6/wAAAAD6/wUAAAD0/wAABQD6/wAAAADz/wkABADz//z/AgAHAAQABQAEAAUA+f8AAAsAAgD3//T/AAALAPr/+v8AAAAAAAD6/wAABQD6//H//f8IAP3//f8IAAIA9/8IAAIA/f8IAAIAAgAAAAsA+v8AAAAAAAAFAPr/BQALAPr/BQD6//r/CwACAPf/+v8FAAAAAgD6/+7/+v8CAAAAAAD9/wsABQAAAAUA+v/6//T/AgAFAAsAAAD5/wQAAAAAAAAAAAAEAAAAAAAFAAAAAAD6/wAA+v/6/wUAAAD6//r/AAAFAPr/+v8FAAAA+v8AAAAAAAD6/wIA9//9/wgAAgACAAgAAAAAAAUABQAAAAAABQACAAIA9//6/wAA+v/6/wAAAAALAAUA9P8AAAAAAAAAAPr/AAD6//r/AgAAAAUAAAD6/wsAAAAAAAUAAAD6//r/AAD6/wAABQAEAPr/+v/6//7/BwALAPr/+v8AAAAAAAD6/wAAAAAAAAAA9/8CAAgAAAAFAAUAAAD6/wUABQD6/wAABQD6//r/BQD6/wAAAAAAAPr/AAD6/wUAAAD6/wUA+v8AAAAABQAAAPr/BQAFAAAABQD6/wAABQAAAAUAAgD9//f/+v8AAAUAAAD6//r/BQD6//T//f8CAAIAAgD9//3/AgACAAkAAgACAAAAAAAAAAAAAAAEAAUAAAAAAPr/BQAFAPT/BQAFAAAA+v8AAAUA9P8AAAAABQAAAPT/AAAAAPr//f8CAAIABQAFAAUAAAAFAAAAAAAAAPT/BQD6//r/BQAFAPr/AAAAAAAAAAD6/wAAAAAFAAUAAAD6/wUAAAD0//r/AAALAAAA+v/0/wUAAAD6//3/AgD9//H/CAAOAAUAAAAAAPn/EAAAAPT/AAALAAUAAQD3//n/BQAAAAIA9//0/wAACwD6//T/+v8AAAUABQD6/wAAAAAAAAAAAAAFAAAA+v8FAAUABQAAAAIA/f/3//T/+v8AAAAAAAAFAAUA9P8AAAUA9P8AAAUAAAAAAAUABQD0//r/CwAAAAAAAAAAAAAAAAAAAAUA9P/6/wUAAAAFAPr/+v/6/wsABQD6//r/AAAEAPr/+v8FAAQA+v/6/wQAAAAAAAUA+v8FAAAAAAD6/wAABQAFAAAAAAAIAP3/9//6/wUAAgD6/wAAAAD6//r/AAD6//f/CAAFAPr//f8CAP3/AgAIAAAACwAAAPr/AAAFAAUABQD6//r/+v8AAAUA+v/6/wAABQAFAAAAAAD6//r/CwAAAPT/9P8CAP3//f8IAAgA/f/9/wgABQAFAPn/+f8AAAsABQD6/wQAAAD0/wAAAAD5/wAABQAFAAUAAgD9//3/+v8AAPr/AAAAAPT/+v8FAAAA9P8CAAIA9/8IAAIAAgAFAAAABQAAAAUABQAAAAUA/f/0//r/BQAFAAAAAAAAAAAAAAAFAAAA9P8FAPr/+v8FAPr/+v/9/wgA+v8CAAUA+v8FAAAA+v8FAPT//f8OAAUABQD6/wAABQAAAAoA8/8AAA4A/v/x//r/BAAFAPn/+f8FAPr/9P8AAAAAAAAAAAAABQAAAPr/AAD6//3/AgD3/w4ACwAAAAAAAAALAAIACAAIAPf//f/9//3/AgDx//r/AAAAAAAA9P/6/wAA/f/x/wIACAAIAAsAAAAFAPr/AAAAAAUABQAAAAAAAAAFAPr/+v8FAAUAAAAIAP3/AgACAPf/AgD9//D/+f8EAAAA+v/0//f//v8HAAEAAgAHAAsA+v8AAAAA+v8FAAUABQAAAAUAAAACAP3//f8CAP3//f/3/wUA/f/0//r/BQD6//r/BQD6//f//f8CAP3/CAAIAP3//f8IAAUAAAAFAAAACwACAP3//f/6/wAABQD9/wIA/f/3/wAA+v8AAPr/+v/6//3//f8CAP3/9/8CAAIAAgAIAAIACAAAAAAABAAAAAQABQAAAPr/BQAEAPr/AAAAAPr/AAAAAPT/+v8FAAsA9P/0/wIA/f8CAP3/AgACAAgAAAAAAAAABQAAAAAACwAAAAUA/f/9//r/+v8AAAAABQAFAPr/+v8AAAUA+v8AAAAAAAAFAPr/+v/6/wAAAAAAAAAA+v/9/wIACAAFAPr/+v8CAAUABQAAAPr/BQAFAPr/AAAFAAsA9/8AAAcA/f/8//b/AAAAAAAA+v/6//n/+f8AAP3/AgAIAPr/AgACAP3/AgAIAAUACwAAAPr/CwACAP3//f/9//3/+v/6/wUAAAD6/wUABQD6//r/+v8AAAUA+v/6/wAA/f/9/wIACAAAAAAABQAAAAAA+v8FAAAA9P8AAAAA/f/9//3/AgACAAIAAgACAAIAAgAAAAAABQAFAAUAAAAFAAIA9v/5/wUA9P8AAAAA9P/2/wEABwAAAAAA+v/9/wgABQD6/wAABQAFAAUA+v8AAPr/9P8AAAAAAAD6/wIAAgAFAAUA+v8AAAAAAAD6/wAA+v/9/wIABQD6/wAABQAAAAAAAAALAAAA9P/6/wsABQD6/wAABQAFAAIA/f/3/wAAAgD9//r/+v8AAAAA+v/0//3/CAAFAAAAAAAAAPr/AAALAAAAAAAAAAAAAAAAAAQABQD6//r/+f8AAAUA+v/0/wIABQD6//f/CAAIAPr/BQAFAAAABQD6//r/AAAAAPr/AAAFAPT/AgAFAAAABQAFAPr/AAAFAAAAAAAAAAsA/f/3/wAAAAAAAPr/+v8AAPr/+v8CAAAAAAAAAAUAAAAFAAAAAAAFAAUAAgD3/wIA/f/9//3//f/6/wAAAAAAAAAAAAAFAPn/AAAEAAAA+v8AAAUA+v/6/wAAAAD6/wAAAAD6/wIA/f8CAAgABQAAAAUACwD6//r/BQAFAAIA/f/9//3//f8AAPr/+v8FAAUA+v/0/wAAAAD6//3/AgD3//3/CAAIAAIA9//9/wIACAACAAgABQD6/wAACwAAAAAABQACAP3//f8CAP3/9/8AAPr/+v8AAAAAAAAAAAAAAAAAAAAA+f8AAPr/9v8CAAIABwAFAAAAAAAKAAUA+v8AAAAAAAD6/wAABQALAAgA9//9/wgA9//3//r/+v/6//T/9/8CAAgA/f/3/wIA/f8IAAIA/f8OABEAAAAAAAUABQAIAP3/8f8CAAgA9//x//r/+v/6//r/AgD9//f//f8IAAgACAAFAAAA+v8AAAAAAAD6//3/BQD6/wIAAAAAAAAABQD6/wAAAAAAAAsADgACAPf//f/8//3/9v/5//r/9P/3//3//f8CAP3/9/8IAAIACAAOAAUAAAALAAgA/f/9//3/AgD3//f/AAD6/wUAAAD6//r/AAAAAAUACwD9/wAAAAACAP3/+v8AAPr/+v/6//r/AgACAP3/AgACAAgAAAAAAAAAAAAAAAUABQAAAPT/AAALAPr/+v8FAAAA9P/6/wIA/f8CAAcABQAEAAUA+v8EAAAABAAAAAAAAgD9//3/+v/6/wAAAAD0/wAAAAAFAAUAAAAFAAUA/f8CAAIA9//9/wgA9//0/wAA9P/3//3/AgD9/wgACAD9/wgA/f8CAAUABQALAAAAAAAAAAUA/f8AAAAA9P8AAAUAAAD6/wAAAAAAAAAABQAFAAAABQD9/wIA9//0/wAA+v/6//f/AgD9/wIACQACAAIABAAAAAAABAAAAAAABQD5//n/AAAFAAAAAAAAAAUAAAD0/wAABQAAAAAA+v8AAAAA9P8CAAAAAAD9/wUAAAD6/wAA/f8CAAsABQD6/wUABQAAAAAAAAAAAPT/BQARAP3/9/8AAAAAAgD6/+7/+v8FAAAA+v/9/wgAAAD6//3//f8IAAgA9//9//3/AgAIAAsAAAD6/wsABQAAAPn/BAAFAPz/+v/6/wAABQD6//r/BAAAAAAAAAAAAPT/AAAFAPr/AAAAAAAABQAFAAAAAAAAAPT/AAAFAAsAAAD6/wUABQD9//r/BQD6/wUAAgD3/wAA+v8AAAAAAAAFAPr/+v/0//3/AgD9/wgACAAFAPr/AAAAAAAABQAAAAAA+v8LAAAAAAAAAAUAAgD9/wIA/f8CAPf/9P/6/wAAAAD5//n/BQAAAPT/AgAHAAAA+v8CAAQAAAAAAAUACwAIAAIAAgACAP3//f8CAPf//f/9//3//f/3/wAAAgD6//T/AAAFAAAA9P/9/wIAAgACAP3//f/9/w4AAgD9/w4AAAAAAAAAAAAAAAsACwD0/wAABQACAPf/+v8AAPr/BQAAAAAACwD9//T/9P/6//3//f/9/wIACAACAAgAAAD6/wIABQD5//3/BwD6/wIAAAD2/wcACgAAAAUACwD9//3//f/6//r/BQAIAPf/9P8AAPT//f8CAAIA/f8CAAIA/f8IAAAABQAFAAUAAAD6/wAABQAAAAAABQACAPf/+v8FAPr/9P8AAPr/AAAAAP3//f8IAAIABQAFAPr/BQAAAAAABQAFAPr/AAAAAPT/AAD6//r/BQAAAAUABQAAAAUA+v8FAAAA+f8FAAQA+v/6/wQAAAD6//r/+f/9/wIAAgD9//3/CAAFAPr/BQALAPr/BQAFAPr/CwACAPH/+v/6/wUAAAAAAAAA+v8FAPr/BQAFAPT/AAAAAAUAAAD6/wAABQD6//r/AAAAAAAA+v8AAAUABQD0/wAA+v/9/wgAAAAFAAUABQD6/wUAAAD6/wAA+v8AAAAAAAAAAAUAAAD6/wAABQAFAAAAAAD6//r/BAAAAPr/+v8AAPn//f8CAP3/AgACAAgABQAAAAUAAAAFAAUAAAAIAAIA/f/9//f//f8CAAIA/f/3//f/AAD0//T/BQAAAAAAAAAAAAAAAAAFAPr/+v8AAAAA/f/9/wIAAgD9/wIACAALAAUA+v8AAAsAAgD3/wAAAAAAAAAAAAD6//r/AAAAAAAA7v/3/wgAAgD3/wIADQACAAIAAAAFAAsABAAAAAAAAgD9//b/+v8FAAAA+v/6//r/AAALAAAA9P8AAAAA+v8FAAAA+v/6//f/9/8CAAgACAACAAIA/f/9/w4AAAAAAAsACwACAPf//f/6/wAABQD9//T/9P8AAPr/9/8CAP3/CAACAPH/AgAIAAIACAAFAAsABQAAAPr/+v8AAAAAAAAAAAAABQD0//r/EQD6//n/+f8AAAQABQAEAAAA+v/6/woAAAAAAPr/7v/9/wIA/f8CAP3//f8IAA4AAAAFAAsAAgD9//r/BQD6//T/AAAFAPr/9P8CAAAACwAFAAAAAAAFAAIA9P8AAAAAAAAAAPr/+v/3/wIA/f8CAP3//f/9/wgACAACAAIABQAFAAAABQAFAAAAAAAIAP3/9/8CAAIA8f/6/wUA+v/6//T//f/9/wcAAgABAAIAAAAEAAUABAD6//T/CwAFAPr/+v8FAAAA+v8AAAUAAAAAAAAAAAALAAIAAgD3//3//f/9/wAAAAAAAPr/9P8AAAAA9P/9//3/AgACAAIA/f8IAAgAAAD9/wUAEQD6/wAABQAFAP3/+v8FAAIA/f/9//r/+v8AAPr/+v8FAPr/9/8CAAgABQAAAPT//f8IAAAA/f8CAAUA+f/9/wIAAgAFAPr/BAAFAAAABQAEAAAAAAACAPf/9P8AAAAA+v8AAAUAAAAAAAAA9P8FAAUAAAAAAPr/+v8AAAAA+v8FAAUA+v8FAAsA+v8AAAAA+v8AAAAAAAAFAAUA+v8AAPr/AAALAPr/AAAAAPr/+v8AAAUAAADu//3/AgACAAIAAgALAPr/9//9/wgACAAAAAUABQAFAAAABQACAAIA8f8AAAEAAgD3//T/+v/6//r//f8CAAIAAgD9/wIAAgAIAAsABQD6/wUACwACAP3//f/3/wIAAgD3//r/BQD9//T/+v/6//3/AgAFAAUABQAAAPr/BQAAAPr/9P8CAP3//f8IAP3//f8IAAgABQD6/wAAAAAFAAAABQAFAAIAAgD3//r/+v8AAAUAAAD6/wUAAAD0/wAAAAAAAAAAAAAAAPn/BQALAAAAAAAEAAAAAAAAAAAAAAAAAPr/BQD6//r/AAD6//r/9/8CAAgACwAFAAAABQAAAAAABQACAAIA/f/9//3/9P/0//T/AgACAAIAAgACAAUA+v/9/wIAEQALAPr/+v8AAPr/+v8FAAsAAAAFAAgA9//3/wAA9P8AAAAABQAAAAAAAAD0//r/9//9/wIAAgD3/wgAFAD6/wUABQAAAPr/BAAAAAAACwD9/wAAAgD9//3/+v8IAAgA8f/3/wAAAAD6/wAA7v/9/wgA/f8CAAIA/f/9/wIAAgACAAgABQAAAAsACwD9/wIACAACAPH//f/9//3//f/3//r/+v8AAPr/AAAAAPr/9/8CAAgAAgACAAIAAAAFAAsABQAIAP3//f/3/wIAAgD3/wIAAgD9//H/9P/6/wAA+v/3//b/AgAHAPz/BwANAPr/AgARAAAA+f8FAAUAAgD3/wUACAACAAIA/f8CAOv/+v/0/+7/CAD3//H/CAAUAAIA/f8IAAsABQAFAPT/+v8AAAAA+v/x/w4ABQAAAAUACwAAAPr/BQAAAAAACAACAPf/9P/0/wAAAAD0//3//f8CAP3//f8CAAIA/f8IAAgA/f8OABEACAD9/wIAAgD9/wIA9//9//b/9//6/+7/9//3/wIA/P8CAA4AAgD3//f/AAAFAA4AFAAAAAUACwD9/wIACAACAAUACwAAAPT/9P8AAPr/8f/r/+v/9//9//3/9//6/wAAAAARAAUAAgAOAA4ABQD6/wUAEQAIAAgAAAAFAAAAAAAAAPT/6//x//T/+v/6//H//f8CAAIAAgD9/w4ACAAAAAAAEQAFAPT/AAAAAAAA//////n/BAD5//r/AAD6/wMAAQAOAA0ABQAAAAUACgD4//3/AQD1//T//f/w//b/8P/t//f//v////r/DAATAAUABQASAAkADwAPAAUAEAAGAAUA+f/+//3/7//m/+z/6f/j/+3//v8AAPv/CAAPABAAFAAUAAoAGAAFAAkAAQD1//n/7P/v/+//9f/5//r/AQACAAkADQAHAAgA/P8IABEAAwDy//f/AgD7//j/7P/2//r/8//6/wAA/P8DAAoA//8FABEADwACAAIAFgADAP3//f/8//X/+P/+/wYAAAD0//T//v/4//j///8AAAUA+v/7//z/BAAFAAIACAAIAPz//P8HAAYABQAAAAQAAAD0//b/7//7//z/9v/0/wAA/P/+/wsAAAANABEACwARAA0ABQADAPz/+v/z/+v/7P/u//f/8f/z//3/AAABAAkAEwAPABYAEwANAAsADAAQAP//9v/r/+n/7v/k/+j/7//3/wAA/P8BAAkACAAVABAABAAYABcADQAAAAMAAQD0/+3/+P/0//r/8//o/+z///8GAPb/CQALAAYA/P8UABcABAADAA0ADwDw//X/AAD5//P/9/8IAPj/8/8LAAYA/v8AAAMAAwD3//z/+P/x//f/9P/0//b/BAAIAAoABgAMABYACgADAAsA/v8CAAAA9P/6//P/8f/4////AAD7//z/BQAIAAcA9f/9/wcAAwDx//T/AAAAAAAAAAAHAPf/CQAWAAIA/f8DAA8ACwAFAP//CQACAPX/7v/z//X/7v/u//L/+f/6//P/DAALAPz/CwAVAAgABwAYAA0AAgD7//D/AAD7//X/9v8CAAkA8//6/wAADQABAPz/AQD8/wAA9f/8//z/+//7/wAA+v/1/wMADQACAAMAEgATAAQA//8KAAQA/v/9//z/AQD7//r/7v/x//L/+P////3/+P8EAAoA+v8LABcADQD7//T///8DAPH/+f8FAPr/AAABAAUAAAACAAgACQADAAIADQADAPz/+//6//P/8P/q//r/+//8/wMABAAFAAYADAAFAAcADQAGAAIAAQABAPv/9P/5//r/+v/3/+///f8GAPn/+f/8/wcAFQABAP3/DwAAAPL/+P/4//P//v8FAAAA9f/2/wMAEAANAAgADgAFAAQABAAJAPb/9f/7//v/7v/3/wQA+f/y//z/BAD//wMABAAAAAUADwAAAAAAAAD///3/AgD+//H/8//0/w4ACQAAAAcACQAQAP//+/8LAAQA+//5//X/+//v/+j/+//7//X/+////wcAAgADABAAEQAOAAgABQAEAAMA/f8BAPv/9P/6//T/9//4//j/+f8GAPv//P8OAAgAAgAHAAYAAAD///7/9//x//3//f/3//7/AAD9/wcACAACAAgADgAEAP7//f/8/wAAAAD5/+f/9//+//n/AAD7/wcAAgAIAAIABwAHAPr///////7//f/9//f/+P///wAAAAAFAPr/AAAAAAAA//8FAAUABQD7/wEAAgABAAcAAAAAAAAA+P/4//f//f/0//X/DQAIAAAABwANAAgACwD///7/AwD2/wEA9f/4//f/8v/4/wQA+f/u/wkAAwD+/woADwAGAPv/BQALAAAA//////n/+P//////+f///wUAAAD6/wAABgD7/wEABgAAAAAABQAEAPj/8v/y//v/+/8BAPb//P8EAP7/AwAJAAkAEQAKAAIAAgAIAAIA9//9/wIA9//x/wAA+v/0//r/BQD6/wAAAAD6/wIA/f/9/wgAAgD9/wgA/f8CAP3//f8IAAsABQAFAAgA/f8CAP3/9//0/wAABQAAAPr/+v8AAPT/9/8IAAgAAADx//H/BQAAAAUAAgAIAA4AAgAAAAAABQAFAAUABQD6/wAABQD6/wUA+f/0/wUAAAAFAAAABAD9/wAAAAAAAPn/7f/9/wIAAgD9//3/CAAIAAAA+v8FAAUAAAALAAIA/f/6/wgAAgDx/wAAAgD9//3//f8AAAAAAgACAPH/AAAFAPT/9P8FAAsA9P8AAAUABQAAAAUACAD9//3/9P/6/wUABQAAAAUAAgD9//3//f/9/wIAAgD3//T/+v/6//3/BQAFAPr/AAAFAAsABAD6/wAAAAAEAAAA9P/6/wAAAAD0//3/CAACAAIAAgAAAAAABQALAAsACAD9//f/AgACAPf//f/3//T/9P/9//3//f/9/wIAAgD9/wgADgAFAAUACwACAPf/AgAIAP3//f8CAPf/8f/6//r/AAAFAAUA+v8AAAAAAAAAAPr/AAAAAPr/AAAAAPf/8f/9/w4A/f8CAAIA/f8IAAIACAAFAAAABQAEAAAAAAAHAP3/9v8CAP3/9P8AAAAA9P8AAAUAAAAFAAAAAAAFAPr/+v/6/wAA+v8FAAUAAAAAAAAAAAD6/wUACwAAAAgAAgD3//f/CAACAPf/9//6//r/+v/6//3/AgAIAPr//f8CAAIACAAFAAUACwAAAPr/BQAAAPT/AAAFAAUA+v/6/wUA+v/6/wAABQAAAAAACwAAAAAABQD9//r/9P8AAAQAAAD6//r//f/x/wIAAgACAAgAAgAIAAAAAAAFAPr/BQAFAAUACAACAP3//f/9//H/+v/6//T//f8CAP3//f/9/wIACAD9/wIACAALAAUABQAIAP3//f/9//3/9//0/wAAAAAFAAAABQAAAPT/+v8FAAAA+v8AAPr/AAAAAAAA+v/3/wIACAAFAPr//f8LAAUAAAAFAAUAAgD3//r/BQAAAPT/+v8LAPr/+f/5//f/AgAIAAIA/f8IAAAA9/8IAAAAAAALAPr/AAAFAAAA9P/6/wUABQAFAAAA9P/0//3/CAAFAAUAAAAAAPr/9P8FAAUAAAAAAAUABQD0//r/CwAFAAAAAAAAAAAAAAD6//r/AAAFAPr/9P/9/wgAAAD3//3/9//6/wUABQAAAAUAAAAIAA4ACAALAAQABQABAP3/BwD+//b//P8CAPb/9v8AAAAAAAAAAPT/9P/9/wIACAD9/wIAAgAFAAUA9P/9/wgACwD6/wAABQAFAAAAAAAFAPr/CwD9//f/AAAAAAAAAAD6//r/BQD6//r/AAAAAPr/9/8IAAgA8f/9/wgA/f8CAAIAAgAIAAUABQD6/wAAAAAFAAAABQAFAP3/AgD3//r/BQACAPf/+f8EAAUAAQACAP7/9//9//r/AAD5/wAA+v/x//3//f/9//r/AAALAAIA/f8IAAgACAAFAAsABQAAAAIA/f/6/wAABQACAPf/+v8AAAAAAAAAAAUAAAD6/wAAAAAAAAAA+v8AAAAA+v8AAPT//f8CAAgAAgACAAAAAAAAAAUAAAAFABEA9//9//r/BQACAPf/AAD6/wAAAAD0//f//f/9//3/AgACAAEADgD+//7/BwAEAAoAAAAAAAUA9P/6/wAAAAAFAAUAAAD6/wAABQALAP3/9P8AAAUAAgD6/wAA+v/0/wAA+v/9/wIA/f8CAAIA9/8CAP3/CAAIAP3/CAAFAAUA+v8AABEA/f8CAAgA/f/9//3/9//3//r/AAD6//r/AAD6//3//f/3/wIAAgACAAgACAAFAAAA+v8LAAsA/f/9//n/AAAEAPr/AAAEAPr/AAAAAAAABQAAAPr/AAAFAAAA+v8AAAAA9P/6/wIABQD6/wUAAAD6/wUABQAFAAAABQAAAPr/AAAAAAAAAAAAAPr/AAAFAAAA+v8AAAAAAAAFAAUAAAAAAPT/BQAAAPT/+v8CAAUA+v/3/wIADgAFAPT/9/8IAAgABQAFAPr/+v8FAAsAAAD6/wAABQAAAAAAAAD0//r/9v/9//7//v8CAAIABwACAAIACAAAAAUABQAAAAAABQACAAIAAgD9//3//f/3//T/9P8AAAsA9P/6/wUA+v8AAP3//f8CAAgABQAAAAAAAAALAAUA+v8AAAsA/f/3/wAAAAAFAP3/AgD3//T/+v8AAAAAAAAAAAAA+v/3/wgABQAFAAAAAAAAAPr/AAAFAAAAAAAAAAAAAAD6//n/+f/9//z/BwACAP7/AgAHAAUAAAAAAAAABQARAP3/9/8AAAIAAgD3//T/+v8AAAAAAAAAAPr/9P/9/wIAAgAIAPf/AgAOAAUAAAAAAAAAAAAFAAUA9P8FAAUA9P/6/wUABQD6/wAAAAAAAAUABQACAPf/9P8AAPr/+v/3/wgABQD6/wIAAAAFAPr/AAAFAAUA+v/6/wUACwAFAPr/AAD5/wQABwD2//r/AAAAAPr/9P8AAAoA+f8AAAUA9P8FAAAA+v8FAAUA9P8AAAUA+v/6/wAAAAD6/wIAAgAAAP3/AgAFAPr/BQALAAUAAgACAP3/8f8AAAUAAAACAP3//f/9//r/BQD6//r/+v/6/wUAAAAAAAUA9P/3/wgABQD6/wAACwAAAAAAEQD9//3/AgACAAIA/f8CAAIA9//3/wgA/f/9//3/8f/0//r/+v/2//b/+v8KAAkA/f/9/wgAAgAIAA4AAAAFABEACAACAPf/9//9//3//f/6/wUAAgD0//r/+v8FAAAA+v8FAPr/+v8FAPr/+v8CAP3/CAAAAP3/AgACAAUABQAAAPr/BQAFAPr/+v8AAAAA+v8AAAUAAAAFAAAABQAAAAAAAAAAAAUA+v/6//r/9P/3/wgACAAAAAUAAAAAAAQABQAAAPT/+v8AAAAAAAAAAAAAAAD6/wUAAAAAAAAAAAAFAPT/AAALAAUA9P8AAAAAAAD6//r/AAAAAAUAAAAAAAUAAAAAAPr/AAAAAPr/BQAAAAAAAAAAAAAA+v8FAPr/AAALAAAA+v8FAAUA+v/6/wAAAAAAAPr/+v8AAAAA+v/9/wIA/f8CAAIADgAAAPr/AAAFAAUABQAFAP3//f/6/wAAAAAEAAAAAAACAPT/+f8AAAAAAAAAAAAA9P8AAAUA+v8AAAAAAAAFAPr/+v8AAAUABQAFAAsA/f/3/wAAAAAAAAAACAD9/wIA/f/x/wAAAAAFAPr/+v/6/wAAAAD0/wIA/f8IAAsAAAD6/wUABQD6//r/AAAFAPr/+v8FAAAABQAAAPr/BQAFAAAAAAAAAAAAAAD6//r/+f8EAPr/9v/9/wIA9/8CAAcABwAEAPb//f8CAA4AAAAAAAUAAAALAAIAAgD9//3/9//9//3/+v8LAP3/9/8AAPT/+v/3/wIACwAFAPr/8f8IAAIA/f8IAAAABQD6/wAABQD6/wUAAAD6/wAAAAAAAPr/+v8LAAUAAAD6//r/AAAAAAAAAAD6//r/AgAAAAUAAAAFAAUAAAAFAAAAAgD9//b/+f8FAAAAAAD6/wAAAAD0/wAAAAAFAAUAAAAAAAUAAAAFAAAAAAAAAPr/AAD6/wAAAAD6/wAA+v/9/wIACAAFAAAAAAD6/wsABQD6/wAAAAAFAAgAAgD3//3/AgD9//f/+v8AAAUA+v8AAAAA+v8AAAAA+v8AAPr//f8IAAsAAAD6/wAABQALAPr/AAALAPr/AAAFAP3/CAD9//3//f/2/wIA/P/6/wUA+v/6/wAA+v8FAPn/AAAAAPr/BQAAAAAA+v/9/wUAAAD6/wIAAAALAAUAAAD6/wsACAD9/wIAAgD3//H/AAAFAAAAAAAAAAAA9P8AAAAA7v8CAAgAAAD9//f//f8IAAIACAAFAAAAAAAAAAsABQAAAAIA+v8AAAUAAgD3//T/+v8FAAAA+v/6/wAAAAD6/wIAAAAFAAUA+f8AAPr/AAAFAAQAAAD6//r/AAAKAAUA+v/6/wAA+v8AAAAAAAAFAAUABQD0/wAAAAD0/wAAAADx/wgACAAAAAAACwAFAAAAAAAAAPr/9P8FAPr/+v8FAPr//f/9/wIACAAFAAAA+v8AAAUACwAAAPr/BQAAAAAAAAAFAP3/+v/6//r/BQD0//r/AgAFAAAAAAD6//3/AgAFAAAAAAAFAPn/+f8FAAQAAAAAAAAA+v8EAAUA+f8FAPr/+v8FAAAAAAALAPr/AAALAPT/9P8AAAAA+v/3//3/AgAIAAgAAAD6//3/CAAFAAUA+v8FAAsA/f8AAAIA/f/9//3//f/9//r/BQAAAPr/+v8AAAAA+v8AAAAA+v/9/wgABQAFAAUABQD0/wAAAAAAAAUAAAD6/wAABQAAAPr/AAAFAAAABQAFAP3//P8CAPb/AAD6//T/AAAKAPn/+f8FAPr/+v8FAAUA+v/6/wAABQD6/wAAAAD6/wIA/f8CAAUABQAAAAAABQD6//r/BQAAAAAACwAAAAAAAAAAAAUA/f/6/wUA+v/6/wUAAAD6/wAA9P/3/wgAAgACAAUAAAAAAAUABQAAAAUAAgD9//3//f/9/wAAAgD9//3//f/6//T/+v8AAPf/AgACAAIABwAAAAAA+v8CAAQABQAEAAAAAAAAAPr/BQAFAAUA/f/6/wAAAAD6//r/BQD0/wAABQD0//3/CAAFAAAABQD6//r/AAAAAAAAAAD6/wAAAAD6/wUAAAD0/wIACAAFAAAA9P8FAAUABQAAAAAAAAAFAAIA/f/9//3/+v/6/wsA+v/6/wAABQAAAPr/9P8AAAUAAAAAAAAAAAAFAAAAAAAFAAAAAAAAAAAABQABAP3/AgD2//r/AAAFAAIA+v/6/wUABQACAPf/AAAAAAAA+v8AAAAA+v/6//3//f8CAP3/CAACAP3/CAACAAsACwAAAPr/BQAAAAAABQD9/wAA9P/6/wUA+v/0/wIAAgD9/wIAAgACAAIABQAFAPr/AAAFAAAAAAAAAAAABQAFAPr/+v8AAPT/AAAFAAUAAAAAAPn/+v8EAAAAAAAEAAAACwD6//n/BQAAAAUA9P/6/wUAAAAAAAAA+v/6/wAABQAFAPr/AAAFAAUAAAAAAAAA+v/0/wAABQAFAAAAAAAAAAAABQD6//T/AAAFAAAA+v8AAAAAAAAFAAUA9P/6/wUA+v/6/wIAAgAFABEAAgD9//r/CAD9//f/CAD9//f//f/0/wAABQD6/wAA+v8AAAAAAAAEAPP//P8FAAQABAAAAAAABQAAAAAAAAAAAAAABQD6//r/BQAAAAsAAgACAP3/8f8AAAgA9//0/wAAAAAAAAAAAAAAAPr/+v8AAP3/CAAFAPr/+v8CAAUABQD6/wAABQAAAAUABQAAAAgA/f/x/wAA+v/6/wAABQAAAPr/+v8AAPr/AgACAAUA+v/9/wIABQAAAPr/CwAAAAAAAAAFAPn/AAAFAPr/BQAEAAAA+v8EAAAA+f8FAPP/AAAFAPr/AAAAAAUA+v8AAAAAAAAFAPr/+v8FAAUA+v/6/wAAAAAAAAAAAAAAAAAA+v8FAAUAAAD6/wUABQAFAAIA/f/9//3//f/6/wAA+v/0//f//f8CAP3//f8OAAIAAgACAAIABQALAAAA+v8LAAIA+v8AAAAA+v8AAPr/CwAIAPH/AAAAAAQAAAD0/wUAAAD6//T/AAAAAP3/AgAFAAUABQAFAAAAAAAAAAUAAgD9//3//f/6//r/BQAFAAAA7v/6/wUA+v/9/wgAAAD3/wIACAAAAAUABQAAAAAAAAD0/wUAAAD6//r/AAALAAAA+v/0/wIAAgACAP3/AgACAP3/CAAAAAAAAAAFAAAAAAAAAAUABQD0/wAAAAD6//r/+v8LAAsA9P/0//z/AgAFAAQAAAAAAAQAAAD5//n/AAAFAAUA+v/6/wAACwALAPf/AAACAP3/AgD9//f/AAAAAPr/+v/6/wAAAAAAAAAAAAAAAAAABQAAAAAAAAD6/wAABQD6/wUAAAD6/wUAAAALAAgA/f/3/wIACAD3//H/AAAFAPr/+v8AAAAA+v/0//f/CAAOAAAAAAD6/wAAAAD9//f/FAALAPT/BAAFAAAA+v8EAAQAAgD0//r/BAAAAPr/9P/9/wIA/f/9/wgACAAAAPr//f8IAAUABQAAAPr/AAAAAAUAAAD6/wUA+v8AAAUAAAAAAPr/AAAFAAUA+v/6/wsABQACAP3/9/8AAPr/9P/0//3//f/9/wIACAACAAgAEQAFAPr/AAAAAAsAAgD3//r/AAAAAAsA/f/0/wAABQAAAPT/+v8AAPn//f8CAP3//v/+/wcABwACAAQAAAAAAAUAAAD6/wAABQALAPr/+v8FAAUAAgAIAP3//f/3//3/AgD3//r/+v8FAPr/+v/6//f/CAAFAAUAAAAAAAAACwAIAPf/AAAAAAAABQACAP3/AgD9//f//f8AAPr/AAAAAAAABQAAAPr/BQAFAPr/+v/6/wUAAAD0/wIA/f/9/wIA/f8CAAgACQAAAAAA+v/2/wIABwALAAAA+v8EAAUAAAAAAAAAAAAAAAAABQD6/wAAAAAFAAUA/f/6//T/+v8FAAAA9P/3/wIACAD9//3/AgAOAAsAAAAAAAAABQAAAAAAAAD6/wAABQAFAPr/9P8FAAUA+v8AAAUABQAAAAAAAAD6//T/AAAFAPr/+v8FAAUABQAFAAAAAAAAAAAAAAAAAPr/+v8FAPn/AAAKAAAA+v/6/wAAAAAEAAUA+f8FAAUA+v8AAAAABQAFAP3/+v8AAAUA+v/6/wAAAAD6/wAACwD6//r/BQAAAAUAAAAAAAAAAAAFAAAA+v8AAAUABQD6//T/AAALAAUA7v/6/wUABQD6//r/BQD6//r/BQAFAAAAAAAFAAAABQAIAP3//f/9//3/AgD3//r/+v8LAAAA+v/6/wAACwD5/wAABQD6//r/AAAEAAAAAAAAAAAABQD6//r/AAAAAAAAAAAAAAUA+v8AAAUACwD6//r/BQAFAAIA+v/0/wAAAAAAAAAAAAD0//3/CAAAAPf/AgAIAAAAAAAFAPr/AAAAAAAA+v8LAAUA+v/6//r/CwAAAAAABQD6/wUABQD6//r/AAAAAAAA+v8AAAAAAAAAAAAAAAAFAAUA+v8AAAAAAAAEAPP/9P8FAAQAAAD6//r/CwAAAPn/BQAFAAAABQACAPn/+v8FAAUA+v8AAAAABQAAAPr/+v8AAAAAAAAFAPr/+v8AAPT/AgAIAPH/AgACAAIACAACAP3/AgALAPr/AAALAAsA/f/6/wUAAgD3//r/AAAAAPT/9P8IAAUA9P/3/wIAAgD9/wIACAACAAIAAgD9/wsABQD6/wAAAAAFAAUABAD8//r/+v/6//r/+v8AAAAABQAFAPr/AAALAAUA/f/6//r/AAAFAAAA+v8FAAUA+v/6//T/9/8IAAUA+v/9/wgAAAD9//3/AgALAAUAAAAAAAAAAAD6//r/AAAAAPr/AAAFAAAA+v/6/wIA/f8IAAAABQAAAAUABQD6/wUABQD9//T/+v8FAAUAAAD6/wAAAAAAAPr/+v8AAAUAAAD5/wAABQD6//r/AAD+/wsABAD6//n/+f8AAAUAAAAFAAAA+v8FAAAA+v8FAAUAAAAAAAAAAAD0/wAABQAAAAUAAAD6/wAABQAAAAAAAAAAAAAA+v/6/wUABQAAAPT/+v8LAAAA+v/6//3/BQALAAUAAAAFAAAA+v8AAPr/AAAFAAAA+v/6//r/AAD9/wIA9//9/wgAAgACAP3//f8CAP3/9v/5//r/+v8AAAAA9P8CAAQA9/8CAAkAAAD9/wUAAAD6/wsAAAAAAAUABQAFAP3/+v8AAAUA+v8AAPr/+v8FAAUAAAAAAAUAAAD0//r/AAD6//3/AgAIAAAA+v8CAAIA/f8CAAUABQAAAAAAAAD0/wAABQAAAAAABQARAP3/9/8CAAIA/f8CAP3/9//9//3//f8AAPr/+v8AAAAA+f/6/wUAAAD2/wMAAwADAPr/AAACAAAABAD8/wAAAQADAAEA/v8GAP7/AAABAP3/AQADAAAA/v8DAP3//f/7//b//f8CAAUA9//8/wcAAgD7//3/AgADAAcAAAABAAYABwABAPz/AQADAAEA9P8AAA0A/v/7/wEABAD8//v////+//3/+f/9/wIA+//+/woA/v/7/wAAAgAEAPr///8HAAEAAAD+//n/AAACAAAAAgADAAIA//8FAAIA/f///wAAAAD7/wIAAgAAAPj/+/8IAP7//P8AAP//AAAAAPr/+v8DAP//+////wkAAgD6/wAA///9/wAAAAAAAAAA///7//b//f8CAP//AAACAAAAAAAAAP3//v/8//z////9/wMABQADAPz/AAALAAQAAAD8//j/+v8DAAAA/P8AAPn/AAACAAEAAAAAAAQABgABAPz/AQACAPz/9v/8/wEA/f8EAPr/9v8DAAQABAAFAAcAAQD6/wEABwD8//v/+v/3/wQA/v/8/wAA+//7//3//v8AAAQAAgAAAP3/AgAGAAEAAgAAAAAAAgAFAAEA+f///wQAAgD+//b//P8FAPn/9f8CAAUAAgACAAEA+f8AAAcA/v/5/wIAAwD4//n//v8CAAEA/P////3/+P8CAAMA+v8AAP///P/9/wMAAwADAAIAAgAAAPr//P/8/wMA/f/6//z/AAAHAPz/BwAFAPT//f/9//7/AQD6//r//f8AAAYACAAAAP7/AQADAPz//v8AAPv/AwD+//r/AwACAAQA+f/5/wQAAgD9////AwABAAUAAQADAAQA+v/9//7/AwADAPv/AAAGAPr/9v8DAP///v8FAPr/+v8CAAMAAgD//wMA/f/4//3/+P/4//v/+P8BAAQAAAACAP7///8FAAQA+v/8/wAA/v8AAP3//f8AAP3//v8BAAAA//8BAAgA/P/4/wUAAwACAP3/+v/+//7/+v8BAAMAAAAEAPv//v8AAAIABwD7/wYAAAD6/wMAAwAAAAAAAAD5//3/AAD7/////////wIABwACAAAA///+/wQAAgADAAEA+/8GAAEA/P/9//r/BAD9/wEABAD6/wEABAABAPz/AAD//wAABQD6//j/AAAHAAAA/f8AAAAABgAFAAAA/f/8/wIAAQAAAAQAAAAAAAEA/f8BAP//+f8AAAIAAAAAAAIAAQD4//j/BQAIAAAAAAD///3///8AAAMACAD+//n/AwD8//n/BgAAAP//BwAGAAMAAAACAAQAAAD2//r/AwD6//r/AwADAAAAAQAAAP//AQD+/wQA/f/6/wEA+v8AAP7///8AAP7/AwAIAAgAAAADAAUAAgD+//j//v/9//7/+v/3/wAAAAD8//7/AQD//wYAAgD8/wUAAAAEAAoABgD+//b/AwAAAPL/AAAFAPz//f8AAAMAAQD7//7/AwACAP///v8AAAAA/f/+//z/AwAAAPr/CAABAPv/AgD//wEABQD7//7/AgD5/wIABQABAP7/9////wMA/f/4//b//v8AAPn/+f8FAAkAAAAAAAYABgACAAEA/f8BAP3/+f8BAPr//v8AAP7/+/8AAAoAAQADAP7/AAACAP3/BAABAPr/AAAIAP3/+P8AAAYAAwD6/wAA/v8AAP//+v8EAAIA//8BAAUA+v/4/wMAAAADAAQA/v/9/wAA/P/8/wYAAAD5/wAAAAD9//////8KAP7/9f8AAAMAAAD2//r/CgACAP3/CAD///r//f/6/wAA+P/4/wIA/P/5//z/BAAEAP//BAAFAAYABQD4/wQAAgD6/wIA+v/6//7/+v/5//7/AAD6//7/AQAIAP7//P8EAPv/AAD+////BAD+/wQA///5////AQADAAAA/P/9////+f/+/wAAAQAIAAAA+v8BAAIA+/8AAAAA+P8AAAYAAAD9//3///////3/AgAHAP//AAD+/wQABQD5//z//f/6//z//P/+/wEAAgAAAAIAAQABAAAABAAJAP///v/9/////f/z//v//f/+//7/+//9/wMABAD5/wEAAQD+/wYAAgD//wAAAAAEAAAA/v8AAPn//v8AAP//AQAAAP//AAAEAPr/AAAIAPz//f8AAP////8AAAMABAAAAAAAAwD//wEAAwD///n///8BAP7/AgD9//n/AAADAPX/+P8AAAAAAAD3/wQABgAAAAAAAAAHAP3/AAADAAEA+P/8/wUA/P/8//z/AQACAPz/AAD6//r/AQADAAMAAQD///////8FAP7/+/8HAP//AAABAPn////6//T/AAABAAAA//8CAAQA/P8CAAQAAgAHAAMA/f/8/wUA/v/6//n/9//+/wIAAQD3/wEA/v/9/wEA/f8DAAAAAQD///v/+v8EAAMA//8DAP//AwADAAAA///+/wEA/P/4//7/AgD//wAAAAD7/wAAAwAAAPv/AwAIAPv//P8DAAAA/f/9/wEA//8AAAgABAD///r/AAAAAPj/+P8AAP7//v8JAP3/AAAEAP7/AgADAAUA/v/+/wcABwD//wAAAQAAAAMA+v/4//j/+P/8//7/AAABAAAA/f8EAAIA/P8CAP7/AgAFAP3/AQD///3/AgD+/wAAAwABAPn//P8CAPz//P8AAAAA+/8AAAEA+f8DAAMAAAABAP3/AAAHAAEA9v/9/wEA/v///wcA/v/y/wAABgADAP//AAAEAAAA+f/4/wAABAD+/wAABwAAAAAABAAAAPf/+f8AAAAA/v///wUA/v8BAAYA+P/+/wMA///+//v/AQD+//n//v/+/wQAAAADAAMABgADAP7/BwABAPn///8BAPb/+v8AAP7//f/6/////v8AAAEAAgACAP//AAD+/wEAAAD///7/AAAEAP3/AAD///3/AAD5//z/AQAAAP3/AAAAAAMACgAGAP7//v8AAP7/AwD8//j/BQD///3/AwAAAAAAAAAAAPf/AAAIAAAA/P/6//7//f////r/9/8AAAAAAgD6/wMAAAD8/wYA//8GAAQAAQAHAPz//f/+//7/AAAAAP3/+f8CAAEA+P/8//7/+P8AAP7//f8CAAUABwD7/wUABAD5/wYABAD9//3/+//8/wQABwD///z/BwD9//v/AgD1//r/AQAAAPv/9v///wcABgD4//3/BQAFAP7/+f8BAAIA///6//7/AQAAAPr///////7////6/wMAAwD8/wAAAgAAAAMA//8CAAkA//8CAAEABAAAAPb//f/8//j//v8FAAIA/v/8/wIA/f8AAA8AAAD+//z/+/8AAP3/AgAAAP7/AQAHAPv/9/8AAAAAAgD3/wEA//8AAAcA/P8AAPz/AQABAPz/AwACAAEAAgAAAAAAAAD6////AwD//wQAAgD5//v/AwD9//3/AQD+/wAA///7//7/AQACAP//BAAIAPz/+f8FAAIAAAACAP3/AAD2//b/AAD7/wAAAgACAP3//P////n/7f/4//b/9P/5//n/7//+/wIA/v8FAP7/+/8AAAAAAwD9////9P/4/+z/9v8HAAEA+f/4/xwACQADAAUAAwAEAAIADwD3//v/AQD7/wsA8//s////GAAJAOf/7P8LAAcAAADy/wIABQBFAEsAMwDK/9L/AADz//b/4f/M/8X/7P/s/+P/7P/s//L/2v/w/yMAEAD5/+f/x//G/+r/DQALAPL/2//3/yMAKAAGAPn/AAAKABkAGAAaAAoA/v/+/+r/6/8EAAsA//////P/2//v/ygAPAAjAPn/7v8YADwAIwDo/9b/wP/U/wMACADX/8//5P8YACsAGAD0/+z/4P/q/wQAJQAXAO//0P/j/wIAHQADAOb/6P/x/wUAHAAUAA4A7P/S/+n/DAAfAAgA0v/Q/97/DwANAAUA9P/t//n/EwAaADEA8f/N/93//v8ZABcA4v/h/+X//f/7//3/EQAAAN//7v///yEAKAAoAO//1//r/+j/CgAfAAEA5f/g//D//v8FAAsA+v/c/+b/5P/7/xQAIAD9/+P/4v/p/wMACwAjABIA5f/n/xoAOQAOAOf/yf/g/wgAJQD+/7//wv/E//j/KgAwAAAA3f/g/xgAPQAdAOP/wP/h/xIAJgAAAOz/6P/S//f/IgATABAAAADo/+v/DAAOAOj/2v/4/wsAGAALAO3/0f/s/wsAEgD8//b/3//u/wsACwAHAPj/+v/r/xkAHwAFAAQA5f/w/xUACwD3/+T/6//6//D/+P8GAPX/6v/6//v/+//u/wAABQDr//b/5//p//z/BAD///7/EAAOAAQAAADY/8f/5P8GAB4AGADn/9r/7P8GADUAJgAmAPn/6f/y/xYAGgACAMH/zP/4/woAMAAQAPD/4P/1/yUAFwAgAAoAy//m//P/DAAcAPb/6P/r//n/CgD7/xIA6//n//j/+P/4/xkACAD+/+z/9//6/wMA+P8JAAEA+f/b/8X/9P8JAAQA9//v/wMAGwAsABcA+v/f/+//IAAOANr/zf/Y//D/MAA+AAMA4P/X/+3/EQAVABUA8P/Y/8X/yP8BACIADgDp/9D/6/8mAD8AJAD1/9P/4P8AADgALQARAPf/2P/O//D/BgAGAOP/3f/k/wYAIQAaABIA+P/q//n/CQAMAN//u//P//T/HgAlABAA3v/o/wQAOABAABgA/v/Y/+j/+v/x//r/0v/J/+3/DgA9ACMABQDq//P/AwANAA0ABADg/9T/0v/z/woABQABAOz/DQACAAoACAACAP3/6v/t/wUABgD6//b/3f8BAAwAIgAWAPX/6P8FAAYAOAAXAOv/3//0//X/9v/5/+j/1//h//X/7f8DAAYA9/8CAAAA//8IAB8A6v/Z/97/8f8LAPb/6//w/xYAJAAoADAAJwAIAOD/6//s/+P/tf/e/+r/9P/O/9f/+P/w/y0AMgAeABUABQADAAcADgD0/9P/2v/u/wEAHwD0/9v/1P/w/yQALQAXAOj/1P/r/xwAGwAEAAwA7v8PACkAIADs/+D/7//3/wQA9P/l/+D/8P/9/w0AAAD6/wEAAwAMAA4A/v/o/+j/9f8RAAgA+P8NABIAHwAQAOb/+v8QABcAGAD8/9X/4P/p//7/AwDn/+L/8//7/y0ABQDp//z/CAARAAIA9P/s/9f/+f8YAPD/xf/N/97/7v/o/+H/0//f//r/AAAOAPT/3v/8/xAAHgAQAAsAGQAdACIARwBtAG0AUgAvABgAAgABAAgA8//H/4r/d/+V/6n/kv94/w3/9v43/2D/ev+C/2v/hv/Y/0QAjACoAL4A4gA7AZwBugHIAXoBSAEKAfgA2ADk/8T/sv+u/5f/if+D/3r/hP+H/4H/if+M/43/kP+X/5z/l/+g/6f/qf+y/6n/tP+0/7z/zf/H/9T/0P/V/9T/0v/g/9n/7f/r/+D/8P/0//D/9f/6//n/+//9//j/////////AwAJAAsABQAIAAoACgAHAAAABAATABQAEgAQABEAEAASAA0ADAASAA0ADwAKAAsAEQAKAAAACAAOAAkA//8HAA8AAAACAAoABQD8/wQACgAIAAsABwAIAAEA///5/wAABQABAAAA/f///wcABAD9/wEA/v/6/////////wEAAQAHAAMA+/////v/BQAAAPn//P/0//v/9//1//r/8//3//f/9v/4//z/+v/2//j/+P/4//r/+v/z//X/9P/z//v/+P/y//j/+v/4//b/+P/7//n/+f/7//v/+//4//f/+//x/+3//P/z//L/+P/9/wAABwADAAEABgD4/+7/+v/7//v/CQD3//P/BgD2//H/9f/3//j/6//i//3/CgD///7//v8EAAkA+v/9//z/DwARAA8AHQASABAACAD+//j/6P/m/97/1//f/+D/7P/s//z/AAD//wYA+//k/8T/5P/9/97/6f/q/+7/CAD5/wgAEAArADQAKQA0ADQALgAXACEAFADr/+j/3f/V/8X/6/8CAAAAGwAQABwAHADY/6r/iP+m/87/uP/Z/+r/BAAIAO7/BAD8/wkAGAAWADcAMQA7ADAAKADr/9j/AAD2/8b/3/8gACIAJAA4ADgANwATAMj/qf+J/4r/uv+a/63/AgAQAA0AGQA6ADcAOQBiAFAARwB2AF0ARQAeAPP/CQDz/8b/n//A/9f/vP/Y/+L/5P/4/x0ACACr/5//rv/O/4X/aP/J/7f/tP8MADsAaACQANgA3gDAAN4AtwB/AEoA8P/o/4H/if9o/y//xf/D//7/PwB5AH4AjACLANv/oP9n/4L/Ev/I/iL/y/7Q/lf/p/8sAKgAawHMAdEBFQKvAUgBwQDy/4j/x/6B/mD+Ev62/hv/h/8mANgAHAE/AZ8B6ABoANb/jf+q/tP9S/7o/dr9tP5N/xwA3QD7AXsCogIgA4YCFQJxAW8Axv+m/iX+fv0g/Yj9wf1a/gb/t/8/AMMAIwHRAHgAFwAOACz/lP4X/3z+eP46/8r/gAAxAU0CqgLhAlcDwwJUAqMBpADg/7z+N/6E/er8df2Z/RP+9P5p/zAAuAAnAQcBpQBrADkAev+w/vz+T/4D/vb+Mv/7/9sAMwLNAjMDEwSEA3ADCgOzATIB5f8v/3r+Yv20/Zf9o/2F/pv+S//q/zAAXAAEALj/xv8p/3T+zf5b/jb+M/9s/xMA8QCqAUQCVAImA4QCYwJNAv4AugCy/xv/oP6D/dD92P2L/W7+pv4s/6z//v9YAB0Ayf/y//L/Av+X/53//v4aAIgAtgClAb0BUgIaAg0C9QEYATUBBADp/zn/bf6C/qv9qP0b/uj9hP4x/5D/LQBLALIAnAAAAMX/BQBc/wP/yf/J/kT/XQAWACUBfgENAj8C+wFPAlwBYwG+AOj/sP/L/p7+4P23/fD9B/5s/gr/vf9LAJ0AEAEdAQwBowCIAJUAev99AMn/UP/cAMT/uAB5AREBFwKBAdEBawHgAOEAzP+d/9f+W/7g/T/9mv2Q/fL9kf4l/+n/PAAzAAQBpQBnAH4ApQBw/5EA5f9j/94A5P+GAGYBqADoAXYBQgGgAbcAxQAwAJT/Lv+6/jz+9v0K/hz+a/7e/l3/NwA4AE4AvwBsAB8A1f/6/xT/fv+w/4P+6P/I/5b/YQHgAO8BBAIbAl4C4AHlAdoA4ADf/1P/cP9w/t/+6f5l/mn/OP/d/w0AmP8XALH/Lf++/tn+wv1M/or+uP34/jv/Qv/9APIABwJbAogC8AKVApkCuQGsAcgAIAD3//L+FP/P/of+Jv8M/1b/z/9R/6z/d//U/pz+s/7d/Wn+1/4t/mf/p/+//3ABMAEVAm8CZALKAlgCQAK/ATgBqgD1/63/7/7c/nL+cP7V/qX+SP9D/xT/jv8P/3D+e/7U/q39Av/I/kD+DQBh/ywAyAEzAX0CdwJxAuMCPgIkAqsBFAGQAAgAh/8V/xD/iv73/hT/D/+I/0b/ov9r/9X+tf4T/0j+y/43/0X+q/9//4n/AQHvAMgBQQI8ArwCeAIlAtUBLgGTACgAiP8G/wH/gP6k/vD+gv5E/0P/EP+g/9D+bv5j/2b+t/5f/1j+oP/y/7D/TAGQAdABoAJ1AqYC3wLxAc0BUQE4ABcAYP/L/rv+Y/6J/tr+nv45/3X/Tv/G/wj/0v6b/6X+Hf+Q/7j++/8lAA4AiQF8AcABjAIzApMCcwJ0AXcBoQCL/7D/ov4B/l3+v/0r/oP+WP5V/3j/hP8GACT/sP/n/8n+JQCF/x7/uwDL/5wAqAEcAe4BPALdAVgCtwEVAQMBuv9V/xL/8v0c/gv+1/2C/p7+5/7R/7P//f/m/8T/OgBr/wAADABG/60AFQB6AJ4BMgH0ATUCAAJiAtgBSAEoAfb/eP8C/yX+C/7A/ab9A/4u/oD+E/85/3P/NP+A//f/JP8wAAwAfP8sAV4A/ADeAVIBIwJDAh8CegLWAa4BXQFZAPj/BP+M/hf+zf22/an9+v0t/qT+3f5B/8L+nf+1/1f/3QDw/9wAoQHpADEC9AHqAaQCUAJsAv8BggE4AV4A9v/p/mz+Ef6f/b79ef3Q/RX+YP7H/hD/kP4Q/8r/1/5nAEEA7/+AAecAfwFaAtUBmAKIAj4CGAJ5AR8BYgDc/wb/dv4s/rz9w/2Y/Xr9/P0H/jr+zP4v/tT+x//I/mUAgQAIALQBcgEcAtACSwL5AtMCkAItAicB7ADx/4D/yP4i/vD9ev2b/a/9WP0V/kz+hP4o/4D+yv8VAKb/gQHcADQBjAL2AfYCzAJwAvwCJQJIAksBYAAzAPz+2/7Y/X39mv0C/aD9lv1L/WD+VP7K/l//sf4YAD4A8P+sAQYBLQGiAuYBswLIAisCtQIIAvABHQFGAB8A4P7e/hb+YP31/Tf9g/0f/kj9dP7A/qn+n//l/sT/hwDY/34BPwH2AJ4CCgLHAhADXAK1AmcCHAI6AYcAEQCq/sv+Cv7f/MX94Pwn/UT+/fw//uL+W/6g/+r+h/+dANj/awFZAekAmwIiArICEgN2ArACbwIWAjwBoABEANT+/f5b/hD9Af7k/CT9S/7B/P39kv7//Uj/kP43/4sAQgBdAVABZAFzAlgC3wLbAqACqQJPAiYCMAGfAD8Axf4I/2H+JP0L/v78Qf1Z/uz8YP7a/mD+vf///rL/vQCwAKwBPwGmATAC7wGTAjMCBQIDAnwBwQFzACUA2P+K/vr+Q/51/UL+Uf3B/aH+fv25/hj/sv7Y/+r+kf9xADkASQCaAGcBbgHcAWQCGQJJAlYCZAJsAfIAvQCC/3P/B/8T/nL+0v3y/Y7+bf1g/tr+hv5H/5z+NP8IAAQAHABwAD0BWAHOAUoCIQJPAl0CdgIRAlkBTAGBAAEA0P8b/7b+Tf7u/S7+k/1d/RP++f0A/kf+TP72/o3/wf/+/70AUQG6AQkCYgJ2AmUCkwJ5ArMBTQHzACgAwf+V/wT/mP5m/gv+Dv4c/gz+Qf7g/tr+Mv+N/7b/VgC1AMUAIQFyAaABtQGqAdoBXwE6ATgBkAA/AOj/h/8g/+/+4/6G/oP+f/6g/vL+9P7l/ov/eP92/+7/1P8GABMAUgBVAEgAggBxAH4AWACcAJQAcAByAFwAUAASAC8AGAD5/w8Awv/R/83/oP+w/6L/sP+t/6z/yP+u/97/6P/i/wAAKAAJADgASABQACoAPABcADYALgANAEsADgAZAAkA7v8dAPj/FQASAP3/CQD6/+j/7//R/9z/qf/J/wgAx//t//H/9P8YACoAGABEABMAQgBVAOn/PwAqANn/QgANAEQA3/8MABcA/P/6/+//7//A/6//9P/I/9b/zP/X/9L/wv+9/97/zP/U/8D/1f/k/9f/8v8OAAwAAAAfACsACQArAPX/LgD5/wgADwD3/wcA9f8TAPv/9v8vANH/FgD5/+v/BgDo/wQABwDf/w8A+P8gAAIAGQAYAAMAGgAIAAcACADk/wUAEwASAPj/CwAHABIA/f/s/wUABADy/wcACwDs/9v/DAACAPH/6f8EAPP/rf/t/87/zf/H/9b/4v+9/9r/4v/4/+j/AAAfABIAGQAIADUAAAAbABwAFQD8/yEAFQAYAAMAJAATAO3/3//2/+X/0f/d/93/3f/4/9X/+P/2//n/DgAIAOn/CwAIAP//IwAuAAoAEwAoABQAEgAqANv/GAADANn/6P/f/+f/yf/V/+P/6f+t/93/7v/r/wIA5P8UAA0ABAAnAA0AGwA1AP3/MgA4ACUA+v8YABcA9P/r/w4A8P/U/9r/BgDh/87/4P/u/+n/6P/h//j/9f/i/wEAIQD//wsA//8fABYA/v8DABYABQDr/+P/+f/v/+D/yP/2/8//y//2/9T/7v/L/woA9///////GAA/ABgAKgA8AEYAOQBEACQAIAAlAP3/+v/9/97/0//H/73/uP+3/6T/qv/F/8P/yP/4//v/AwAIACcARAA9AEsAOABIAEwARgAgABgAMwADAN//6f/0/8z/xv++/7r/pv+4/8z/uP/K/9f/6v/v//v/EAAMADcAHgA7AD4APgA5AEIANgAoAA0ABgANAOP/6f/h/8v/x/+//+D/yf+m/8X/3v+1/9j/BgD6//j/AwAgACwAKAAqADEANwAxADAACAAGABgAGQDk//P/AwDY/9D/5P/l/8v/zv/g/9H/uv/X//r/8//9/wcAIgAQABoAGAArADAABQAkACAACAAGAAkACAAAAOn/8f/7/+L/6P/t/83/+f/l/9j/6//0//D/4P/5////AwAGACgAGQAQAAAAGQACACQAAwATAAUA6//9/xQAAwDW//L/+P/Y/+X/9//m/9X/7v/r/+j/+f8DAPX/9//8/xgA7/8gAA8AKAAIAPL/FwAfABkABQANAPP/9//+//f/+P/d/+H/7P/v//D/+v/o/+/////6/wIAFAD9//z/BQAFAAsAAAAdAAoACgAyAAgACwDv//j/6v/r/wUA4/8OAOz/BwDz//n/2f/v//T/4v/i//L/+P8AAOz/9//8//7/BAAgAP7/BwAYAAsABgAFAAoA9//s//r/7f/n/+v/7f/n/+j/8//6/+3/9//p//v/7P/g/woA8P8TAO3/LgATAP7/LAA0ABsA/v8dAAIA+//7//j/9v/P/wAA6P+8/8r/zv/K/8T/4P/t/+v/MAAiAF8AQQBsAHcAjABvAF4AZQAsAB0A/P/O/7X/bf9W/0D/Q/9C/xz/Mf9Y/5L/lP/s/w0AYgCNAAgBCQEQASgBPwHtALcAYgD5/6j/J/8L/87+vf6h/s3+Gv9L/8b/IAB0ANMAFAFAATMBCgHkAIUACwC+/1H///7C/r/+1/4Q/2X/3f9HAJQA7wBSAU0BOAEaAcUASQDa/1r///5Y/mr+dP6W/vX+cv8HAH0AGAGKAbAB5AG/AYEBCwGGAAAAYv/w/pX+TP5S/n3+tf4Z/3v/8v9vAMgA5AAaARoB8QDAAHsAIADG/3v/Z/8O/yP/I/9Q/3z/0f8eADcAgQCkAJwAjQCPAGgAKgAOAPL/xv+n/5//lP+X/67/zv/k/xIANgBNAGEAcABfAEsANgAaAPr/1P/K/7D/jP+d/53/uP/J/8f/8//p/87/5v8EAOr/9v80AFEAgwCwAOMA6QDIAMEAygBjABgA5/96/wz/sP51/uv9pv31/U/+vf6Y/3EA7ACrAUgCWwJQAlgC/QEOAZAAyv/q/oH+HP5I/jD+zP5M/5H/QwCzABEB8QAqAQgBcABKAMf/e/8A/yz/L/8E/7f/0f9BAHUA2wDhAKAAxAAwAMP/QP/V/of+Pf6B/pD+Wv8hAMQAbwGiAT4CBQIHAr4BBAHEAK7/Vv+W/jH+Kv5a/r/+Uv9BAJgANgGRAZABQgHlAHoAMP+c/sv9Pv3V/P/8i/1p/rb/AAEYAtUCQQOFA/8CcgKtAagAv/+I/hj+3f2U/RL+2v5L/wAAGQFVAYYBzQGCAf0AhgARAPr+p/5Y/ur9G/5k/tD+8/5x//b/vP/w/0QAWAB6ANIAAQHiAOgAtgDQAJsAxgDFAGEAngBgAA8A9f+i/6H/nP+Y/2MANwDMAP4AggChAI//Wv+7/rz9o/02/Vj9Xv2v/Vb+Wv+MAKABzgIoA1gDSAPmAiAC1wB5AGj/hP6+/pb+ov4A/67/5v8hAMsAuAClAMYAlwAKAG//af/i/qP+Qv9H/9X/eQDdAPoA5gD2AGwAyv+6/4v/Jv9M/3P/gP+r/8X/FQDh/yYAEQDv/wgAJgA7AEoAHgABANb/yf+9/4z/Xv8s/zb/Qf8l/2b/OP9o/5j/iP/R/z4AlAAxAYcBvgHFAdoBkwF4Ae8AkQB4AMX/tf+G/4//d//e/1oAfADBABoB5ADjAOUAVAAYAP//cf8N/wb/yP6Z/sf+4f41/0z/ov/a/67/4f/t/8f/wf+u/6z/iP97/4D/Z/92/3n/g/+m/9L/+/8PACMAHQAZABAABgDk/xIAnP+3/7f/bP+U/4X/pP+h/8X/DgATAGcArQDTAOQA4gDmALgAtgB1AEUA3QAiAPH/w/9t/zf/gv+d/7r/bQCfAMgAEAErAdIAkwCRAA8Aqf9H/7j+h/5o/pL+9/5R/yUA0ADSAEsBTQHsALcAtACJAFkAVAB1ABIA4P/A/6f/af9o/37/VP9f/3b/bP9+/6z/1//k/wkADwAEAPf/wf+O/zL/Gf/8/gf/Iv9k/+H/TwCYAM4A9gATAfsA1gDVAJgAZwBNABAA1P++/8D/w//T/+v/+f/d/+T/zf/H/8j/y//Y/7//1v+9/7n/xf+7/7b/m/+o/6v/tP/Q/7//7f8pAGoAwAAGARcB7wDTAJcAQwA2AAoA4P/y/8n/1P/c/93/7P/w/wEA6//w/+j/3f/d/7f/sP+1/7H/t//S/+D/4P/V/87/vf+u/6j/u/+4/8L/8P8fAHIAhwCBAJsAdwBgAD4ANAAAANj/yP+f/5j/oP/J/+//BAAjACcALQAwADEAHAAOAAgA5//o/+b/3f/j/9//8f/n/+L/6P/c/+T/FQA5ADQAXwB0AHgASAAgADkADQDp/+v/0P+w/8f/4P/W//v/GAAEAAYAAADS/6j/DAA5ANX/6f/j/4T/SP9h/1j/M/9y/6r/vv/c/x8AOwA1AE0AhwCfAJ0AqQCoAAUAmgCgAD4AWAAwAPz/mf+E/xEAkv+w/4MAFwDa//j/5f9K/9j+IP9g/x7/T//o/9z/o//Z/xIA4v/V//D/5P+3/+7/KAD7/zIAhwC6AKgApwCqAD0AMQDOANAArADsAO4AsQA6AGQAnADY/+z/UgDO/4T/Qf8g/7f+f/6u/pn+4P5e/5r/5v/w/xkAHgAEAA4ALgARANz/5P+6//T/7P8EAGEAkQC3AK4A2wDEAI0ABAF6AVEBWAF2ATABmgAvAPb/jP/u/t/+iP4P/hP+L/45/kX+8/6W/8X/UgCaAKMAmwBxAFwAIwDR/5T/U/8Y/zD/Jf88/6n/CgBlAGQAngCpAHcA2ABUAUQBRwGiAaUBagEHAcMARgC6/zr//v53/jj+S/5P/mb+pf4y/8L/EQCXANkA8wAHAewAwgCGACgA7v+f/0z/Sf8g//z+Lf9e/67/v/8KADsATgCXAAsBSgE5AbgB7QEDAssBuAF2AfoAiQAQAJf/+P6g/lL+B/7c/ef9Mv5d/qf++/5W/6f/zv8ZAFAAdQCGAJQAlACTAJQAagBJADIANwAJAAkALgAzAGYAuAAHATQBiQG3AcQBrgFpAQYBpAAbAJD/DP+a/jf+2/2h/Wj9af2X/dD9If6I/vn+dv/Z/0QAtgD9ACUBNQElAfwA1gCYAE0ANQAsABYAGAAvAEoAbgDPACABTgGoAcsB5gGoAVYB7QB/AP//eP8I/4/+Ef7A/YH9Tv1J/Xz9qP34/Xb+6P5k/9T/WADEAPMAJAEvAQsB2AC4AGcAHQAIAAgAGQA0AHIApwDUACoBkQHDAfIBFgIRAvQBjgEfAaIAIACU/xn/pf4y/uD9rf2U/Y/9sf3l/Tr+oP4A/3L/3P8rAIwAxgDZAOYAyACtAI0AYABSAEMASABUAIIAsQDAANkA7gABATMBRgE0AUgBQAELAcQAdwAfAMD/cf8q/9j+h/5M/ij+Bv77/Qn+NP5n/rH+Av9C/5f/4v8iAEkAZgBwAHIAVgAjABoAAgDy/wQAKABUAKYA4AASAT4BWQGAAZgBqAGSAY0BXAEWAb4AXAALAK7/XP8x/wT/2/68/q/+q/6w/rz+2P75/in/Yf96/6D/vv/Y//T/AAD4/+j/0P/J/7H/p/+V/5v/v//k/wgARgBvAKYAyQD3AA8BIQE2ATUBKAH+AMkAjABTABcA6f+8/6P/iP+R/4j/k/+b/6r/uf/X/93/+f8FAPr/FQDv/9X/zP+5/63/ov9+/2r/bv99/1f/cv+C/5j/uf/c/xUAIAA1AEQAXwCGAIYAmwCWALEAlwB7ADMALQAiAPz/+v8HAPL/+/////r/CAAXABAAJwBDACMASAAgABcABADM/7//nv96/4D/S/9C/xz/TP8c/y3/Tf9v/4H/o//m//P/NAA4AHUAggC/AK0AvADMAKYAwQCqAJEAfgBgAFoAEQDr/7X/uf+3/5P/p//O/3j/y/+z/8n/4P8RAPn/igAIAGwANwCpADsA///n/7v/y/9i/3//0P6Y/4j+x//b/gH/6P5R/w8Anv8+AAIAngCPAMcAyADXAMkAzwB4AKgAWAB1AEAAHQDp/7v/0v/f/8j/1P8KABMA7v9QAOr/WwArAND/wQDG/9gAe//ZAEsA4P4a/2n/4/4w/9H/bv/u/9v/TgBOAJMAbABGAa8AygCfACIBPQBfAK7/5//r/kH/WP4F/3r+xv4Q//f+3f63/73/9/9VAJQAwQDWAOQAsAHZAP0AsADFABsADADqAFT/FgA2AMn/oP9N/w7/tf9V/3L/rv8UALH+SwGR/50A///GAIYBO/8pAOz/lwCA/3H/iv+J/5D/Jf/s/1kAbf64AA3/qQA//kcC9/4FAeL/DwHTAEAAtwAXAMEAwf6VABv/5f81/43/FgAlAGwA1P+YAAz/qAA4ANj/FwDf/+j/ygBd/1YA0f9bAGT/4gBt/1UAr/9d/3gARf7QAfD9oAG2/t0A/v44ALQABf8iAQ3/7gDi/00A9f9Y/3ABqP44Amz+dAE1/8sA0/8W/10Be/5KAYf+FQDk/sj/LACI/0gAff+AALn/UgDS/48BQP4OAV3/ngBr/mwBN//e/1AAxP9tAA7+EgJs/hcBOf8rAQ//nAIr/xgBWgAGAbH/HQAr/9D/hwD5/VwA0/5mAIP/lADE//j/Uv9sAKD/+P4FApf+iAA1AAEA1/97AUv/H/+5Ae3+PQDHAKz+kQGt/07+wADK/z//iAAhAEH/kAAqAJH+pQAC/wUBJP9RACEA2wC+/scBjf8rAeP/bAB8/7AAj/+s/9b/e//e/17/DQBJ/x0ASP9GAKr/BQAIAM7/EAAw/5IASf9uAKb/OADw/xgAeP8oAJH/8P+0/xAA+v8AAKj/RgDn/0IApP+sADwAOgDOAGj/BAEx/8AATACcABgAWAA7AMH/DgC2AND/hwAIAEkANv8R/0P/5/2w/u3+R/5i/kn/mf97/4UAogCQARkDEAMJAkcDpQJhAaIBcAHc/xMAeP+O/3v/XP8Y/9L/eP/M/k3/Uv9f/l7+2f5w/oz93P1S/YT8Wf2M/MH8W/3U/az+RgAwAeEC0wSUBjMGLwZABokEoAOYAcAArf+z/h7+/v1h/vn+WP+g/1UAggAQAMb/nv/j/h/++f3Q/VP9Q/1N/Qb9yf3E/Rz9bf2v/cX9if2c/igBCQJOAxUFNgYiBroFUwVsBBsDWQGTAJ//hv4C/hz+of5X/8X/VwDtAAQBjgApAL//s/7p/aP9h/0F/f384PwB/V/9F/2x/ID8pfzF/Ob8cv7vAH0CVwQkBhwHbge0Bu8FFwSNAkYBv/94/vj9u/2z/f/9vv69/+sAiwG7AeoBkgHGALH/yf4R/gr9xfy4/KL87fwb/an9BP7a/YX9OP3j/Lf82Pxn/msAHAIfBPIFKAcrB8cGDQaCBG8CxgBP/w3+Wf0p/XP9+f3f/isAYQG+Ad0B6AGFAX4AT/+b/tD93fzB/Nj8Cf01/Y79Lv4s/sr9fP00/df8wPxZ/Rn/AgHEAkgEBQYGBykHtQb4BcQE7wJkAQoAxP7c/bD9vf3x/Wj+D//L/xgAKAAgALD/Kv+C/vb9tf1+/aH9Ev6V/ir/lf/V/wcAyP9D/5X+Ff61/UH9BP1g/YD+dgBEAqgD9gR3Bu8GhgaxBboEMQNkAQsA3P7b/Wj9mP3L/Tb+iv4g/6D/mP99/w3/if5Q/uj9r/3h/UD+qP7o/mf/wP+x/4b/IP+D/gj+y/1f/Vz9+f1X/z0B6QJKBHwFjga+BigGKQUHBFYCxgCW/3j+wP3B/eP9Gf5w/sD+SP9j/z//+P5m/if+Av7D/eL9Ov7B/iX/Y//O/97/rv9Z/+v+Xv79/ZT9Yv2u/YL+EwC8AVYDpwTzBcEGwQb4BQsFsgP0AYgAP/8m/oH9Zf15/br9EP6m/tT+Bf8n/8D+Yv5w/jn+AP4s/o7+6f5d/5r/yf/Z/7f/Ov+n/kD+vP09/S/9o/2E/jMAPgKCA6gEcQb/BpYGJgZwBccDTQIPAZT/av7o/av9fP2h/Sf+U/6N/gD/yP5m/nj+Q/7d/fH9J/5K/qf+F/85/2v/j/9o//L+t/5y/vL9uf3x/W3+hf9dAcACegPiBAgGAQa0BXUFhQQQA/UBmgBL/3D+5/2I/T/9af3L/fv9Uv6F/o7+uP65/qv+wP7c/vD+EP8+/z7/Qf9A/xf/pP5z/l3+7f20/QX+d/5L//AAKgLhAj8EewWpBYsFhgXMBKQDhwI7Ae//+f46/qH9G/0Y/VL9bP2k/Rf+P/5q/r7+1P4C/zn/i/98/6X/xv+g/27/TP/y/nj+X/4b/rP9v/0o/l/+cP8XAdYB+AKRBF0FcgX7BegF7QQuBEUDCAKlALz/z/6w/S/9/fy5/Kz8BP1N/YX9EP54/sj+Fv+P/7n/0P8CAOn/uP+T/zj/zP6k/l3+/v0n/nP+g/57//oAhAFsAggErwTKBF8FfQWnBOoDMQP+AdQA6P/j/uP9OP3U/HX8XvyI/Nf8Iv2M/Rb+h/7T/kH/rf/N/+r/+v/b/6v/cv8T/8b+iv5H/ib+Wf5R/tn+TQAwAaUBLgNmBHIEEQWGBRgFVwTcA/cCsAHSAOL/v/70/Zj9Bv2p/Mv85vzt/E/9xf0t/oz+CP+I/8//+/8tACAADADk/3f/Mf/2/qX+TP5P/lL+b/5f/0EAsQCgAfsCTgPQA5IEuwRfBCYE5gPiAv4BTgEhABj/ev65/fP8tfye/GP8m/wE/Wf95f1x/g3/ef/U/zYAVgBRAE0ADADI/43/Nf/J/pj+kf6G/vP+ov8QANQAuAGAAgwDrwM0BFoEegQ6BLkDMQNYAmYBdgBy/3j+sf0C/Wj8LPwg/B78Zvzc/Gz96f2R/iv/qP8QAEMAggCGAGIALgAHAJ3/W/8w/+v+yf4O/4r/zv+QAFAB0AGfAk0DlwMIBHYETgTyA8kDBwP4AVMBUQAR/zj+gP3A/Ef8EPzu+yb8g/ze/KD9Q/7Q/nL/BQBIAHIApQCDACgAAADJ/zj/Av/r/qr+rf4P/3v/5v+xAGwB+AHGAnADqAP9A0QEEASpA00DjgKQAdMA8P/U/hX+cP3g/I78Xfx2/L38Df2M/Tb+xv5B/9H/VACVAK4AzgC8AGMAIgDx/3//bf82//3+Hf9T/6b/DQCsADABzAFuAuUCPgN0A48DcwMsA8cCDQJAAVwAgP+n/rn9DP3D/Gn8GPxH/L787fx+/Sr+mv44/8L/JgCCAL4AzwDoANEAfABiABsA0f+5/2j/WP+B/8D/2P9eAOEACQHSAU8CgALgAhgDCgP+AsICNwKjAeIACQBQ/4j+tf1f/RX9p/y5/Bj9Nv2g/Uz+nP4L/7L/zP8hAIEAWAB4AJgAQAAXAB4AyP+w/6P/a/9+/9X/4/8zANEA3ABtARoCLQJ4AtgC2QK9AqICTAK4AUIBgQDP/xj/g/7r/WX9Mv0U/fb8E/2B/cn9K/7h/i//kv8hADAAWACoAGoAYwB8ABcA4P/T/5L/dv+Q/13/b/8IAA4AVQAcAUYBqAFVAnACmAIFA/oCkwJ8Av8BQQHfABMAWP/x/iL+t/1+/Sj99Pxa/W79jf0l/oX+v/5a/6H/7P80ADYAaABtADMAHgAEAM//wP+u/3L/Uv/x/8v/5//TAO8AKAECAkACSgISA/kCjALcAlkCxwF5AcYAKgB+/+b+ff74/YT9jP2U/WT9p/0O/kT+nf4Z/17/rP/b/w0ANgALABEAEADg/8//t/9//y//qP+z/yD/TQB2ANz/awGwARkBaALBAhcCDQNMAy8CmgJoAkABBwGgALD/EP/h/gn+qP2p/WT9Uf2b/af91f1w/r3+Af+H/4P/yP8BAOL/q//n/5n/Rv9Z/wj///4n/8L+Xf+S/3//oQD+APQAEwKNAkYC+wK3A+sC6AIzA0ACfwFbAX8Agf9Y/5z+2f3n/ab9V/2z/df97f1y/rX+D/+U/4H/0/8wAB0ADAD7//H/vf+E/2v/NP8n/yf/K/94/6b/AgDyAFcBnQHNAkIDFQOiA3cEzQM1A0IDdgIyAX4A2P+e/uv9oP3u/Kn8svzo/BD9af3s/UL+r/4q/1D/ef+z/9D/r/91/27/aP8V//b+8v74/vX+Gv+F/8T/MQAkAcIBMAIoA9QDwwP0A2AEEwRMA7wCGgL2AOn/Rf9J/oz9SP37/Lz8/vyU/cb9Dv6Q/gr/Vv9l/3v/n/+g/3f/OP8X/wv/yv6X/pH+jf6U/rT+GP91//r/+ADgAWkCVwM6BIwEmQTSBHEEuAPpAvQB1gDo/wz/I/5e/Rj99fzq/Az9jv0j/n7+5/5D/7H/6f/n/+T/5v/Y/5b/QP8a//L+sP6g/nr+Yf5p/p3+CP9p/w8ATQFIAvcCAAToBCsFQQUbBWUEoAO5AmABCAAC/0X+fv3u/LX85fwx/aH9Bv6a/ib/XP9u/4//oP9l/zD/Fv/y/vD+sP6C/oz+hv6E/mH+QP5E/nD+vf7//nv/sQAIAvECAAQPBa8F3QWIBY0EcwNxAhABgf8+/nP9PP0M/QX9T/32/aP+Gf9k/8r/8//c/6L/cv9P/wj/4f7J/uP++v7l/t7+4/69/qH+Tv7o/bv96f1A/qD+kP8hAY4CBgRmBUkGtAafBr0FbATzAoIB4/9o/lT94vzw/A79ZP3n/Zb+Q/+Q/8f/3P+3/3L/MP/o/sj+zv7o/gD/K/8x/xT/Df/l/rP+Wv7k/YH9aP20/Sj+xP4PAKsBLQO/BNgFWAZ0Bi8GcQUHBFECwgA6/xj+V/3p/Nf8SP3//a7+a//P//L/AADP/0z/9P69/pj+rv7X/hn/df+z/5v/QP/f/oz+J/4B/sj9df1f/YL9//2h/pX/PAEWA80ESQbBBowG4gUIBfADGQI9AKn+gP0a/SX9W/3I/aD+gP9FAMYAogAsAKz/E/9l/kP+Of5t/u/+Z/+//+//1f9//wD/cf7y/Xf9R/03/VL9g/3d/Y/+Tv+2ANsC0AR6BkYHEAc+BhQFywNPAlcAsf59/eP8GP2r/UH+uv5Q//j/pQAaAaAAyP/Z/in+0f0H/mv+qP4U/3X/1//q/6H/Gv+F/v39of1S/UT9fP2m/TD+0/52/zgAZwFZA0AFywZgB8EGrQVZBAkDjwGn/xf+Dv3K/Ff9L/7X/iT/fv/f/3gAsAAVACv/U/7R/dj9Xv7Q/gz/Wv+p//P/4/9//8H+Af6K/WP9h/39/UX+Yv6z/iD/tf9yAPcB2QOCBY4GkQbQBbIEcQM7AukAPv/+/Xv9hP0w/uv+Uv+Z/9z/FABgAFkAmP/I/i7+uv3p/Yf+B/9w/8j/+P8DALz/Pf+G/uD9lf2p/eD9KP5g/l/+wf47/6X/MAByAYIDRQW4BggHQAb4BGoD9QGSADf/yf0s/Qv90v3Y/pP/DgAoACUALAAPAJD/wP4S/ov9kP05/gL/rv8HACgAEACx/03/if7o/Y79j/3Y/SL+SP5X/rv+B/9c/+L/aAF4A4cFDAcKB0EG3QRkAwACpQAY/839OP1E/Uf+f/8wAIsAbwBMAB8AzP8P/zL+gP0Y/Xj9cf4//+L/GwAWALz/WP/l/j3+2f2+/QH+Xv7L/uj+6P4X/zH/UP/L/xoBCgPjBAoG7AU6BQ0EuwK0AZgAiP+5/nn+qv5Q//D/HwAhAN//gf9A/9z+cv4y/iD+Lf6g/uj+Tv+b/3//QP/5/q/+U/4O/m39A/39/Dn9nP3f/gIBRAMmBXMGhgbpBdAETQP8AbIAef+h/mj+j/43/0cA6ACaAd0BuAFDAXYAsP+3/gv+mv1u/Z79vP0A/lH+mf73/gn/HP/y/t7+ff4u/uf9R/2Q/ID8qfwB/Zn+uQDNApIEBgY5BrgF4gRwAzoCAAHR//D+uP7A/kX/YgD4AJ8BGQIMApkBEQFiAHD/k/4c/sr9wf2e/cr9Ef5M/q/+Dv8v/y//N/8I/4L+NP6o/Qr9evx+/Hf8o/3G/9MBsQMIBeoF7wW4BYIETgM+AucAsv8V/9D+/P6o/0MACgG+AecB8AGXAfkALwBB/4L++/20/UT9OP17/bH9I/6o/vP+B/8y/wb/jf5L/u/9Iv2U/EP88fsD/Tj/KgFWA/cEFAaaBnwGSAXhA8ACEgG//wL/nv6i/jf/5/+dAGsBvQHjAcYBSgGXALj/0P4k/rj9TP0b/Wb9o/0S/pb+0/4E/zn/L/+h/of+Qv5k/QT90fxo/FL9Rv/MAFgCGASGBTsGXAZ8BWEEfQMRAlwAbP+//k/+h/4X/7j/cAApAZgBqAFyAfAAAQAI/0L+l/37/MP8Bv1M/er9k/7p/jD/g/91/97+vP5h/mz98vze/Ej83fza/mYA4QH6A28FMgaQBiYG3wT9A4ECpwBg/9/+Jv4n/sj+Yf8QAPgAlgGnAdkBnAG3AMX/If9I/oD9K/0Z/fD8QP3I/Qf+k/4f/zD/Mf8Y/9P+Bv6G/Tn9uvwU/VD+z/8wAQgDdQSVBTUGEgZEBXMEHAOOAVAASv92/i7+Yv6k/k7/+/+QAPIAeAGQATMBtwAYAFb/hf4M/qD9If0+/Uv9aP0V/m3+pf7w/vb+ff7//ef9Ef21/K79pv60/4ABzwLSA1EFGAbSBaoFOgWrA3YCSAGl/4T+Ev6Q/Yj9Pv7Q/mj/bAAtAWgBogGKAdAALgCC/7T+6P1q/S/9yPwg/Xv9kP0P/nT+d/4l/iz+3P0Y/Yj9Kf6Q/vz/WwHiAWoDyQTvBEQFsgXYBNcDSAPuAYkA7P8P/yn+Lf49/in+y/6F/8n/PgC0AHkATwAMAIf/9P5s/ib+nP0+/YP9cv2k/SP+cf57/n3+q/4s/tD9iv6t/jX/nQBIAf0BqQN2BI4ERwVsBZ4EHASHA0ACEgFxAHr/mf6E/mn+Rf6p/kL/cP/K/ywAIQAAANX/kP/j/nz+O/6N/Vv9Tf0l/V/9xP3+/Qj+V/6B/gL+X/4A/wj/2P/gAEQBRgKmA+IDYgREBQsFfwRVBJgDUQKRAc4Asv8b/9X+XP5M/pb+pP7V/jL/WP9o/3L/cv8e/9b+rv4v/vb92f2X/Zf9wf3U/dX9EP4x/uD9DP6T/nr+MP8DAG0AmAGbAhgDDwSzBMAEzwS/BBUETQOiAsAByAAaAHL/zv5+/lH+OP5a/nr+rf7s/gH/KP8e/xL/CP/C/pT+d/40/hz+GP4V/gj+G/4o/gL+8/1w/mv+x/6l/wMA0QDwAXcCLAMbBGAEeQSgBFkEuwM5A4kCpgHmAC4Ae////pX+Tv5W/k3+Xf6R/rH+0P7w/gj/4/7a/rT+gf5p/kz+KP4n/iz+Df4j/i7+AP5K/pb+qP5m/+D/dgBcARkClQKDAxIEWAReBJYEMQSYAyMDYgKHAdIAFwBt/9z+ev5E/hD+B/4Y/jj+Tv52/rP+pP67/r/+mv6Q/oL+X/5T/mn+N/5a/mj+HP5g/qP+df4w/4r/7v/VAFwB4wHcAn0D5AMvBGQEPATVA3MDywINAlQBmADf/0v/uP5f/if+6f3y/f39Ff4//oz+gf6g/rr+ov6w/qj+l/6T/pb+ff6I/nT+Sf6Y/rf+lv5Q/5n/7f+pAEoByQGIAi8DlgPVAygEHwTjA40DEwN7AtABLwF5ANH/M/+3/mT+B/7O/dj9vf3V/QT+Lf5H/nL+iP6c/qT+p/6O/pb+if5w/oT+W/5S/pD+hP7D/kr/gP8HAMMAQAHbAawCMgOAA+gDFQQGBM4DdgPlAk8CuQH/AD0As/8p/87+d/4k/gz+6/3g/f/9GP4w/lP+c/6G/qf+tf6m/rf+uf6p/rb+nP6c/q7+o/7C/v7+Sv+e/zkAwwBaARYCrAIjA6kD1QMhBPUD3QOEAxEDfwLxATsBmQAAAHb/Bf9v/ir+3P2l/ZP9nv2S/az9z/3t/Rj+M/5S/l/+g/6L/qT+qv6f/qH+of6c/sP++f5V/6//EQDCAD8BzQFkAtICUwOAA7oD6QO1A5ADJwOpAkcClgEFAYcA6P9y/wj/jP5f/vX98f3C/bb9xf27/ej99/0d/j/+VP58/ob+o/7A/sP+wP7X/tP+5v4b/yD/sv+a/2kAswA3AdwBPQLdAj4DgQPPA9oDuwOYAyEDrwIvAnQB6QBKALD/Qf+4/mn+Dv7M/cf9oP2s/bL9u/3g/fH9Kv4s/lz+Sf5z/nj+Z/6Q/k/+lf5s/rP+v/48/z3/+v9lAOcAngEqAt8CXAPUA0gEgwR7BGAEBgSVAxADJwKKAbcA+P9U/6D+JP6k/Uf9JP34/A79Ef1G/ZH94P3u/Ur+Vv6E/pj+dv6p/lj+u/4z/pD+iv7Z/u7+eP8JAIgAFQHZAWMCGgO4AxQEnwSgBL4EgwQgBMAD4AJDAoEBnAD0/yr/jf7p/bP9J/0d/e/8EP1X/WT9w/0m/lr+gP6v/q/+5f6U/qL+Sf5Y/jX+1P0d/hD+WP5V/kr/sP+JAEoBSwLPAhYETgTmBIcFIAV4BcYEMwS8A6cCyQHyAOH/Af+E/pv9Xf3b/MD8xPzm/Bf9mP2R/Uj+Vv6Y/ur+wP73/rH+y/6f/gv+Nf4E/qD98f0z/m/+ZP/v/woBwAHzAo0DhAQ2BUsFxAV0BQgFtgS4A9kC7gG0ANX//P4T/n/9GP2+/Ib8sPy6/Ar9VP3I/R7+k/6t/uj+BP/Q/gb/p/4o/lD+tf2c/cH9iv0G/lj++P6y/0wAeAFIAh4DNQSMBFAFxgVkBWwF4wTcA00DIAIKAT8A+v4z/rP98vy6/Nf8wfzp/G39sP0z/o7+8f5D/2X/RP84//f+o/52/hz+bP2q/Rj9GP1w/Y39g/5k/0MAbgHDAsAD2gTHBQ4GkAaGBv4FdAWLBEgDYgIMAdj/CP/g/UP97/xe/HP8qvy9/Ef9x/1S/uT+Nf+f/+H/+v+h/2P/8/5E/sb99fyw/Gr8V/yw/CX9P/5M/3cA+gEuA1UEiAUMBmgGqwZwBtUF9wTEA5MCdgH4/+j+9P34/Jj8PvwB/Fb8qvwI/br9Xf74/oj/8/9EAFEARwC1/0v/q/63/Rz9SPzd+6r7r/sZ/LP8//04/44ARwKMA88EHga6BhEH/QaxBiAGDwXxA5YCIAHb/9T+af0C/W385vtU/Ab8pfx//d/9+f66/xAA6QAUAecAFQEfAGf/nf6L/az89/tL+z/7H/se/F/8QP6c/+UAIAM3BGQFFwdfB5UHbge4BhMGzARUA/MBGQDL/uD9TPwj/Lj7KPsO/Af8lvwm/qj+lP/4AOIAhQHJAQoB9gBJAOr+Rf5Y/RX8qvs4+8j6Tfs0/Jj8rP40ADUBvwN3BBsFAQfcBpoG0QaVBYgEtgPGAWcA5v50/cn8pvul+8T7qPu1/Eb9C/5C//v/zQCxAb8B9gHsATwBpgDQ/37+lP26/Mn7B/v/+o76Cvtg/NT81P4EAeABeQSsBQQG7Af3B0wHUgf3BWEELAMyATH/vv1v/JT7IPsg+zH75fvZ/OH9Hv82AEoBAgKtAroCcwJmAlEBZgCH/+r92/ww/Pn6xPqg+oX6p/vN/KD9JgCsAfACaAW5BZcGCQg6B88GFwZLBP0CMAFo//T9V/xf+yL7svoX+9j7Zvyz/R3/BwA/ASgCkwIaAxoDVgIlAhsByv/O/lT9Dfx6+5b6QPpb+qD62fsV/ZP+ngCeAusD4QWfBhkH9AdmB3YGmwXtAzYCSwC7/iv9m/sF+8/6kvpC+zr8R/3F/lgAlAGwAkIDmAOYAwAD+gEsAaT/Xf5N/a378vqL+sX5BPpi+ub6wPxK/vf/TwJJBKsFRgcZCB4ITAiHBxIGmQTCAsgArf5v/RX8xPq2+uv6HPsQ/IL9r/4CAMgByQIuA9kDrwMbAxkC6ACa//j9xfzB+2L6/fm6+dn5L/ot+wH9dP42AGUCXQR1BcYGtgeQB3EH0wZmBbwDGAJLAFP+6/zO+8v6b/rP+mP7LfyD/eX+CwCeAb4CEAOGA2cD0AK9AYYAbP/e/br86fsW+5z6jvqu+vb6x/tH/Zn+JQANAvwDEgU8BkgHWQcXB48GXwWxAw8CZAC1/h39H/yI+xz7c/tH/BH9OP6o/94ABQLzAnADiwMwA6UChwE/AAn/1v2V/Jz7C/uY+o36vPoZ+6v79/yS/g8AagE8A/YE/AXJBncHUQenBrQFRQSLAvwAeP/7/bn8KPzI+6z7CfzN/Ij9ev6I/4MAIAGkAfgBGQL7AbQBSQGvABgAef9s/nX9qvze++n6jvou+k76Sfvb/Hr+IwBjAmoEAAY/B/EHNQi4B8sGRgVwA74BAgBL/un8Cvx8+zz7f/sk/Of8xP2i/of/SQAfAbQBHAJaAkICBgJYAU4AKv/w/XL8N/tY+mT5YvlP+tb7jv3V/0YCTQQwBpAHIQggCLsHwwYPBWgD0QEQAGf+LP1q/NH7nPva+578R/0K/tP+nP87ANMAVQGnAc4BuQGaAQQB+P/5/uH9afxI+2f6ffmL+Vz68/u4/bP/awKxBJAGyAeyCKcIKAj5BjMFaQOxAdn/V/7x/B/8gPtL+2L7FvzD/J/9ev5H/xsA3QBjAdEBHwIfAvQBXQFRAE7/M/6o/FD7YfrU+Yr5RPr1+7L9gP8oAmAEEgZRByQILAh4B0sGgQTgAiMBdf80/gf9e/z/+/D7NvzX/JL9ZP4q/9T/gwAoAZkB2wHUAa4BZwGwAIX/iP6B/TX8/fo4+gP6+Pm9+rT80P7FAP0CUAXVBuQHNwgWCDEHugXtAz8CaADX/mT9XvzQ+2D7cfvo+7n8ef1Q/jH/+P/BAFsB7wE4AjECCAKdAb8Awf/O/pb9OPwS+3v6FPon+lj7Uv0q/ysBbgORBe8GuAf1B9oH4wZlBZIDHwJmALv+X/2J/Nv7dvuZ+x38vfxt/UX+OP/i/5kAJAGbAa4BkAFpAdEA8P84/0/+KP3Q+0L7ufp6+hL7qvx3/mgAbgJxBBAGXwe8B8gHbgcsBm4E2QIKASj/nf1U/Hz7A/v9+nj7RPwZ/RT+Tv8yAPgArwEUAkoCHwLnAUsBcACX/7H+pf1u/JX7JfvS+iP7N/y4/U3/+QD4ArgEQQb3BoEHgwegBk0F4wMfAicAl/4X/f37Hfvo+hf7kPtF/Dn9cf5f/2IAHwGzARACDgLrAWQBsADt/xH/AP7y/BD8iftW+2P7WvyI/Tb/9gChAlAEsgW/BhQHHQemBoMFMwSlAgoBaf8g/gr9RPy2+6L76/tq/BX97v3q/rL/aQABAWQBfgFeATABqQAaAIn/AP9V/q39Ff3G/Jr8xfxR/Qz+EP8PADYBTQJtAzAExQQFBeAEcQTQAwgD+QH9AP7/F/8//qX9Uf0l/TL9bf3P/U/+1v5O/8X/IQBVAHYAbABQACMA+P+h/2D/Gf+y/lD+Cf7p/e79IP5s/tL+Xv/u/5sAUQHjAV8CuAL3AgYD7QLFAnACCQKQAQoBiAAPAKP/OP/x/tH+qf6d/p/+sP7E/tz+9v4P/yj/Qf9j/4v/lv+T/5P/g/9b/yn/BP/+/hD/Jv9g/4v/3/9PALgAIwF4AcIB8wEjAi4CHQL5AdABiAE6AesAoABCAPv/wf92/zz/EP/l/r3+lf6N/pD+oP7C/ub+Gv9J/2b/k/+2/8P/0P/H/6H/fv9r/0j/QP9M/2D/g/+n//j/UACnAAMBTgGGAdkBCgIbAh8CFgLnAbMBdQEgAcgAawAHAKD/RP/p/rb+ef5Z/j3+Ov5a/m/+kP6q/tP+/v4g/0T/Sv9W/2f/bP9v/4b/nP+q/8L/5f8qAHwAuwAGAVoBlQHGAe4BDQITAhUC+AHHAaABZAEFAcIAdgAYALn/Zv8v/+7+tv6P/nD+bv5u/nb+jv6j/tD+6P79/iT/M/9H/2b/df+H/6P/tv/D/9v/+/8fAE0AhAC/AOgAFAE3AVgBaAF0AXUBagFkAUgBIAH2AMEAjgBRABkA4P+y/3T/T/8q/wf/7P7l/t7+0f7e/vb+/f4O/x//K/8w/0j/U/9k/3f/gP+V/7T/zv/v/yMASACNALkA3wAHAS4BRwFFAWUBbAFVAUwBKwEAAcEAgABLAB4A5P+u/4j/Z/9P/zD/KP8n/yL/Fv8S/xX/AP/s/un+6v7W/uL+5/74/h3/V/+K/8P//f9BAKIA9QA9AX4BvgHkAfQB5gHNAcABpQF9AT0B6AC3AHcASQAPALb/af87/x//EP8A/9f+zv7R/sz+wv6w/qb+gP5//lr+QP4v/jv+o/4N/57/GABtAMIAMQGwAfwBHgIeAg0CEwL2AcgBlwFhASYB4ACeAGAAGQD//+X/kf9J/w//+v4A//D+xP6A/nP+Xf5H/iD+8P3A/cn9zP27/ez9T/4X/wsABAGoARwCiAL5AjsDIwO+AkECxgFzASIBygCDAFcAVAA4ACkAIQATADAAMAD4/8b/cP9B/xH/2v6A/h7+//23/Xf9Kv0I/fj8BP0V/aL9xP4uAKsBnwIyA6ADHARABOgDEQMLAkABuQBFAMz/f/+u/wsARACCAIoAcACNAJEADwCM//T+c/5W/kL+9/2m/Yv9av1S/Q39xPx4/EP8M/yf/Bz+TQC1AngEhgUcBn8GXQZ/BdcD6QFLAEr/tf4c/tL9QP51/60AlwEDAsgBZAENAfn/4f7S/ev8vvwE/Uj9Pv1z/ab9s/2H/fn8P/zg+/P7tvyw/pMBcQR2BpAHFQj6BykHRwWiAuD/wv20/G/8Vfye/ND9xf/hAUADrgNOA4cClQHl/yX+qvy5++f7nPxf/ab9D/5R/jf+lf2F/GH7sfrX+iD8U/8xA4QGlginCeIJfAkOCCoFkgE7/hT8iPuS+777ofxc/v0AigPqBPIECQTbAiMBEP8Q/Vj7nPoP+/P7p/wS/XD9df0B/f37ufrD+Zv5jfpM/ZEBrwWFCOsJOwrFCXkI6AWIAuP+Rvwu+zT7m/ua/CT+YgBJA0sFvwXuBHADogGP/6f9r/ub+sz66vs2/R3+rv7a/nz+mP0b/Hb6dvl4+bf6sf1WAucG9gkHC5EKSglbB48ERwHq/W77w/pn+2j8uP1T/zoBqQNDBXAFVQR4AqMA1/5Q/c/7B/tU+278wP2O/uj+2P5r/qv9EPxx+h35+/hb+t79FQO1B1AKwQrgCaoI2AbLA4MA4Px6+k36UPup/EX+9v9AAsEEBwbABQwE3QHM/+n9UPwr++X6sPvb/A3+hP6z/on+MP5N/eD7ivqq+dj5wftq/1gEFAjwCfYJBgmvB0QFIQIG/yD8+Pqg+8r8Nf6+/14BOgOhBNAEwgPUAfj/VP7q/AX8nPsC/EL9dP5Q/5b/cf8g/4n+df3D+zz6I/kt+Sr7EP8/BGAIeAqhCqcJLwiGBRACyv7R+7/6bft8/OD9cv80ASwDrQTTBF0DcwF0/xv++/xK/M77G/xJ/X3+Yv+k/2f/GP+Y/nH92Ptr+l35qPk2/IUAIwV+COMJzAn4CIQHogRAAUz+wvtS+zb8Bv0v/pL/JQHrAiYE3QNBAqIAK/8j/nz9+fyL/Oz8OP5E//b/qv8F/3P+6P3w/Fr7CPow+Wv52Pvl/1gE0Ad0CXAJpwiqB38FHAI3/5v8w/v//Pz9uf7Q//0AcgLIA68D5AEnAOv+Lf65/U79xvwJ/Z7+2P89ALT/xv44/u/9Mf2U+xf6Mvn9+OT6Bf9GA0kHcglzCagIvgfeBfwCUwCh/U78WP1g/vP+t/91AHsByAIKA6cB/P+C/rT9Wf0j/cv8+vxV/nb/BgB2//D+v/7A/gr+b/yg+pH5J/n++U39XgH0BXcJcQp2CRMIPwapAysB7f4Z/SX9Pv4k/xcA9QCOAewBEwL+AND/p/7c/ZH9iP2W/az9zP0g/or+p/6n/if+Ov1O/MP7Cfvq+of84v/eA9cG0QdYB9AG1wVFBFoB6/6b/YH9n/6A/9v/rgDEAVMCIALjAFL/cP4o/iv+Fv4v/n7+6P4n/+X+rf5f/i7+Gf6I/bX8Q/y9+4r7qvyp/7IDDAdNCK8HxwaYBfEDcQGe/jz9Lv1N/nn/yv9EAFoBYgJqAooBFAAO/6L+eP5B/u/9KP6g/tP+o/41/sv9lv2l/VT9qvxS/Of7rPuU/D//SAOoBjUIoAeEBk0FsAOwARj/mP2F/Y3+6/9VAIQARgEkAlgChgEmABb/sv6h/nD+GP4c/ob+tP6Y/ir+oP14/Yv9U/3I/Gn8+PuK+0b8E/8dA4cGAAhwB2oGQAWcA0gBu/5b/Zf9+P5pAP4ASAEVArEChQJIAaz/x/6M/qz+kP5u/qf+D//j/nL+EP7F/dD97f18/bv8XPzp+0r7y/u6/iID3wYpCPsGnAV0BNgCaADH/eL89v2//ysBQgExAfsBjgL7AVkA2v6O/gT/Wf8d/9P+I/94/+L+1/1W/Wf98v09/rr9Gf35/Bz8GPtW+wL+/gIeB0UIHQe6BcYEGANMAHT9vfx6/pEA7gHkAVkB3QEMAiABb/8q/pD+tP8PAIr/Cv8M/yz/oP7P/aT95f10/qz+BP5W/dj8tPvp+pj7Uf5bA34HdAgWBzsFswP1AW3/DP0m/Uf/ZQGTAgcCNAFSAS8BMQCz/u/9y/4bAH4ARgDN/57/VP9L/lr9Uf3r/Zz+5/5t/t39h/1P/Aj7LftN/YQBbwZ/COEH1gU5A+QA2/7H/Tf+JQDLAfUC7QLDAfQABgBS//D+1f54/0oAiAB8AAsAVf94/vz9xv04/hP/gv9B/9j+pf1l/JL7JfuY+i37Gv5PAhYH2QgBB+wDTQFJ/5v9tf19/xwCZgMYAwQC6wDr/wr/x/58/6sAnwGKAZUAuv83/6D+9P06/v7+zv9HAEj/HP5s/U/8U/tT+877hvvS+7T+MgMKCCMI2ATaAYgAZP/N/af+sgGmBEcEJgJTALv/GP+N/mr/8wANAsIBmwB2//X+aP78/ZH+CgBnAOf/iv+o/rT9B/1C/Kb8nf3M/Vz8ZPsN/rsCeweTB4EEVAJKAcr/2P14/rQBgQQuBJICsACw/4/+gv7d/1sBBwIMAS4AV//o/nr+9f2j/kYAlgCP/5L+1v0J/Tj9F/3k/cL+nf7C/Ir64vtKACYGcghNBqsDCwJJAOH9N/38/6YDMwSkAsMAhv+e/g/+TP+lARgD3AHl/9D+Q/4i/gX+0v6wAEYBuv81/nD9svwT/dn9K/7V/or+HP0I+3n7hv6BBMoI1weBBZoCuP8T/kn9nv8+A/8DewI1AbP/TP6i/UX+pABvAp8BgADK/07+f/3A/db+vACDAUEA5P4b/v/88Pz3/YD+ef5B/mb9//sY/FT+dgPGCA0IbgUcA7P/GP4E/kn/sAL3A5ICagG9/zv+Q/7h/p8ASQJiAVgAf/9c/gX+QP7+/hMA0QAFAHv/7P3A/Ef98P0C/gf+QP7Q/fL7tftQ/voDSQgGBxcFIgO1/+n9uf1m/9QC+gPuAtwB6f8j/tj9e/4PAXMCjwHBAHX/D/6H/cT9wf5yABwBIAFkAO79qfwI/Wf9wf0//hj/PP4o/CT7Af6dBJ8HnAU9BLEC+f8Q/nb94P9mA34DvwIJAv3/Rv6M/Xn+TAHNAUoBMAECAJ3+y/2P/cH+OgBHAJQArf/K/Yr9t/1//Zb9/f0x/lb9SfyZ/WgC/AbIBesD0QPvATb/3f3q/oQB+QEeAdoBeQG+/87+rP6m/4MANgBeAIQA6/8L/1P+EP6J/uP+y/+N/9r+k/7R/lP+kv2O/dH9Qv1w/ET+bQQ9B8wEMAR7BPsBEP/y/Yb/GQLBATMBhwKyAZr/rf6j/kT/LQD//z8AkAAlAFz/jP4V/kv+E//n/ygAov9u/jX+Bf61/Yf9gv2M/Qz9TP6hA34FdwOFA40DXgFZ/2r+uf/0AXMBBgE+AsgBGAAv/+b+Xv+j/zr/xP+JAEkALv9e/jX+SP69/mT/7P9c/8f+nv5n/or93/wo/Vb99P2yAU8FQwTwAzMEKgIWAPb+rP/OAJ4A6AC4AWwBYwCY/0f/Wf+K/63/HACMAF0As//M/pD+iv5T/tj+UP+g/23/Fv/H/iX+r/01/VH9df5AARcD5wLgA2QEfgL9AGcAMgD5//j/zgBaAQABnQCbAAgAXv9F/6f/nP/A/yYAt/8W/+D+WP4q/lT+jf7f/hv/GP/B/k3+yv2V/eX98//kAXYChgMdBBADFQJ6AVYALQATADQAwwDNAMkAFwFwANH/vP+C/1L/6P8dAPX/+P+J//3+t/5m/jL+Uf5o/pb+pP5n/iX+7f31/U///AD7AT8D0wMhA0ICmAG+AD0A2f/o/1YATQBaAOUAtQCAAGkAJADO/9P/4f/Y/1b/A//Q/nr+Uv5O/k7+TP5Z/nD+Z/5J/jf+cf6i/wYBiwF2AjoD0AImAs8BGgFDAOT/yP/O/93/CgB4AJMAiwCbAGkA8f/h//H/2v9//0v/PP8P//P+xf6K/o/+jf6C/of+mP6d/sz+2/+1AAIBwgFXAl0CYAI3AsMBQAHKAEkA4P+g/5j/uP/J//n/+/8YABMA/v86AB4Aq/+f/2P/IP8E/9P+wP7Z/tj+/P4T/zD/Of9N/7//BgAlAJAA7wALATIBSAFCASUB6QCsAIsATAAcACcA7//o/+b/1f/a//D/5f8HABwACAD//+3/yf+v/4b/Yv9Z/1H/Vf8+/0j/Wf9G/2X/tP+y/93/IwAmAGEAggBaAJQAigBlAIkAmQByAG8AcwBDADgAOgAjACwAOAAiACsAKQDd//r/5f+2/7b/pv+R/6r/oP+f/6v/rP+q/7j/0//W/+f/BgAdABcALAAhABsAMgAgABUAKQAmABQAJQAdAAAADgAYAA0AEgAXAA4AHwALAAQAEAAIAPv/+f/v/9b/2f/V/8f/x//F/8f/2P/W//j/9v/s//H/5v/p/+f/1//f/+f/3//x//L/8f/9//z/BQAIAA4AGQAVACEAKAATACQAIgAaABoAGwASABQAEQASAPb/+P8AAPf/+P/s/+j/5v/n/+D/3f/g/9z/2f/Y/9X/z//i//D/7//3//v/CAAQAAoABAAPAA4ABAATABgADAAWAA0ABwANABkACwAMABUABQAQABAACQAIAAUA+f/7/+b/5P/1/9z/1P/P/9f/1f/S/9X/1//g//H/BAD8/wwACQAJAA0ACAAKAA8AEQAQABMAEQANABsAGAAVABAACgAQAAgABQD///n/AgD5//X/8P/y/+j/7//r/+r/3P/u/+f/4//s/wAA/f/6//7//////wgAAAAFABYAEAAQABUABAALABQACwARAAwADAALAPz//v/4/+7/7//q/+P/7//q/+b/7P/t/+b/8//v/+3/+f/2//T/+f/4//T/9f/2/wAAAgAHAAgACAD+/wQADwAMAAQAGAD8////CAD3//j/9//z//D/+P/w/+7/8f/r/+7/7//u//v/8v/1//X/+f/4/wAA+f/4/wIAAQACAAUACwADABIAEAAEAAgABQAIAAUAAgD+//7/9//4/+r/6v/7/+7/7//z//b/9//6//b/8//w//j/AQD3//b/9//5//X/8P/0//X/+P/5//b//v8CAP7/BQAKAAgACAANAAQAAgAAAPv/AQAAAP7//f/4/wMA+//y//n/AAD2/+3//f/v/+b/4v/t/+v/5//r//j/8//v/wAA+v8BAAoAAwADABEAFAATABcACQAQAA4AEQAKAAAA+//7/wMA/P/6//j/+v/x//T/9v/y//z/+P/w//j/AQD4/+//+v/5/+//9f/5//7//v/4//X/AQD9//j/AgABAPv/AAD4//D/9f/1//f//v/4//r//v/8/wAA///5//X/+v/8/////f/7//v//P/+///////0//r//f/4//b/7//w/+f/9f/4//n/8f/9////8v8LAAYA+v/+/wkAAAD6/wAA+//4//n//v/2/wEACAAPAA4ACwAIAA4ADQABAAcADwAJAAUA/f////7/+f/6//7/8//f/+H/4P/h/+f/6//m/+j/8P/r//j/+f///wcABwAFAAYABQAAAP7/BAACAAQADAADAAQACAADAAAACAD8/wEA/v8AAP3/9f/7//L/6P/4//b/6v/t/+7/8v/2//H/8v/8//z/+P/+/wYAAgAAAAcABwAHAAoABQD8/wAADAAJAPr/AwALAPX/8P/5//n/9/////z//v///wMA+f/+/wQA8f/5//b/8P/v/+v/7f/z//P/9f/3//n/+//z//z/AAADAAQAAwAHAAAAAQAFAAMACAAQAAcAAgAFAAYAAgABAPr/+v8AAAAAAgD4//j/AAD4//n/AgD4/+3/9f/z//b/7v/j//X/9v/w/+r/7P/z//f/9v/z/wAACgAGAAgABAAMAAkA//8FAP3//////wQA8f/9//X/+/8CAPb/8//5//X/+//2//3///8BAPP/8//6//P/8P/w//f/+v/2//r/9//+/wIAAAD6////EgAJABUADQAMAA4AAAAJAAAAAAD6/+X/8//w/+//7v/Z/+7/9P/w/97/9P/q//H/7v8IAPn/9//1//n/+v8SAN3/MgDz//L/EQANAAQABAATAP3/CQDt////AgDy/wQA/f/7//f//P8DAP//AQAGAAQAfv8CAPj/UADi/x0AqgAN/xgApABvAEP/SwDN/0b/1P/c//n/j/+9/xIAWADe/ysAfwBDAAAARABXAPn/AADs/xAA4v/X/+//9P/T/8P/GgD8/+j/CAArAAgA/P8fABgACgD9/zUA8f88APj/7/8GAPz/4P8hAPL/DQDx/67/wv/0/93/0P8BAPX/8f/6/w0AAQAAAAoA3f9RAAIA9P/S/w8A8P/a//3/OQDl/+L/8P/9/9D/4v/Q//v/6//s/wkACAAAAAAAGwAKAP3/DwAXAAkAKQD4/wEANADI//3/BQDj/9j/9f/n/wsA6//5/+r/yP8tAMX/LAAIAAAACgDS/xAA/f/x//7/DgD7//n//P8OAAcA7f8iAAAABgAUAAMABwDz//T/IwD7//z/BgDy//r/6/8UAAEA5f/4/+z/7f/q/+//1v/k/+f/0P/k//D/2f/2/wMA8/8KABQAFQA3APj/EAAxABAAIwA9AE4AVQAxAFQAOAAQABMAHgDn//j/6P/Y/93/vf+t/5T/iv9t/0b/Tf8+/yb/N/8k/zX/Mv8//4X/rP/t/20A3gA1AZQB6wERAjwCFQLRAacBOwHCAG8A3v+c/0T/8/7r/q3+qf6I/l3+X/4Y/gf+8P2y/dL9x/37/Xn+9f60/7gApAGNAnEDHQSrBLEEdQQDBEwDXgJMAVsAUv94/hT+sv2j/dX9IP54/p7+uP6b/lH+NP7Q/XP9gv0c/Tb9ff0j/QH+g/5K//EA4wFuA6AEdQU5BjkG4gVgBTME/gKlAR4A6v7o/Rf9uPyY/Mb87fxS/bz9x/0N/uD98P37/az93/0Z/uv9ff5w/mz+R/+Z/8QA+AH5AmkEJgXdBRMGmgUTBekDmQIbAeD/mf68/Xj9Uv2T/RX+mv4D/xf/Cf/9/lP+F/7g/T79Zv1C/V792f3K/Ub+jv48/s/+Jf8IAFEBZwL2A/cExQUtBrkFOgUZBMcChwEwAB//Rv7a/cz93f0t/o7+vP7o/rj+ev5I/ur92P3R/br9+P37/S3+kP5Z/qr+p/6I/pr+Iv8LACYBXQLYA8YEfQXxBbAFPQU4BOkCvwFOAC//Tv63/Zb9h/3Y/Sb+WP6Z/oH+cP5b/i7+Of5G/kb+hv6I/qL+wP6S/pP+T/5U/kH+uv7K/7IA6AEfAxsE6wRpBWcFJAVJBEIDJgLTALT/zP4c/tX9x/35/Un+mP7e/uj+6P7y/pj+jP54/nP+yP6q/sz+7f7t/sX+mf5r/nr+VP4r/vz+BAC1ANgB8ALmA18E3ATpBIwEwQPKAsUBvACx//L+jv5D/jb+YP6N/tf+6/7z/gH/BP+1/pD+m/5q/pf+rf6f/uf++f77/vn+5v7//hv/x/4Q/9X/NQC3ALIBbQLcAosDwAO7A3EDuQIzAnABgwDb/1T/8P6y/mn+k/6R/pH+y/6i/pD+nf6R/lb+cP6B/sr+//41/27/ov/v/7j/tf+g/43/YP8V/1H/zP8YAJAAdgEeAtsCUgOTA7YDXAO4AiICawGPAA8Ahf8U/8f+nP5w/mv+O/5e/k/+M/5Q/nv+iP7H/gD/Yv+T/9n/AgAvAEcAMQD7/83/mf90/zb/Gf9f/8L/BwChAE0B8wF2AsQC9gIAA54CKALbASwBsgBAAMP/ff8d/7n+k/5g/jH+EP4Y/jT+XP6H/tj+Lf99/77/8/8bACUAEwATAOb/r/+G/3f/Sf8P/0z/lf+w/xgAjAAJAYABuQECAjUCHwLyAdcBqAE/AfsAlQA9APT/k/8t/+b+tv6A/lj+Sf5H/ln+cv6s/vX+G/9j/7T/2v8BACMADwAXAAsA5f/U/6r/iv+8/77/z/8mAGQAuwAOATABdgGpAbUBugGwAZsBdwE+AQABswBpAB0Ax/93/zD/7v6+/pv+fv5//oL+nP7Q/vT+GP9g/3n/oP++/9f/0P/V/8//wP+4/7D/r//B/9D/5v8UAD8AgADLAO8AJQFjAYQBjQGKAXgBaAExAQABwQB1ACoA5P+T/1b/Kv/s/tX+tv6v/rL+x/7s/vv+Iv9f/3j/hv+w/8r/0//d/+r/3P/a/9H/xP/L/+D/+v8vAEIAWwCeANoABwEPAS0BWAFJAVIBNAEUAe8AqABwAB8A/v+4/3f/Vf8u/w3/+P74/vf+8/4P/zr/LP84/2//eP94/43/iv9l/47/ef+F/5D/qf/V/wAAFQA8AIMAxwD5AAABRAFWAWgBdwFAAVYBKwESAcQAsACNAC8AAgDi/7T/iP9m/1j/N/8w/0L/HP8F/xX/Df8f/xv/A/8g/1v/KP9G/zn/Mf9V/0n/YP9+/5n/1v/u/xEAXQCLANMAGwEpAXIBbgGVAY4BVgFiASEBLAHRAL0AkwBLACgABAD4/5//nv+G/2r/L/83/wb/EP/8/g//8v70/hj/KP8J/zv/GP8s/y3/L/9Q/4L/j//f/9P/NgCFAKwAAwEeAVcBdQGCAZcBbwF4AUsBNgEYAbIArwBmACoA7f/h/8L/hv+O/3n/YP82/0f/H/8s/y//Ev8s/wX/Iv8K/wD/GP8J/xf/Iv8V/zX/cv+Q/+L/7f8yAKAAuAAVAUMBZgGVAaMBogGVAYgBQAEoAfgAnQB9AGoAIwDk/9L/n/9w/z7/Pv9Q/w//G/8i/wX/Hv8F/9j+Dv/h/un+wv7r/sT+0f4j//T+IP98/7D/CwBlAKUAJQFWAZcB6AHyAQwC8AHdAXoBfAFIAfMA0ACoAEsAAgDZ/5X/gv8W/0r/Q//+/hD/A/8K/yD/2P78/g7/1f7Q/sL+3f5//r7+p/6t/un+RP+Z/xsAawDhAHIBqAEIAh4CMAIcAuYBoQGLAXkB+gDsALwAZwATANj/q/+c/1D/Wv+A/yb/Sv8z/zX/S//x/iH/Lv/y/tH+u/5y/vz9Cv7k/dP93/1b/hX/vv+DAEQBIQK8AjMDbwNlAzYDuQISAsoBggG2AIcAfgD+/7f/zP+t/7T/k/+r/9//gP9I/yj/EP/P/on+lf60/mD+Of41/u79P/3//OH8lfye/LH94v7I/0gB/gI2BBYFqgWkBRgFIwTUAskBkwBE/7P+j/44/mD+GP+Y/+r/TgChAPgAjwAWALr/UP+C/gj+N/5F/uz9+P0q/sT9CP2g/FH8ZPsV+8v7Sf39/kYBrQNpBT0HLggXCGwHPgZABEMCtgDc/of9R/2G/bj9wv4LAN8AbwGuAekBQwFuAJT/yf7p/Rj9F/2C/Yn9m/0C/hH+kf07/Zv8oPvY+t/6s/ta/Zf/KwJDBFQGAAgrCLEHwwbiBMMCGAE//5j9u/zZ/Cr9yP0w/28AUwHZAV0CFgI+AXwAhv+a/q39OP1x/bX9CP54/jD/K/+W/jb+j/0w/Av7pfoJ+1b8Gv/LAVcEngZ0CBEJdghUB20F5AKZAMT+N/0M/AL84fye/ez+kwCXARECUAJEAjABCwAk/yr+df0+/VT9Gf63/kj/oP/I/77/1f6q/f78XPtV+o352Pnt+3L+5AEMBaMHFgmlCbgIdwdmBdQCigA7/sf8NPy/+978WP5X/xsBWAKaAo4CHwImAa//h/7A/Rn9Bv24/U3+Af+n/8L/MABEAEb/7f7I/SD8OPva+dD5h/ua/b8AWAPABa8HOwj0B0oHIQXVArQAF/6V/PH7jPvC/Dv+lf9mAZMCEgNnA4ECeAF5APr+Af5z/R/9cP1B/uP+pP8NAPv/ZQAVADn/5f55/SP8Mfvj+Ur66fsz/iMBggPTBXQHggjIB4gGkQRiAvX/yf1c/KD7fPus/Br+iP8AAZgCFQN3AwoD4wEDAYv/RP6v/Q39EP3i/Xn+QP8BABMAWQBIAEn/6P7A/Uj8Q/to+pP6JvxY/r8A9wJBBdkGxgdPBzQGhATQAtgAvf5w/fj8c/wb/an+u//FAGECBAMAA8ECeAE7AAv/f/3o/Jn8e/yJ/Zb+9v4oAHoAHAASADb/gf7g/YL8sPsF+8n6R/sb/sz/lwHSBJAGlAddCF4HsQUQBOcBjf/X/Rn9z/zB/FP+fP9HAOUBdwLDAoACigGYAG7/Af69/WD91vzD/YD+Z/6n/yMA1P/6/4v//v5w/nv9jfxs+2P7O/s6/RH/agBUA2cFmgZEBxYHAAZ1BLICpwB+/tb9uvyl/ID9J/4m/2oAXgFoAlYCJQLXAXoAa/8O/+X9W/34/eD9Pv4//3r/nf/S/4b/Cf9X/pn9Nvx7+0j7E/tK/dj+OABuAxUFWAZnB9EG2AWSBM4CrAAa/+z9y/z1/IX98P0o/0AA9gBiAsACjgJ3AmwBOwCp/2j+lv3e/ZT9x/2s/uD+OP+J/1D/C/+W/lz9Tvzq+wb7Lfzf/Yz+wAG1A7UEBQciB2UGVQblBGcCEQFI/xb90fy+/EH8af2I/u7+zQD5ASwCoQKFAiUBpgDD/zb+5/2f/Uf92/1u/pP+9v5E/8L+sf5g/lX9bvyb/DD8J/1n/xoAuwLQBGYFEAdABxMGmAVGBAwCiQAp/1b92/zw/OP8Zf2L/jP/QQCXAfcBGwISAhABPgCR/4z+yP2p/Yz9g/0J/iH+Kf6K/mP+zf3r/RL94PyF/br9ff/ZAB0CCATNBJgF8QVYBZMEvgNKAr0Alv9j/nn9S/1n/YH9N/4G/4z/sAAxAa0BvgF1AQsBbgCK/+L+Wv6k/a39c/1K/bL9qP1f/a/9//wE/ZH9uv04/1AAiwFPAxMEDAXkBWsFfwX2BHYDXALnADn/Sv4x/c78mPzp/Hv9av6O/14AeQHoARMCDgKQAZQA5v8A/wf+vf0y/dv8Fv3o/Hj82Pxo/Dn8Df1e/eD+BwByARcD6AMjBdQFwAXdBVcFGgQrA6UBGgAL/9L9Jf3e/M/8K/3//cT+rP+hABUBbgHcASwB7gCUAGf/E/+Y/sz9qv2a/fj8yPzq/CD8ePw3/Yz9Bv99AHgBGwMKBO4EkgWIBXAFygS+A6ECMAHz/9H+3P1o/Rn9Nf3A/VL+G/8MAKcA8gCJAYEBBAH/AD4AWP8g/4T+zf3j/Xr9z/ze/Gz8L/zk/Dr9NP6k/7QAIAJfAzoEKAV7BYcFagWOBJ4DVQLYAKn/V/6E/QD9qPwC/Vj97v3Y/pf/IgDVAHgBRQFuATcBPAD1/0P/Tf42/q39/vzB/Kf8BPyx/Pv8Z/0C/6D/KgGjAksDqwQ9BTwFmAXdBN4D/gKfATUAMf9C/lL9RP05/fD8xf1I/qn+nv9SALAAHAFfAe4AwwCMAHf/Nv/V/tj9Y/1p/Y38bfxA/Zz85/0A/0j/YgFTAsACMwWwBM4E8AUZBPkDogN0AfYAHQCa/jv++v30/FD9rf1Y/UD+xP7t/qn/EQDm/1AAFgCY/6T/Bf99/gj+0/1M/VD9cv1a/Tz+F/+V/14BEQKlAqAEDQRGBGwFrwMQBLgDrQGbAb4ANf8U/5/+dP3b/dL9av0U/kf+J/7Q/hL/8P5D/17/7f48/wX/d/5i/lL+zf0Q/iD+4P3e/nb/zv+OAawB3wLgA8MDVgRvBMMDkgMiAyACuAHUACEAbP/y/pn+Sf7t/Q7+7/3n/Vr+Ov5k/rX+Zf60/s7+uP7A/gr/6P78/jD/D/91/4//1/9VAGQAOQFZAeYBNQJgAoICiQKYAmcCKQIAAksB7wB9AAAAjf8B/+j+av4s/o7+5P05/lT+sf1Y/jH+HP6I/qv+rP4Q/zj/Xv+2/+T/SAAWALwAMAGoAA0C6gEpAaIC3AG+AVYCsAHjAUIBMwHaAEEAawCd/1T/SP+6/pH+y/5Y/nr+mv6D/l3+8f66/sj+Wf8x/1f/vv9n/+L/7P9HAPT/iwD4AD4AhwEeAcAA1AGiAIcBuQH7ADABcQESAXsAYAFuAAYAWgFe/ysAPwCn/tT/WP+C/iT/Q/+D/sD+cf8d/tP+eP84/ib/Y/+T/mT/p/95/3D/bgAsAOD/XgEfAKAAXAFsALIA/ACGAFIAtgBdAAMAjQAKAAQATQDQ//z/6ACJ/0gAmwCqAOH/uwBl/xwAHQBm/83/q/+W/tkAEv62AJ3+XADh/03/yP/c//T/sABx/uQBKP8dAKAAw/9CAAcBn/80Adn/dgA1AEcAaQDB/0X/xACO/4b/7/9e/8//tf+I/9X/VP/l/70A0/6fAMb/OP++//j/SP5ZAIX/1P+D/+QAqv6oACMAof+x/zcBZ/8IAKkA/v8AAD4Bgv99AKQA6v88AEoAkP+PAMX/HAD1//X/IQDY/zcAEABN/8MApP+BAAL/sQD0/6b/QgCmAA3/DQGE/yQAIwDi/wgA//8KAOP/AQDg/1IA6P/1/0AAPwBw/2EApf+6/zoAeQBo/3AABQCw/1wAGAFJ/sAB0P+A/6AABAAu/64A9v9F/wwACQHb/iAASAB//wsAPgDM/p8At/9t/ycAm/+X/xIA7/5vAIj/qP9e/z8AwP+l/9L/GAAKABUAlP+V/+MAMP8PAb3/zgBQ/7cAW/9QASD/WgBrAFUAvP8EAVAAu/+PANn/lwCt/wMATQDu/7D/CgAY/3sA0/7oADL/FgAbAHH/qAC0ANv9KwJc/pcA1/+R/zIA1v9w/0IA2P8qAfD+hgCeAJP/ugD4/x8AIAD8/yQA/v/W//MARf4PAl3+dP+tAK3/3f/T/xcAHQB1/6L/MAFL/sEBg/6dAEr/9QAd/yMA4/+MAIb/ygC6//7/qwBj/2oAxf8WAPj/agCK/4cAZ/+HAPb+pQCQ/ycA0//x/xAAeQCx/jsAXwAx/3QAkP+Q/2gAu//o/+v/GgAcAFL/RQC0AC//mQDG/0IA4P/i/1UA3f8yAMj/YADT/8IAWv9pAPb/7/8MAOP/9AAZ/0oB9v64AOj+XgHn/lcATv94ACX/YgCO/6YAiP/y/5D/MwHF/nYA8v/3/x0Ah/9XAMb/IQDO/yj/LgAEAeD+mwDF/18AAgCm/8oAl/86ALT/OAC4AD3/8gB3/+oAeP+Y//f/1P+2/68A3/2vAcD+ZgD9/9j/lQA1/yT/rAHO/iMBKP9fAIgA8P5jAFoAQP+qAJb/IQBDAKr/OgAHAPr/BgACAAsABAAhANT/OwD//9b/u//JAHT/kAA6/+8AEv/KAI3/zv8iACUAcP9HAfT+ywBi/4cA2P72AK/+yAAY/2UAYP9oAM3/2v9GAF8Aa/8wADkAZACE/zwA9/8lAO//7f8yAGH/nQCH/1gAKv9tAUn+PAFx//f/QwB5/10A4v/j/9z/QQD5AAb/LgEZ/30AYf8HANv/lgAq/2AAtv8NACcAbv+tAPP/oP8dAKX/wABD/wMBmP4/Ae7/g/9YAFj/kADL/wf/zgAeAMD/JQBU/5cAq/+i/48Atv8VAOr/CAD4AAb/PwGQ/uf/qACK/y8APgC//zkAuf9O/wsBGP+dAPb/v//HAAD/tgA/AJb/GgAPAJf/bgCI/xAARgCg/+r/KwDq/xAA/f+jAB3/owC1//P///8bALj/MwDo/5EAbf8pAAwAy/8KAMP/i/8KAVD+eAF4/vAAzv6dAMj/DgAJAHoAef8wAGX/LwEj/0ABGP9xAOf/2f+4/+4AMv+jAKD/6v+kADb/jACf/x4ABgCa/z4ABwDa/w4Azv8LAAwAMwC2/0MAzv/7/xEALwDY/0YArv+w/+EAuf5VAYb+/QB2/24AAv9QAeH+XgAG/w4BA/+yAAH/rAD3/3sA9/5XAQD/ywAn//EAx/9//6gAdP8iABoA9P8bAPH/zf+IAJj/DgACAO3/HgCQ/4j/tgBz/wgAQP+0AK3/9v84/88A4f9HAKj/ngA5ANP/BQABAHAAfv+Z/28Azf/+/4AAeP+lAMD/iABw/3gA1v/TACz/0QD6/y0AB/+zANf/YgAm/24AWABC/ywAZwBL/6sAEP/EAMP/9P/4/9r/NwCT/9j/HwDq/77/T/9rAOH/E//pAN7/Qf/a/xgAAACv/8//UACJALr/9v+MAO7/3v/v/zAADwDl/97/WQDA/5sAUv/jAJ//swA+/3oA7P8iAFn/QwB1/8AA+P4UAOz/TQBY/xIAiP9oAGj//P+1/w8A9P+i/yEAHQAIANr/GwAQADcA0v8YAKwAdv9jALv/u//9/5j/QADQ/1//QgBU/zQAr/8hAEAA6v80AIkACADHANv/nQASABIAOAC2/6b/+f/U/97/F/9EAKv/8/9A/2EAjwCj/0oAVwBmACkAaACIAFkAbP8TANj/3f/6/53/TAAPAGn/cQB5/1sAp/9uAF0A+P9oACAANQDt/43/bQCo//j/3P+//wUAsP+t/xAAwP9uAHb/iwD2/wcAPwDj/1IAiv+t/zkA6f9jAPT/4P9WAED/CACM/8T/9//Y/2YA+f/e/zsAvf8AAJr/BwD8/1v/cgCF/zAA9v+5/9f/Sf8XAHn/3/8lAFgAhQDHAJMAOgHDAKoAKwBDAC8ArP8UAM7/+f8DACUAgP+D/1P/L/8p//n+lf9d/y//qP+5/ln/EP8J/wP/4f4i/7T/bf+aAMQAXwGAAnACygM+A2gDewIcAnwBmgBnAFYA8v+5/3T/sP55/oH9j/2v/Nb8Lv0m/b394v0G/oj+s/71/p7/eP82ABcBjwDcAagBXgL+Ak8DJwSHAycEGQMAA0MCxAE3AX8A9/+V/77+Xv6v/f78y/xg/FD8R/w7/Hv82vyl/FL9hf1m/aD+O/6B/wMA1ACcAmEDUwVKBUkGIgaDBUEF6QN9A6wCsQFVAUUApf+h/o39NP04/Fj86Pvb+wv8Q/yX/MX8P/20/Yz9U/78/Z/94/20/VP+Sf9oAEYCjgNgBckFVAZLBo0FMQUFBIAD5wIPAlsBZgB4/2P+S/3Q/Av8Efw//JP82Px2/RX+Lv53/v7+2P7j/hL/Pf67/QH9VP3g/cv+FQHbAtQEqQUJBpwGowVvBccE8AOpA84CEgLoALD/nP4d/Vj8TPta+5n7oPtV/ML8qf0d/pj+wv4M/+D+nP6o/kL+ev3i/F398f0v/18BagPKBEsF3wXWBfsEqgTqAxADWwL6AQ4B//8u/4L+m/3q/JH84PzK/EH96v1V/v7+Xv+u/2j/hP81/5/+YP7z/QD9Hvxs/Ar9Kf4OABQCsgNIBDIFbQUTBbwEJwRwA6wCNgI1AWAAoP/L/gD+QP3c/Kr8vPwA/Zb9IP7n/nj/xP/4/+n/tv91/83+Y/7U/dP8J/xj/CH9mP6lAJAC9gO4BFAFgwUwBdYEIgR4A6AC8QHoAAgANv9h/r39Bf3A/Lr82/w//dX9eP5J/9n/KABMABgA4f9w/6X+vv02/Xr7d/ud+//85f5YARgDWARhBdAFMQb1BcwF8QQZBDADGALZANL/wP5T/aD8bfwu/Ev80vxs/er9rv6V//v/TAB6ADoA5P+B/9L+3f2J/V78DPw//AL9Jf5UAL0BEgNOBP8EggWBBUcFuQTuAyADMgI6ASkAWP84/kD9EP3c/NP8Lv2h/Ub+qP6B/9z/QABtAHAALgCl/0H/VP66/Qz9M/wd/Jj8QP2I/j8AWAHIAt4DqQQ0BU8FFwWkBOwDGAMqAhQBIwA1/x/+h/08/e/89/wb/ZL9Cv6J/jn/t/8hAF0AjgB1AA0Al//s/ib+lP3m/Fz8bfzl/M/9SP+jABwCSgM/BOcETQVGBe0EWATBA/8CHwIgAUkAPf9w/hb+tv1x/TH9OP1i/Zb98v1d/sP+IP96/47/0/+i/1P/3/5c/vX9Wv3+/Aj9h/1Y/n//qQAHAiYDAgTLBE0FcAVFBdYEXgTDA7QCrwGnAGv/fP7i/VL97vxo/E/8c/yc/PP8kP0h/rT+Pf+z/9P/0P+d/yj/hP7m/Zr9lf3z/bT+q//SANsBBwMCBNkEVAWWBXAFHwWABG0DQQIhAe7/zP75/XL97Px4/E38Lvwn/FX8oPwo/cL9Z/7v/mL/sP+0/3n/Af95/hv+5P0M/pH+Yf97AKABugLQA98EhQXdBQIG/AV8BYsEaAMpAssAhv9w/pD94fxO/BT8APwE/DH8ifwL/Z79Nf7J/jD/i/+f/3r/Kv+o/kz+EP4j/oz+Of8pADEBQAJIA0AE4AQ3BVoFXQUHBT0EQwM+AhwB7P/p/hb+ZP23/Gj8MfwX/Db8dvzY/Fv97P14/uj+T/96/23/Kv+8/mn+KP4r/nr+D//4//sABwIjAykE5wR4Bb8F2gWWBdgE3wPIAowBPAAP/xD+M/1//Cf87vvW+wz8XPzO/GT99/2K/vr+Xv+X/2z/IP+v/lb+Fv79/Un+5P68/8EA0wHqAvkDuwROBawF0AWZBQgFNAQ3AwICuAB+/3f+kP2//Ej8B/zt+/P7Mvyf/BP9sP0r/qP+FP9K/yj/5v6O/l/+MP5U/qn+QP8LAPUA/wH0AsYDigQKBUgFcgUYBYgEwAPUAqMBVAA+/13+Yf2v/E78Avz1+xH8WPy2/D79zv03/rD+EP8W//P+p/5I/hb+A/5J/p3+b/9sAEcBbwKNA3QEHQWjBcIFzQU7BZAEngOMAmIBEwD6/hv+Tv2v/G38Q/xP/Hb8zPw1/bD9O/6h/gL/P/80///+sf5F/gr+7f0a/nT+NP86ABsBPAJAAzAE8ASCBZAFhAUgBXgErAOrApABTgBT/1j+kf3t/KD8YfxQ/Hf8sfwM/YD9/f1I/rT+/v79/uf+wP6L/mD+cP7I/i7/4/+5AGABiAJQA/cDnQQHBfMEzgSDBM8DCAMWAg4B5/+i/uf9Kv3j/HD89fsf/FX8qPyx/Av9c/0m/lP+e/6M/q3+o/6e/rL+9f5w/+v/lgA/AfgBuAIcA6gD/QMPBDAEAASEAw0DiQLhAfEABgBL/3n+lf04/RH9A/0F/SH9uP0o/o7+yP4O/1j/uf+0/3z/of+7/3H/ZP9V/4L/4P9JAKsAPwHEAVUCwwLzAjUDSQMKA8ICZwLiAS8BWgC0//L+TP7S/Yf9W/1T/Wn9mf33/Uz+tv76/kb/oP+6/7T/5//w/9z/yP/V/8j/7//u//j/QACQAOEAMAFvAb0B5wEAAhQC9QHfAbABbwESAaQAPADM/1f/7P6g/nL+SP43/jr+QP5Z/oP+sf7f/vj+M/9j/3//rv/N/+f/CQALABAAHwAyAEMAXQBKAGkAmAC1AN8A5wAHAScBEgEyAS8BHgEDAdwAvQCKAFIAJQDZ/5//Y/8v/x7/GP8I//n+/f4Z/zj/VP9n/4P/r//C/9j/6/8DAAAA6P/Y/+D/yv/g/9P/v//l/+//LwBcAGgAjQCdAL4A6wDuAOAA0AC3AJMAaQBWABkA3v+c/3b/cf9e/1X/Z/9j/23/mP+y/7v/0P/j/+v/7//7//b/6P/h/9n/z//f//P/AwAIAB0AMwA+AG0AdgBkAHAAawBjAFQARgA1AAEA8P/d/9L/s/+k/53/qP/B/+D/8f/1/wAAEgARAAoA+//X/9b/uf+l/53/lv+a/7P/0P/l/wMAKABZAHkAfwB8AIAAdwB2AEUAJwD4/8X/tP+k/4//dP9N/03/bP9//6X/zv/f//v/HAA1ADgALgAnACEAGgAGAAkAAAD4//z/AAD+/wQAGQAyAD8AYABYAHYAhgCVAIEAXwBHABIA9P/W/6v/iv9t/13/ZP9h/2v/hf+d/7j/1P/w/wgAGwAwAEkAUwBPAGIAZABfAFIATQBNAEgAOgAzADMAJgAYAB0AEwAPAAoA///2/+f/2f/U/8P/wf+w/6j/qP+v/6//qP+w/6f/vf/I/8X/zv/W/+j/4v/5/wQABQAQABcAJAAoACgANwA0ADoAMwA4ADsANgAwABYABwACAPD/4v/Z/9T/wf+3/7P/tP+t/7n/wv/B/8r/0P/Y/+D/6f/1//z/DwAWAAwAGAAfABwAJwApACwAMAArADAAOQA4ACkAMQAzACgAKgASAAIACAD8//T/5P/r/+T/z//Q/9X/0P/R/9X/0v/f/97/4P/l/+3/+f/7/wcACwAIABAA/P8LAPf/+v8RAAMACQANAA4AIgD6/xoAEgAHAAkACQAAAOH/BwD+//r/+P/c//H/7f/w/xAA6/8DAN7/8v/2/+//BADy////AQD6//r/CADz/+H/AQDn/wIACgDw/xgAAQAfABwA4v8ZAPj/CAADAPT/AADl/x0A+P/4//v/0/+IANv/uAAHAQD/CAEi/sb/sP/a/lUAQP/5/18Aqf+oABwAOgCnAOX/bwCsAIEA8gDU/w0AJf+H/5r/T/+j/2H/2P8AAAcAWgANAFgAWgAkAKj/CwDT/+D/ZP9DAMP/k/8l/wAB9QARAUsAEABtABEA1P+a/3L/ov+A/4H/qf+5/0cBpwCIAF4Abf+0AMD/wP/O/wT/1P91/x4A6P/A/yIA8f8rAB8A6P8YAOr/8P+A/gn/b//9/QkCNQCdARgEMP8HAxD/JgCLAKj9uv+g/tn+c/4jAMf9xAAu/0MAFQGb/30AIAG2ADUBDgA4/yAAZP+G/4v/Fv8wAN//DwBaAAgAHf9oAGP/BQDV/4z/fwBz/1oAKQCIABoAfgCWAKsAkQB1ALgAvf87AH3/TgDI/7z/YADf/1EARwDV/0EA6P+e/97/nv+//18Anv80AOb/nABSAP7//P9TAO//3f8y/5z/uf+X/5P/mv+b/xcAyf/k/57/AQD3/+//hf/5//r/CwCd/+L/BQAnABoASgCLAGcAAACn//v/4v/b/7D/1v8eAB0AFAAGAE4AfwDk/w4AAgAHANT/uP83AE0A1f/8/xIAMwAnABcATQCMANf/hf/w/7v/3P+T/6j/HwAeAAUA8/8vAAwA5f8iAEoABwCG/4v/MwABAFr/jv+/AAUA6//5/48AfQCR/+f/vwBEAI7/hv9vAEEAzP+1/wIATQD4/7D/7/8iAPb/0v8PAJsA9v+U/+f/NgDG/27/xP8GAPv/2f8aACwAEADp/ywAewAIAKz/FwBkAPX/Zf95/xMAHADE/9b/PgCLAAYAv/8TAB0A2P+q/5L/FAAUANH//P8oAC4AOgDw//f/9f/F//j/EgD5//j/yP/z//T/2/8FAAMACQAQAPv/2v8AAFYAGgDR/wQALAD//3f/TP/7/x4AQgAtABgAtQCIAM3/oP97/wEA/P+S/2AAkwAtABYAif/S/+D/pf/1/w0AMABXAO//v/8MAPn/OgDp/83/1P/e/2gAhACd/9L//f/2/+b/qP9jAG8A5f9HAAcA3v+V/3H/EQAJAOD/cAAyAEAAIwCZ/9r/yP+Z/+v/IQAoAEIA2P/o//T/rP9y/67/9f87AKAAZQAGAPn/gv+b/7z/s//N/3gA0QCrACgA3f/b/57/Tf99/8z/QACSAEwAKwDL/33/wP8TAAMA/f82AGoAcgATAMj/6v/m/8L/r//F/x4AUACZAO7/kv+V/6z/DQD4//j/gACXAFUA9v++//X/OwD5/3P/5/+xAEwAAABo/+r/lwAuAJD/c/+9/0AA/v+y//j/HQD8//P+4/6O/+H/R/9t/zkATAAKAAH/tP7L/w8AHQCGAO0AVgHzAEQAeADhAJAAZwC4AAMBoACHAKMAbwFkAVAAIADa//T+KP8w/2D/iP/m/u3+G/+6/rD+CP9S/wf/pf60/uD+L/+J/gT+C//p/08AxwBCAWwBCAGmABgBzAG8AbcBwQJxA8ECVgLhAYAC2gEaAOT/m/9I/y3/OP6C/qn+W/44/h7+4P2a/Rn9Df1L/ar9n/2W/Vj+H/9C/1//7v9gAAQAzf9IADcBywEOAkIDbQQABJ4DKgN2A5cDRwJ7AYkBFAGwAHL/8P5I/8f+z/7A/sX+Ff9a/sj9mv1N/cX9lP2O/WX+WP5a/k3+Mf4L/+X+3f6P/2cATAGRARYC2AMyBCQEggOkAsgC0wGiAJIAgAD4AL0ASABTAAwASf8N/wz/NP82/4P+M/4k/or9F/3r/Jv8e/0F/vr9Zf4Q/h3+Fv5g/b79O/48/7AA6QH4A5oFrAWwBYIELwNXAt0AdQCRAMcAgAGIAYoBrgHbABEAGf+n/vj+wP6q/rX+oP48/or9D/2U/CP9qP2u/fv9qf1A/dT8Afwz/MD88P0EANICawU8B4UHLQeoBaAD8gEgAMH///9oAGABUAGmAZwB5gDgAAkAJ/9w/2D/lv+b/wn/9v7g/Rv9sPz4+w/9UP27/Wn+of3C/Kf7mfoI+9P7l/0AAQYF2AhGClUJEgj2BNUBKv/V/Cv9Y/5X/2wB7wH9Ad0BQwDb/3L/oP5A/57/1f8zAG3/C/+9/uT95f2S/aD9Uf49/sv+xf5Z/VP8Sfu6+n/7u/x1/ykDvAZiCSYJlwcTBbwBIwDF/i7+u/71/xIBrAGoATUBzADH//j+kf5w/hP/+P9/AJoAMABY/8z+Hv6s/b/9qv0+/jb+Fv5Q/lL9APwe+4f6EfvZ/LH+4wESBToIbQkXCJMG6wM6AT3/lP3G/tYA3wFLAvMBCwLUARwAm/5Z/tT+ev+o/6X/OQDzANMAqP+L/hL+f/6z/kb+2v2G/av9Z/1q/PD8jP1d/ZD8qPvK+1L+UgF4BJMGRwdeB7wFQwPjALz+hv5W/8//jgBPAWACAAP5AZwA2P8z/8L+V/6I/ib/JwCkAFkA3v9B/zv/K/+w/jX+RP5j/uL9J/3z/B/9xfzv/H/8cPzu/HP9rf+WAjEFMQd+B9sGzgWsA+AA8/5T/ib/9/9YADUBVgL8AmQC7wDA/wf/Yf7z/dn9Of5w/zQAjgCpAAwAzP93/6L+7/3A/fX9t/0Q/eP8Pv0J/QH93fy+/AH9H/3Z/vEB1gQhB38HuAY2BroE8AF6/wD+kP6v//n/bwB/AagCwgJrAaj/uP5z/o/+cP5o/kf/WQD6AAUBNgCv/3P/6v4W/nT9dP2x/S39aPyw/Bf9AP0I/cz8//wJ/TX9Yv+3AuIFzAeAB9IGZQaMBK8BFv8a/ir/OgB8AA4BRAJRA/ICCwEY/6/+4P6G/uL97v0f/1UArQBSAK7/ff9j/8H+3P1X/Zn94/1B/Wv8v/zg/Kj8b/yM/FD9tf3q/ef/vgLNBe4HYQdhBsEFNgTtAYL/Vf5Q/4UA4QDUAE0BNAJfAhoBFP/r/S3+Uf4S/uf9qv4EANEAzwAjAKD/iv9I/5b+s/10/a/94/07/cX81fzA/NH88PxD/cj98P0g/5EBKgT7BtQHDgdZBiMFMgPqAB3/xf6c/5wA4AAMAc4BSgLKASoAr/5C/mn+Vf4R/lb+cP+1AO8AIQAr/6z+gf4u/qj9E/1E/df9wP0f/fP8ivyI/Oj8Q/3o/TD+tv7FANwCcwVwB2IH3AYFBmEEXgJQAB3/I//p/6gA1ABDAewB9gEOAYT/qP6z/tD+Xv4X/o3+wP+VADMATf+d/n7+YP7G/TL9Gv28/Tn+zf0M/R/9Tf2N/Xz9cv0T/mT+LP/gAOkCeQWbB7MHCAcvBrwEzAJ8ABf/5v6m/xUA9v9HACoBkwHuAIv/1P7p/gT/dv72/Sf+N/8iAOv/OP+z/q7+c/4B/mv9Lf1h/b79af26/Mv8IP1w/a/9yv1f/qz+MP+3AOACRQVPB7kHPgepBoIFswN8Abz/HP9X/5z/nP/Y/7UAogF6AYIAn/8t/xD/ff6w/Zj9QP4I/2b/Gv+q/nr+RP75/Yz9M/0i/Vz9h/0b/eX8RP2U/fr9UP6u/u/+9v63/2sBuAMXBm8HogdTB6gGRQUxA/8Amf89/z//MP9A/wEACAGoAWYBqwDl/3L/HP9B/pv9rP1M/uP+CP+8/nH+TP4Y/t79sf2f/bn9v/1m/Rj9GP03/Xb9Bv6e/jX/Sf88/w0AvAHyAwIG8QYSB9AGEwavBM8C6AC0/zL/+P7U/hL/3v+sABYB4wBhANb/ef/T/gT+qP22/SP+mP64/rv+y/7Z/sD+kP5T/iP+Af7j/ar9cf18/az9Ev6T/vP+J/8+/6v/2QCGAowENgYMB18HCAf2BWIEaAKYAFj/XP7s/fv9m/5//zQAgQB6AFEA9/9L/1H+nP1Q/VH9of3T/fr9Xf6A/q3+yP67/p/+d/5L/jD++P2y/br97f34/U/+0v4l/4//9f/QACkC0gObBY8GsQaGBsMFhAQJA1wBCAAw/7n+r/7V/kT/6f9QAG0AQgD+/57/8/5L/vj9y/27/d/9FP5d/pD+nv7e/vX+Qf8d/9j+mv5m/kD+IP4K/gD+Ff6U/gD/WP+l/zAAaAHjAocE1gU+BlYG5QXQBGwDuwFJAGD/uf5z/o3+6v6M/xsAVgBWACIAz/9N/6b+L/7w/e79A/4y/lz+hP6o/u7+9v4T/+r+fP5a/kH+N/4I/u794f30/XD+1P4f/4T/AgAMAW0C/wNnBRgGQAY6Bn0FRgSzAu8Aqf/b/lj+Jf47/rj+aP/7/1gAaAA3AOT/Uv/F/k/+C/7X/fj9Iv5E/nv+xP4M/yn/WP8O/9r+y/6Y/kn+Av7b/aD93P1W/qr+FP9u/1wAuAFvAzEFBgYnBjMGvwW+BGEDYAHF/9r+SP4f/jP+dv4k/+b/YgCbAHUAFwCX//7+ff4h/tv97f09/o3+uv79/k//cP+Z/1b/6f60/mr+D/7Q/a79uP3d/T/+tf45/2L/zP/BABICzwM3BasF8wXuBUQFeAQSAxQBr/+//iD+Av4Q/kn+vP5N/+n/QwBLABQAs/85/wT/z/5Y/jT+Pf5N/oz+5v4l/2v/rf+U/1H/EP+Z/jP+9f3a/dX9/f1w/ur+V/+M/xcAFwFfAvcDCgVdBakFhQXoBCEEsQL9AMP/2P5R/iX+Mf51/uX+ef8IAEMAQQAtAMX/V/8h/7D+K/78/fD99/02/o7+6/5g/73/uP+H/0D/yv5x/iD+5f3D/dT9L/6Y/t/+JP/a//gAcwIQBAAFgQXMBZUFAgUaBJwCAQHS/9/+Tv4T/hP+Zf7e/nX/AAA+AEoALwDb/43/Pf/H/mz+Q/4s/kf+kv7M/hP/Zf+f/5D/Wv8A/4j+QP7a/Y/9YP1+/ej9bf7b/l3/GgAVAWoCAwQ/BbcFBgbWBU8FjAQfA4MBGAAI/0T+6/3Y/fH9V/7W/m//xP/g/+T/wf9r/yX/y/54/lr+Uv5h/q/+9v4h/2//jP+H/1z/9v6L/jD+yv2A/VP9Wv3i/Xn+/f6N/0MAOAFhAtgDAQV5BaYFggUQBWcEJQO4AXQAZv+2/mT+QP5O/qn+Ev+Z/wQAHgAwACIA3/+J/x3/zv6I/kj+K/5B/n/+l/7B/gX/G/8O/wj/vf50/in+6P3K/av9/f1w/sv+Wf/e/40AiAHXAikEyQQcBUwFHAXHBN8DewIfAfz/RP/G/m/+Q/5v/uz+dP/+/yIAUwBZACgA6/+E/xH/pv5i/ib+Kv5P/mH+l/7X/vj+Av8U/+b+tP5//jn+7v2w/dj9E/5J/rX+NP/2/wEBYALBA4sEIgWQBXEFJAVCBPgCqAFqAGz/qf4j/tT98P1S/tr+Zv+6/x8AXQBUAEAA4v94/w//q/5J/iH+J/5A/nX+2v4O/zL/Yf9S/zj///6r/kv+/v3//Q3+Pf6K/vL+kP+CAMkBAgMLBOAEbQWABUMFjwRkAx0C1wDL/93+S/4G/gf+T/6v/hD/YP/Q/w8AJQAlANn/dv8g/8n+jv55/nr+jv7L/vz+Lv9B/2D/U/8q/+H+jP4//g3+3P3f/Rj+bv7g/mr/AADOAOoBaAOKBDoFlgWwBWoF3AS0A0wC8AC8/8D+//2S/WP9l/0I/on+7f5X/8D/+f8YAAkAoP9D/xL/uf6L/oT+jf6t/uL+F/9O/3j/iP9//1v/If/u/sT+ff58/qf+0v4d/3H/5v+GAHwBkwJ3AwAETARwBEcE2gMYAxYCGAEkAGb/yP5r/if+Ev5H/pr+3/4i/4j/wv/s//j/wv+O/1j/Bf/L/qv+mP6j/rf+1/4K/y3/RP85/y3/Iv/+/tr+wP7E/tP+/P5C/4T/6f+EAHABagJFA98DPwSCBF0E7AMmA0MCOgFOAIz/7f5d/gv+AP4o/l3+nf4F/3L/wf8IABwADgAAAOH/lP9T/xn/6P7Q/qz+m/6o/tD+4P7k/ur+//7//vr+4P7m/vv+Gf86/1v/sP9TAAEBtQFAAsMCewPFA70DowNZA78CFgJ6AbMA+P9Q/9L+gv5M/hv+Mv5w/rj+/f40/3f/sv/r/9X/r/+r/3v/R/8U/+r+yP69/rv+xv7P/uX+E/86/1r/kP/J//7/SwB4AKoA0ADjAA0BJAEgARYBGgEXAQ0BGAEeARsBDQElAS0BCwEPAfIAwQCOAFwAJQDi/53/Xf8t/xP//P7w/u/++v4K/xz/Jf8k/zb/SP9Q/1j/V/9m/4j/m/+o/7j/yf/Y/+f/8P/y/wcAEAAaACEAGwAiAEIAQgBQAF0AVgBoAIEAjwCiAKgAtADIAMMArACrAJcAegBkADgAGQD3/9//v/+i/5n/hv95/3T/ZP9c/1X/Vv9a/1r/dP9x/3n/hf+W/7X/u//J/+H/3v/l/+v/7//y//H/6//4//H//P8UACQAPwBIAGIAdwCKAKIAsgCrAKgApACXAIAAbgBLADYAGgARAO7/4P/Q/7v/sv+u/6X/oP+S/5H/hv+I/4T/hP+p/6f/p//D/83/2//z////BQAEAAYAEgAJAPb/7v/n/+3/4f/h//j/DQAWADEASABeAGcAbACBAJEAkwCHAIkAgABwAF0ATwA8ACcADQD4/+r/4//Q/7v/uP+w/6b/pf+j/6j/rv+r/7v/w//T/97/7v/x//L//f////7//v8CAPP/8f/3//b/7P/o//D/8f/7//H/+P8CAAgADQAPABQAGQAZAB4AJgAlACQAIQAmABgAFgAAAP3/4v/2/9D/zP/N/9r/4f/R/9b/3//y/+j/7f/0//D/9f/v//L/+v/5//3///8BAP//AgD9//X/9v8JAAQACgAHAAMACQAVAAcA/P8IAAcA//8JAAYABAAHAAYABwALAA4AFQAEAOv/8P/o/+f/2v/Y/+z/6P/t//P/+f/8////+f/1/+z/+f8AAAAAAQD7//v/9P8HAO7/9P/5//f/9f/5/+j/AgD//wkABQALAAoAIAACABEABgAYAA4ACQADAP//GgAEAAwACAAEAP//AgD+//f/6f/l/9j/+P/i////7v/m//L/AQDs/+//8P/0//7/+gDSANv/3P9w/93/G//C/yj/b/+e/97/gv/Q/xcALAAoAEEAXwDQAFkAYQAxAMAAPgAwAAkA9P8GAOj/CgDo/9T/4P/k//H/1/8cAFYA//8KACsANADp/+X/OAC2/5H/wP+P/33/Zf+C/3r/X//g/zgAKQArAFoAhwBQAEkAYQAFAO//+f/s/8j/v//E/8X/z//v/wAAKwAiADEAKQAhAFIARQAnABoACAD7/+v/CwAaAPH/9v/+//b/DgDz/wgA6P+7/+L/sP/T/9j/2P/r/7X/AADR/+7/CQD5/xoAAQAYABAA8/8KAO3/8v///9//8P/0////BwAJACEA8/8MAPv//v8bAAAADQABAAYAAAD3/wgAAgAcAA4AAgAnAAcAFQARABkAGgD4/xAA///v/+7/0v/t/+P/4v/x/+X/AAD7/w8AIwD5//L/9//n/+f/6f///+T/3//z/wUA+P8bACwAFgAKABAA6P/h/9v/5//v/+D/9f8KAPv///8CABMA8f/u/wkA5P/w//T/7v/q//H/EADr/+r/AwDx//n/+f8HAA8AAAATAAgAAAADAAIA9v/c//b/+P/v//n//f/9/wEAFgAfAAMA/P8EAPr/7P/u/wQA9//s//P/CgD+//7/AQALAP//AwAGAPj/9//4//f/AwD7/wEA/f/9/wAA8v/7//r/+v8BAPv/+//+//P//P/+//v/AQATAAMA/v/6//f/9//7//f/8//+/wEA8f/+//b/AAANAPv/AwD+//z/+v/2//v/+P/7//7//v/2/wAA/P8DAP3//v/z//L/+f/+/wIA/v/5/wAA9P8AAPH/+P8CAAUAAADp//v/BgD6//f/9f/3//j/+P8AAPL//v/6/wcABAAEAP3/BQACAPL/+P/4//T/+f/3//r/DAD1//3/9//9//b//P/6////BwD9//z/8/8EAAgA/f/7/wUACQADAPb/8f/y//r/AAD4/+z/8f/5//b//P/+//j/+P/+//v/AADy//v/AAD///T////8//j/BAAAAAEA/P/7////AAADAP3///8HAAQA//8AAAMABgADAPv/AAAFAPz/+v/+//3//f/6//7/CAD///P/+/8BAAEAAAADAAMAAQACAAQA/f8AAAAAAgD+//v//f8DAPr/+P8CAAEABQADAP//AAD4//r/AwD8//X/BgAJAAEAAAAEAPr/BQACAPr/AgAAAPn//f///wEABQAAAPv/+f8AAPv/+//9/wYABgD//wQAAAAAAAUA//8DAAQABgD8//j/+v8BAAEA/v/7/wAAAwD8/wAAAAD9////+//8/wUAAgAAAP7//P8DAPv/AgAGAAAAAAAAAP3/AwD//wAA/f8DAAUA+//9//z/+//+/wEA//8FAAIAAAAAAPb/AwAGAP//AQAAAAAA+v/+/wIA//8LAAQA+//9//3/AgD+//3////9/wEAAAD6//3/AQAAAAEA/////wAAAgABAAIAAAAAAAUABAAEAAEA+//6//7/AwAAAP//+/8AAAEA+/8GAPn//v8AAPj/BwAAAAAAAAAAAP7//P8HAAYA///3//z/BgACAPz/AQADAPv//v8GAP7/AgD8/wAABgD///v//v8AAAAA/f///wEA/f///wAABgABAPr/AgD9/wMA+P8AAP//+/8AAPv//v8GAAAA//8EAP3/BQD6/wMA/f8AAAgA/f/8/wAA+//6////AAD9/wcA/P/7/wIA/v/9/wEA+v8DAAMA9v8AAAcA+P///woABQAGAAIA/P/5//z/AQD//wYAAwD8/wEA//8BAAAA///2/wEAAQD4////BAAFAP3/+v8HAP//AAAAAAAAAQD9//r/BgAAAAAA+P8AAAUA9v8CAP3//v8AAAQAAQD7/wcAAgD7/wIAAQD5/wAAAAAAAP//BAACAP7/AQD+//f/AgAGAPr/AgAEAPn/+f///wQABQAAAAMA/P8BAAEA+v8BAP//AwD9//z/AAAAAAAA9f8DAAYA+//7//3//f8BAAAAAAAGAAgAAwABAAgAAAD7/wUAAgD5//v/AAD6/wUABgD8/wMAAQD9////AAACAAIA+/8DAPj//v///wEA///5////AQAAAAAAAAAHAP7/+/8IAAQA/P8HAAQA/f8AAAMAAQD8/wEA/v8DAPb/+P/9//r/AAAAAAMAAQD7/wAABgADAAMA///6/wAABgAGAPr//v8CAAAA/P8AAAQA+/8BAAQACgD8//f/+f///woA9f/2/wAAAAAAAPr//v/9////AgD//wUA/v/6/wUABAD+/wkABgAAAP7//f8EAPz///8AAPj/BQABAO7/+f8DAP//AAABAAEA+v8IAAcA8/8EAPv//f/8/wAAAwD6/wEAAQD6/wEAAQD6/wQABQACAAIAAAD8////DAAEAPn//v/9//v/+v8DAPz/AwD6//j/AQAAAPz//v8BAAIA+//9/wAAAwAAAPz/AQD9/wEAAgD8/woABAACAP//BgAAAAAAAgAAAPr/AgAHAPj/+f/6//7/AgD6//f/9/8JAAAA9/8BAPr/AAAGAAMABgD//wcABwABAP///P8BAAEA+v8EAPn/AAABAPv/BAAIAP7/+v8HAPz/AQAAAP7//v/4/wAAAAD9//n//v8AAP//AQD+////DgACAPv/CAD///X/BwD8/wAABAADAAIABgD9///////9/wAA+//3//X/AAAFAAUA+v/5//7/BAD7//f/AQAAAPv/AgADAAAAAQAAAAoABAD5////BAACAP7/+f/2//r/BAD/////AAD6/wAABQAAAPv/CgD+//7////7/wEAAQAAAP///f8BAP///P8DAPf//f8FAPr//P8IAAYAAQAFAAQA+f8EAAQAAwD4//r/BAAHAPf/+/8FAAAA+v///wQA+v/7//v/+/8CAPz/BwAAAAAABQAEAAUAAAAAAAUAAQABAAcA9//9//3//v/y//r/BQD5////BAAEAAAAAAAAAAUA///5////AAD7//b//v/8/wYABwD9//3/DgD6//3/BwD//wAA+/8DAAUABAADAAQAAgD+//v/+//7//v/AAD6//z/BQADAAUA7//4/wgAAQD2/wIAAgD3/wIAAQACAAIA/f8IAAgAAAAKAAoA/f/+//7/+v8FAPr/+v8EAAQA+f8FAAAA+//7/wAACQD///n/AAAAAPv/7//8/wwA/P/9/wQA/v8IAAkACAAHAP3/+f/8//v/+v8EAP//+f8EAAUA8P/+//3/AQAHAAAAAAAKAA8A+P/7/wQAAgD3//r/+v8AAPr/9P8CAP3//f/9/wIABwAHAAUAAAAFAAoABwD9//3//f/9//f/+v/6//r/+v///woAAAD1//v//f8BAAcA/P/9/wgAAgD9/wgABQD6/wUABQAAAAUAAAD6/wAAAAAAAPr/+v8AAPr/+P/4//3/AgABAAcABwAFAAAABQAFAAAABAAHAP3/8v8AAAAA+v/5/wAABQD1//v//v8CAAEABAAFAPr/AAARAAEA/f/9//3//f/6////BAD///r/+//7//r/AAAEAAAAAAAAAAAAAAAAAAAAAAAFAAQABQD8/wgA/f/3//3//f8CAPz/AgD3//T/AAD0//H/9/8CAP3/AAAIAAgAAgAIABEAAAD6/wUACgABAAIA/f/9//3//f/9//f/AgD3//r/9P8AAPr//f8HAAoAAAAAAAAAAAAKAPr/+/8FAAAAAAAFAAAAAAAAAAAAAAD6/wAA+v/6/wAABQD0/wIABQD6/wUABQAAAPr/BQAAAAAABQAFAAcAAgD3//f/AAD0//T/AAAAAAQABAAFAPr/+/8AAAUABAAAAAAA+v8AAPr/+v/9/wIAAgAFAAAA+v8FAAUAAAAAAAAAAAAAAPr/+v8AAAAA+v/9/wkAAAD7/wQABQAAAAUABQAAAAAABAACAPD/9f/0//3/BwAEAAAA+v8AAAAABQAFAPr/BQAFAAAA+v/6/woABAD9//T/+v8FAPr/AAAFAPr/BQAFAPr/AAAAAAAACgACAP3//f/6/wAABQD6/wAABQD6//T/AAAAAAAA+v8AAAAAAAAAAPr/BQAFAAAABQD6/wUABQAFAAIAAgACAPf//f8CAPH/8/8AAPr/+v8AAAQAAAAFAAQAAAAAAPr/+v8LAAUABQD6//r/AAD6//r/+v8FAAUABQD0/wAAAAAAAAsABQAAAPT/BQAAAAAA+v8AAAUAAAD0//r/BQAAAAAA9P/x/wgA/f8CAAgACAAFAPr/AAAFAAUACwD9//r/BQACAP3/AgD9//f//f/9//r/+v/6//r//f8CAAIAAgAFAAsAAAAEAAAAAAAFAP7/AAAAAAAAAAAAAPn/BQD6//r/BQAAAAAABQAFAAAAAAAAAAgA9/8AAAIA+v/6//r/AAD6//r//f/9/wIACAAFAAAA+v8CAAUABQAFAAAAAAAFAAIA+v/6/wUAAAD0/wAABQAAAAAA+v8AAAAABQAAAAAAAAAAAAAA+v8FAAUABQAAAPr/AAD0//r/BQAFAPr/9P/9/wIA/f/3/w0ABwAEAAsACgACAP3/AgD2//f/+v8AAAUAAAAAAAAA+v8AAPr/+v/6//3//f8IAAgAAAD3//3/DgALAAAAAAAAAAAABQAFAAAA+v8AAPr/AAAAAPr/AAAAAPr/9//9/wgA/f/9/w4AAAAAAAAAAAAFAAsABQD9//3//f/9/wAA+v/0//T//f8CAP3//f8OAAIA/f8CAAsABQAAAAQAAAAAAAAABAAAAPr/AAAFAPn/+f8AAAAA9P/9/wIAAgD9//3/CAACAP3/CAAFAAAACwAAAPr/BQAAAAAABQAAAPr/+v8FAAAA9P/0/wIAAgACAAIAAAAAAAAACwALAAAAAAACAAIA/f/x//r/AAD6//r/+v8CAAIA/f8CAAgABQAAAAsABQD6/wUAAgD9//3/AgD9//3/9P/6//r/BQD5//P/AQACAP7/9/8CAAEAAgACAAIACAAFAPr/BQAFAAAAAAAFAAAABQACAPf/AAAAAPr/+v8AAPr/AAD6//3/AgAFAPr//f8IAAAAAAAFAAUAAAAAAAAAAAAAAAUABQD6//r/9P8FAAUAAAAAAPT/AAAFAAUABQAFAP3/+v8AAPr/+v8AAPr/+v8CAAIA/f/9/wIACAAFAAUABQAFAPn/BAAFAAIABwD+//7//f8BAP3/9v/9/wIA/f/x//r/AAD6//T//f8CAAIA9//9/wgA/f8IAAgACwAFAAAABQAFAAIA/f/9//3/CAD9/+v/+v8FAAAA9P8FAAsA+v8AAPr/BQAAAPr/AAAAAAAA9P/9//3/AgD9//f/AgAIAAIAAgAOAAAAAAAFAAAABQAAAPr/BQAFAAAAAAACAAgA9//2//T/AAAEAPT/AAD0//3/AgACAAIAAgAFAAAA+v8FAAUABQAAAAAABQAAAAAA+v8AAPr/+v8FAPr/+v8AAP3/AgAFAAAABQALAAAAAAAFAP3/AgACAPH/9P8AAPT//f8CAP3/AgACAAgA/f8IAAUACwARAP3/9/8CAP3/9//9//3//f8AAPr/+v8AAPr/AAAFAPr/+v/9/wIA/f/9/wIAAgAOAAoAAAAAAPr/AAAFAAAA+v8EAAsA+v/0//r/+v8CAAAA/f/9/wIACAAAAAAABQD6/wAAAAAAAAUA+v8AAAAAAAD0//3/CwD6//f//f/9/wIACAD9/wIAEQALAAgA/f/9/wIAAgD3//3/AgD3//f/+v/6//r/+v/9//3/AgACAAIAAgAIAAAABQAAAAAABQAAAAAAAAAAAPr/AAAAAAAABAD6//r/AAAAAPr//f8CAAUABAAAAPr/BQAFAAUA+v/6/wUAAAD6//r/AAAAAAAA9P/9/wgA/f/9//f/CAAIAAIABQAFAAUAAAAAAAUACAD9//H/AAAFAAIA/f/0//T/+v/9/wIAAgAFAAAA+v/9/wIABQD6/wIABQAFAAAA+v8RAAIA/f8CAP3//f/x/wUAAAD6/wUA+v/6/wUABQD5//n/AAALAAAAAAAEAPr/7v8FAAQA+f8AAPr/BQAAAAAAAAAAAAsACAD3//r/BQAAAPT/AAAFAPr/AAAAAAAAAAAFAAAA9P/6/wAABQAFAAUA9P8FAAAAAAAAAPT/AAAFAAAAAAAAAAUA+v/6/wUABQAAAAAABQAAAAAA+v8FAAAA9P/0/wIA/f/9/wgACAD6//3/CAALAPr/AAALAAUAAgD9//3//P/9//7/+v8AAPr/BQD5//n/BQAAAPr/AAAFAAUABQACAAIAAgD9//3/9//6/wAAAAD0//T//f/9/wIA/f/9/wIAAgACAA4ABQAFAAUABQAAAAIAAgD9//f/+v/6//r/9P/9/wgA9//9/wIAAgACAAIACAACAAUABQD0/wAACwAFAPr/+v8AAPr/+v8AAAUA9P/3/wgAAgACAAUA+f8AAAsABQAAAAAABQABAP3//f/9//r/AAAFAP3/AAD6//T/+v8AAPH/8f8IAAgACAD9//3/AgAOABEA+v8AAAUAAAAFAAgA/f8CAP3/8f/0/wAAAAAAAPT/AAAAAPf//f8CAAgABQAAAAAACwALAAIA8f8AAAUA+v8AAPr/AAAAAAAAAAD0/wUAAAAFAAsAAAAAAAIACAD9//3/9//9//3/+v8AAPr/8//3//3//P/9//3/AAAOAA4ACwALAAUAAgACAAIACAAAAAUAAADu/wAAAADw/+v/+v/6//T//f/9/wIAAgAIAAgABQAFAAAACwAAAAAAAgD9//r/AAAFAPn/AAD6/wUABQAAAPr/+v8AAAAABQALAAgA8f8AAAAAAAAFAPT/+v8AAAAAAAAAAAAA9P/9/wIAAgACAAIACAAAAAAABAAAAPT/BQAAAPv/BQAAAAAA+v8LAAsA8//5//////////n/8//2//z/CAACAPj/AwAJAAkABAAMAAwA+//6/wUACwD2//n/+P8DAP7/+P8EAP//+f8AAAAAAAAGAAcAAQD8/wEAAQAGAPv/AAAAAPn////4//7/AwDy//X/AQABAAEAAgD9//j/AwAPAAcABwABAAwABgADAAIA/f/7//X/+f/5////+f/6/wAAAAAFAAUA9P/6/wUAAAAAAAAA9P8FAAsA+v/6/wAAAAAAAAAA+v8FAAsAAAD6/wUABQD6/wUAAgD9/wIAAgD3//f/AAD6//r/+v8AAPf/9/8CAAIA/f/9/wIA/f8CAAgAAgAIAAIAAgAFAAUAAAALAAgA/f/9/wIA/f/3//3/AgD3//r/+v/6/wAA7f/x/wcABwACAP3/AgAHAAIAAQAAAAAABQD6/wAABQAAAAAABQAFAPr/AAAFAPT/AAAFAPr/BQAAAAAA+v8AAAAABQD6/wAA+v/6/wAA/f/9/wIA/f/9/wIAAgAIAP3/9/8IAA4AAAAAAAsABQACAP3//f8CAAIA9//3/wAAAAD6//T/BQAFAPT/+v8AAP3/CAAFAPr/AAAFAAAABQAAAAAAAAD5/wUAAAD6//T//v8CAAIA/f8CAAkA/f8IAAAA+v8LAAAAAAAAAAUABQAAAAAAAAD6//T/BQD6//r//f/9//3/9/8IAAgA/f8CAAgABQD6/wsACwD6//T/AAAFAPr/AAAAAAUA+v8AAAAA+v/0//3/AgD9//f/AgACAAIACAACAAgAAAAFAAsA+v8AAAUAAAD6/wAAAAAAAAUAAgD6//n/AAAAAPr/7v8CAP7//f8HAPf/AgANAAsA9P/9/wUABQAAAAUACwD6/wAAAAAAAAUA+v/6/wAA+v8AAAUAAAAAAPr/AAAAAPr/+v/9/wgAAAD3//3/CAACAAIAAgD9/wgABQAFAAAABQAFAAIAAgDx/wIA/f/9//3/+v/6/wAAAAAAAAAA+v8LAAUAAAAAAAUAAgD3/wAACAD9//f/+v/5/wAA+v8AAAUA+v/6//3/BwD6/wQAAAD6/wUAAAAAAAUAAAD6//r/CwALAPr/AAAFAAIA9//6//r/9P8AAAUA+v8AAAAA+v8CAAIA/f8CAAgAAAAFAAUA+v8AAAUAAAD6//r/AAAFAAAAAAAAAPr/BQALAAIAAgD9//f/+v/6/wUA+v/6/wAA9P/3/wgACAAAAAAAAAAAAPr/BQAAAPr/AAAAAPr/AQAFAAQAAAD6/wAABQAAAPn/+v8FAAUAAAAAAAsAAgD9//f/9P/6/wAAAAAFAPr/AAD6//f/AgAIAAUAAAAFAAUA+v8AAAUABQAAAPr/+v8FAAsA/f/6/wUAAgDu/wAAEQD0//T/BQAFAPr/BQAFAPr/+v8AAAUA+v8AAAAABQD6//r/CwAFAPr/CwACAPf/AAAFAAIA/f/z/+7//f/8/wcAAgD+/wcAAAAEAAUABAAAAAAAAAAAAAAAAAAAAAAAAAD6//T/9//9/wIAAgD9/wgACAAFAAAAAAALAAUA+v8AAAUA+v/6/wAA9P/3/wIADgD6//3/AgAFAAAABQAFAPr/+v8FAPr/+v8FAPr/AAAAAPr/AAAFAAAA+v8FAAAABQARAAgAAgACAAUA+v/6//f/6//0/+7/9//2//T/8//8//3/BwAUABAADQAUABQACQAIAAIABQD6//T/9v/3//f/7f/0/wAAAAD8/wsABQAAAAUABQACAPb/AgD6/wAAAAD0/wAA9P/9//3/9//9/wAACAAOAA4ACwAOAAgAAQD9/wMA9v/n//X/9P/w//3//v///wQADwD9//z/FwAbAAcA/P8DAAIA9v/x//r/+f/z//H/8f/y//n/BQD//woAEQAOAAkABgANABAABAD+/wkA/P8AAPr/7v/6//r/9f/5/wAAAAABAAgABQD/////+/8AAPP/7//v/+7//v/4/wAA/P8OAAwAEgAWAAoAFgATAAkADAALAPz/AQD1/+n/+P/y/+n/5P/t//H/8f/7//7/CgATAAEADAAPAAgABwAKAAMACQAGAAAACgD///T/AAD7//v//v/z/////v/4//r/9//y/+/////0//f/AgD4////EQAGAAAACgAQAAQACgANAAEADQAKAP//CQADAAAA+P/0//P/8//y/+//8P/6//v//f8DAAAABgANAAcADQADAA4ABgD5//7/AgABAPb//f/+//P/AAAAAAAADAAAAPv/AAAAAPn/+P/4/wQABADu/wMABAAHAAIA/f8NAAcA+/8FAP//9/8CAPj/8f/+/wQABAAAAPz/+/8HAAcA/P8BAAAAAAAKAPj//v/9//3/9v/8//3/9//+/wQABQAAAAEAAgADAAMABAAVAAYAAAAKAAkA+f/7//T/8//4/+z/7//v//P/7v///wsAAAACABIAEgANAAoACgAPAAsABAAJAAAA+P/6//P/+P/s//X/7//w//r/AQACAP7/CgALAAMA/v8GAAUAAQAMAPn/+f////j/+//7/wwABQD7/wEAAgAIAAgAAgAHAAkA/v8CAAIA9v/1//j/8f/3//T/9P/1//7/BAABAAAABQAPAAkADAAHAAcABwAEAAQA+P/+/wMA8f/6/wUABAD5//j//v/+//j/+P/+//j//P8BAPz/9//9/wMA/v8EABAABAAKAA0ABwAKAAkADwAFAPP/+f/+//7/9//w//T/7f/r//L/7P/z/wMABAAAAAsACAADAAkAEgAFAAAABgAAAAAAAAAJAAMAAwADAPL/9/8CAP3//P/5//n////+//j/+P/4//X//P/8//3/AgADAAkABAD//woAEAAHAA0ADwADAAIA/f/8/wcA+P/m//T/9//x//L/+/8BAPz/9//+/w8ABAAEAAUAEQACAAcAAQAGAAYA9P8QAAEA9f8AAPv/+//2//j///8JAAAA/P/2//P/8v/1//T/+//7////BQAIAA8A/v/5/wsACwAOAA4ACwD//wQACQD9//z/AQD7//T/9P/z//D/9v/u//T/+////wUAAwD+/wQABQALABEADgAUAAUA//8DAAMA/f8CAPz/9f8AAPv/7//3//j/8v/+//////8AAPf//f/9/wkAAwD+//7/AwAQAP7///8JAA0ADAAGAAgABwACAP7/+P/3//j/+P/s/+z/9f/8/+j/9f8BAPf/AAABAAgAEQAMAAAADAAPAA4ADgAEAAQA/v/9//3/9v/z////+P/y//v/BgAJAP7/9/8IAP3/9/8DAPj/7P8BAPz/8f/+/wEAAQAIABEADAAMAAkADwASAAsACgAAAAAA+f/4//f/9v/k/+//9f/v//L/+f8AAAAACAADAAwADQAHAAIAAgAJAPj//P/5//j/BAD5//n/+f8AAAAA+/8GAAYAAQAGAAYABgD9/wAAAQD2//L/AwD+//L/+P/w/wEAAgACAAkAAwAHAAEAAQAHAAcABgADAAIAAgAHAPv/7//6//r/9P/y//L////8//3/CQADAAcAEwAHAP//BAD///7//v/9//n///8EAP7/8v/y//7/+/8CAAIAAgAFAAAAAAAFAAsA///+/wMA+P/3//H/+P/7/wEACAD9/wMABwAHAA4ACAAAAAsABAD+/wMA/f/2//v/+v/x//H/8f/6//r/7//4/wQACwADAP//EQARAAIACAAOAAoACgAJAAAA+f/4//v/9P/6//T/7v/3/+z/7/8BAAIAAwADAP//CgAKAAcA/P8EAAYAAAAAAPr/BAAEAP7/AwD+//7/+f8FAAAABgAEAP7//v/+//3/8/////7/8f/u//r/+v/7/wAA/P8CAAIACQAEAAQACgAOAAgADQATAAcAAAAAAAAA+f/y//X/9P8AAO7/8v/s//D/AQACAPf/AAAGAAQABAAKAAoAEAAGAAYABQAAAAEA/P8BAPX/+P8EAAEA/P/8/wIAAgD9//f//f/9//r/+v8AAPT/9v8CAPz/8P/5/wUA+v8MABEABAARAA4ADgAHAAoACQD9//z/AQAAAO7/6P/r//3//f/u/+////8FAAYAAQAHABEAEQAOAA4ABQD//wkAAwD9//z/+//1//r/7v/r//r/+//7/wEACAAIAAAA+//4////BAAKAAQA/v8PAAwA+v8AAP////8EAAQA/////wcA/P/2//n/BQD6/wAAAAAAAAAA+v8AAO7/9/8CAA0AAgD9/wgAAAD7/wYAEgAGAP7//v8DAAMA/f/9//3/8f8AAAAAAAD///P///////P//P8IAPz/9/8CAAgACAD9//3/DgAGAPr/AAALAAAAAAAFAAIAAgAIAAIA9v/2//b/AAD5/wAA8//5/wAA9/8CAAIAAgACAP3/AgADAAgAAAD3/wIADgAAAAAABQALAAAAAgD8//b/CAABAPz/AgD9//f/9//0/wAACgDu//H//f8CAP3//f8OAAgA9/8CAAgAAgAFAAAABQAFAAAAAAAAAAsAAgD3/wgAAgD3//3/AgD9//3//f/x//r/AAAAAPr/9P8IAAUA+v8AAPr/AgACAAUAAAAFAAUAAAAFAAAAAAAAAAUAAgD9/wIA8f/6/wUA9P/0/wsA9P/x/w4ACwAAAPr/AAAAAAsA+f/6/wsABQAHAP7/9v8AAAAA+f/5/wUAAAAAAPT/AAAAAPT//f8CAP3/AgACAAIACAALAAUAAAALAAgA/f/9//3/9/8CAPf//f/6/wAA+v/6/wAA+v/9//3/CAACAAUABQD6/wUAAAAAAAAA+v8FAAAA+v8LAAAAAAAAAAUAAgD9/wIA/f/9//3/9P8FAAUA+v/0//r/+v/9//3//f8CAAIA/f8HAAIAAgAHAP3/AQAKAAAAEAACAP3/CAAIAP3//f/9//H//f/3//r/+v8AAPr/+v8LAAAA9P/9/wgAAAAAAPf//f8IAAIA/f8IAAUAAAAFABEACAD9/wgAAgD3//f/AgD9//f/9P/6/wAA9P/3//3/AgD9//f/BQAIAAIACAAIAAUACwAFAAIA/f/6/wUA/f/9/wIA9P/6/wUAAAAEAAAA+v8AAAAAAAD6/wAAAAAEAAUA+v/6/wAAAAAFAPT/9/8IAAAAAAAAAPf/AgACAAIA/f8CAAgABQALAAAAAAAAAPr/BQD6//r/AAD0/wIAAgAAAP3/AgALAAsABQD9//r/BQACAPf/+v8AAPr/+v8FAPr/+v8FAAAA+v8AAAUAAAAAAAAA+v8FAAAABQAFAPr/CwD9//r/BQACAP3/9v/6/wAAAAAAAAAA+v8AAAUA+f/5/wAAAAD6//3/AgAIAAUABQD6/wAACwAAAAUAAgD9//3/AgACAP3//f/9//3/9P/6/wUA+v/0//3/CAD3/wIACAACAP3//f8IAAIA/f/9/wgACwAFAAAAAAAAAAAAAAAAAAsAAgD9//f/AAD6//r/+v/0//3//f/9//3/9P8FAAsAAgD9/wgAFAALAAQABQACAP3//v8HAPb/9v/6/wAAAAAAAPr/AAAAAPr/AAAAAAAA+v8AAAUA+v8AAAAAAAAAAPr/BQALAPr/BQAFAAIAAgD3//3//f/9/wIA9/8AAAAA9P8FAPT/9/8IAAUABQD6/wAA+v/9/wIAAgACAP3//f8CAAgABQAAAAUAAAD6/wUACwACAPf/AAAAAPr/BQAAAAAA+v/0/wAAAAD2/wIABwAAAPr/BAAFAAAAAAAEAAAABQAFAP3/CAD9//H/+v/6/wAAAAD0//3//f8CAAgA/f8CAAIACAAAAAAACwAAAPr/+v8FAAUA9P/6/wAAAAD3//3/AgAIAAUA+v/9/wgACwAFAAAABQD6/wAAAAAAAPT/+v8FAPr/+v/9//3/CAAFAPr//f8RABEA/f8IAAgAAAD3//3//f/3//b/9P/z//r/AgDx//7/BwD8//3/DgACAPf/DgALAAAAAAAFAAUABQACAP3/9/8AAAAA+v8AAAAAAAD6/wAABQAAAPr/BQAAAAAACwD6//r/AAAAAAAA9P8AAAAA+v8CAAIAAAALAPr/BQALAAgACAD9//f/CAACAPH/AgD3//3/CADx//T/+v/6//f//f8CAAIAAgACAAgABQAFAAUAAAAAAAQABQD8/wAAAAD6//r/9P8AAAAAAAAAAPr/AgACAAAABQAFAAAABQAFAAAAAgD3/wAAAAD6/wAAAAAAAAAA+v/0//3/CAD9/wIACAAAAPr/BQAFAAUABQAFAP3/9P8AAPr/AAAAAPT//f8CAAIA9/8CAAgAAgACAAIAAAAFAAUAAAAAAAAABQD6//r/AAD0//f//f8IAAIA9/8CAA4ABQAAAAAACwAAAAcABwD9/wEA/f/2//b/9/8AAPT/7v/9//f//f8AAAAABQAAAAsADgAOAAUACwAIAAgACAD6//3/AAD6//f/9//9//3/9//6//r/+v/6//3/CAD9/wIAAgD3/wIACAACAPf//f8CAAIA/f8CABQACwD6/wAABQAFAAAACAACAPf//f8CAPf/9/8AAAUA+v/6//r/9P/9//b/9v8CAPr/AAAEAAQABQAHAAcABwALAAsADgACAP3/AgACAAAAAAD0//3/9//3//f/AAAAAPT/+v8AAPf/9//9//3/AgAIAAIAAgAIAAgABQAFAAAAAAAAAPr/AAAFAAAABQAAAPT/AAALAAAABQAIAAIAAgACAP3/9//3//T/+v/6//H/9//9/wAAAAAFAAUAAgAIAAgADgARAA4A/f8CAAcAAAD0//b//v/+//H/8//6//T//f/9//f/CAACAAIACAACAAsAAAD6/wAABQAFAPr/+v8LAPT/+v8FAAAA9P8CAAsA7v/3/wgADgAFAAsAAgAOAAIA/f/3//f/CAD9//H/+v/0/+7/8f8AAAUAAAALAA4AAgARAAsAAAAFAA4A/f/9/wIA9//3//T/+v/6/wAAAAAAAAUA+v/6/wwACwAHAAgA8f/9/wIA/f/9/+7/8v//////9v/2/wIACAAIAAMABgAAAPv/BgAMAAYAAwAIAAgAAgD5//z/9v/8//z/9v/5/+r/9v8CAPf/9/8GAAkACQADAA8ABgAGAAsAAgAOAPz//P/8//D/7f/z/wQA8/8CAAIA/f8RAAwAAAAJAAkAAwD+//3/AgD3//f/8//t//b/9v/8//////8AAAQACgACAAgACQACAAkABgAHAAYACQADAP3/AgACAAEA/P/7/+//+//1//L////5//T/8f/3/wAAAAASAA8AAwAJAAwADAACAAgAAgDw//b/+f8EAPP/+f////P/CAARAAUAAAAAAAMAAwD+//f/+v8AAPr/9P/w//z/BwD8//z/BwD8/wgADgAAAAUABQAGAAMA/f/6/wAAAAAAAAAAAAD/////+v/6/wQABQAFAPv/BQD///P////y//v/AQD2//f/CQAJAAQACgANAAAABgAAAPn////4//7/+P/4/wQAAAD6/wYABwABAAEAAQAAAAAAAAAEAPL/8v8DAP7////5/wAAAAD7//7/DQD7/wAACwAAAAoA/P////j//////wAABQACAAkAAwD+//7//v8DAP3//P/2/+3///////L/9v8BAAcA/f/9/wIACAAIAAUABQAFAAUAAAACAP3/+v8AAAAABQACAAIA9/8CAP3//f/9//T/+v/6/wUAAAD6/wAA+v8CAAUABQAAAPr/AAD6/wUA+v/6//3//f8CAP3/AgD9//3/CAACAA4ABQAFAAsAAgD9/wIAAgACAP3/8f/0//T/+v/9//3//f8CAAgAAgAFAAAA+v8FAAUAAAAAAAAAAAD6/wQAAAAAAAQAAAAAAAAA+f8FAAUAAAD6//r/AAD6/wAAAAALAAAAAAD6//r/AAAFAPr/AAAAAPr/+v/u/wIAAgACAP3/CAAOAAUAAAALAAgAAgACAPf/AgD9//3//f/3//T/+v8FAAAA+v/0/wIABQAAAAAAAAAFAAAA+v8AAAAA+v/6/wIAAgAFAAAAAAAAAPr/+v8CAAIABQAAAAAACgAAAPr/+v8AAAAABAAAABAAAgDw/wIAAgACAPf/9P/u//f//f/3/wIAAgACAAIAAgACAAIAAgAIABEADgD9//3//f/9//3//f/9//r/BQACAPf/+v8LAP3/+v8AAPr/AAD6//r/AAD6/wIAAgD9/wgAAAAAAAAA+v/9/wIACwALAAAA+v8FAAAA+v8FAAUAAgD9//r/+v8AAAUABQD9//P/AAAAAAAA+v/6//z/9/8CAAIAAgAIAAsABQAFAAgAAgD9//3//f/3//3/AAAAAPr/+v/6//r//f8CAAIA/f8IAAUACwAFAPr/AAAFAAUA/f/9/wIA9P/6//T//f8CAAIAAgD9/wIAAgD9//3/DgALAAAAAAAAAAUACwD9//3/9/8AAAAA+v/6//T/9/8CAP3/9/8CAAgACAAIAAUACgAKAAEA/f8CAAIA/f8BAAIA/f/9//D/9/8AAPT/7v/9/wIACAAFAPr/BQAFAAAABQAFAAUA/f/9//r/AAAAAPr/+v/6/wAA/f/9/wgA/f8CAP3/CAAFAAsAAAAAABEACAD9//3/AgDx//f/+v/6/wAAAAD0//3//f/3/wgACAD9//3/CAAIAAUACwAAAAsACAD3//3//f/9//3//f/5//n/+v8AAAAA+v8EAAUAAAAFAAcACQD9//3/AgD3//H/+v/0//r/9//3//3/AAAFAAUACAAIAAgACwALAAgADgALAPr/9P/3/wIA/f/3//H/9P/6//T/9//x/wAAAAAAAAUACwAIAA4AEQALAAAAAgAIAAIA9//3/wIA/f/9//f/+v8LAPf/+v8FAAAA+v/6/wAACwAFAAAAAgACAP3//f/2//n///////P/8P/9/wEA/f8CAA4ACAAGAAYAEgADAAMACQD9//3//f8CAPz/9v/2//X/7P/4//z//P8CAPf/9/8AAAwAAwADAAMACQAPAAAABgALAAAABQABAPz//P/2////+f/5////+f8FAAAA+v8AAAAAAAAAAAYAAAAAAAUA+v/0/wUA8//w/wEAAQABAPb/AgAIAA4ABQD0/wYACwAFAAAACQACAPH//f8BAAYA9f/v/wMA8v/y//////8FAAAA9f/+/woAAQD///////8EAA8ABQD6////+P/+/wgA/f/x//3/AwD+//P/AAAGAAEAAQAIAAIACAALAAUA///4/wIAAgD7//X/+v/6//H/8f/u//T/+P///wUABgAKAAoACwAOAAgAAgACABMACQACAPz//P/v//r/AADr//H/AgD4//n/BAD6//f/CQAMAAAAAAAAAAAAAAALAAAA+f//////BAD///n/////////+f/6/wUABQAAAAYABgD7/wAADAD3/wAABQD6/wQAAQDz//n////z//b/AQD8//b/AgAIAAkAAwADAAYABgAAAAwAAAAAAAUA+v8AAPP/8/8BAP///P8BAAQA+f8CAAUA+v8AAAAA+/8DAAAAAAAFAAsABAD9/wAAAAABAPT/8/8EAAAAAAAAAPr/BQAFAAAAAAAFAAgACAD9/wIAAgDx//f/9P/6/wUA+v/6//r/BQAAAPr//f8CAAgA/f/9//3/AgACAAgACwAFAAAABQAFAP3/+v8FAAAAAAAAAAIAAgDx//r/BQAAAPr/+v8FAPr/AAD6//r//f/9/w4AAAD9/wIACwD6/wUABQAAAAAAAAAFAPr/BQAHAAIA8f8AAAIA+f/0/wAABQD6//r/AAAAAAUACwAFAAgA/f/3//3//f/0/+7/AgACAAIAAgD3//f/CAACAAIACAAFAAUA+v8LAAsA/f/9/wIAAgD9//f/+v8AAAAA9P/6/wAA+v/3//3/AgD9//3//f8IABQABQD0/wUABQD6/wAAAAAFAAUAAAAFAAIA9/8CAAIAAgD9//3/AgAHAAAA9//+//b//P/3/+3/AAAFAPr/+v8AAAAA/f8CAAIACwAFAPT/AAAAAAAABQAFAAUAAAD6/wUACAD3//r/AAAFAAAA9P/6/wUA9P/3/wIA/f/3/wIACAACAAIACAACAAUABQAAAPr/BQAFAAAABQACAP3/9/8AAAAABQD6//r/BQAAAAAA+v/6/wAABQALAPr/+v8AAAAA+f8EAAAA9P/9/wIAAgD2/wcAAgD2/wkACAAAAAUACwAFAAgAAgD9//3/AgD9//3//f/x//r/+v/6//T//f/9//3/DgAIAAUABQD6/wsAAAD6/wAABQAAAAAA+v/6/wAAAAAFAAAA+v8AAAAA+v8AABEAAAD6/wsAAgD3/wIAAgACAOv/9P8AAPr/AAD6//3//f8CAPf/AgACAP3/DgACAAIACgAAAAAAAAAEAAQAAgACAP3/AgDx//r/AAD0//r/BQALAAAA9P/0/wUACwD0//f/DgD6//f/AgAIAAUA+v/9/wIA/f/9/w4AEQD6/wAAAAAAAAUABQACAPT/9P8FAAAA9P/6/wIA/f/9/wIAAgD9/wIA/f8IAAIA9/8IAAgAAAAAAAUAAAAFAAUAAAD6/wAACwACAPf/+v/6/wAABQD5//n/+v/6/wUAAAD0//3/BwACAAIAAAAAAAAA+v8CAAAABQAFAPr/AAD6/wUACwAAAPr/+v8FAAAABQAAAPr/CwAIAP3/8f8AAPr/+v8FAAUA+v/6//r/+v8CAP3//f/9/wIAAgAIAAgAAAAFAAsA+v8FAAUA+v8FAAIA/f/9/wIA/f8CAAIA9//3//r/+v8AAPT/AAD9//3/AgACAAIA/f/9/wIABwACAAIABAAFAAAABQAEAAUACAAIAP3//f/9//3/9//x/wgA9//u//T//f/9//3/CAD9/wIA/f8CAAgACAACAAUAAAD6/wUACwAFAP3/+v/6/wUA+v/0/wAAAAAFAAAA+v/6/wAAAAAAAAsABQD6/wAAAAAAAAAAAAD6/wAA+v/6/wAA/f/9/wIACAAAAAAAAAAAAAsAAAAFAAAABAACAAIAAgD+//7/8f8CAAIA9v/5//r/AAD6//T/AgALAAAA9P/9/wIACAAAAP3//f8CAAsAAAAFAAAAAAAFAAUAAAD6/wsAAgD9//f/AAACAP3//f/6/wAAAAD0//r/CwAAAPT//f/9/wIAAgD9//3/AgACAAIACAACAAIABQAFAAAAAAAAAAAACwAIAPf/9/8CAP3/+v/6/wAA+v/0//3/CgALAO7/AAAEAPr/+v8CAAIABQD6//3/AgACAAIABQAFAAAABQAAAAAAAAAAAAAADgD3//r/BQD9//3/+v/0/wUAAAD6//r/BQAFAPr/+v8AAAAA+v8CAAAA/f8CAP3/AgACAP3/CAACAAUABQAAAAsAAAAAAAIA/f/9//r/AAD6//T/BQD6//f/AgACAP3//f/9/wIA/f8CAAIACQAHAAAACwAAAAQAAAAFAAIA/f/9/wIACAD3//3//f/9//H/+v8FAPT/+v8AAAUA9P/9/wIA/f/9/wIACAAIAP3//f8RAAsABQD9/wIA9/8AAAgAAgD3//3/AgACAAIA8f/3/wAA+v8LAAIA9P/6/wUAAAD0//r/AgAAAPf//f8IAAgAAgD3//3/CAAIAP3/AgALAAUABQAFAAIAAgD3//3/AgD3/wEABwD3//7//f/2//r/7f8AAP3//f8CAP3/CAD9/wIACAAFAAAA+v8FAAsAAAAAAAAAAAAAAAUAAgD0/wAABQAFAPT/BQAAAPr/AAAAAAUA+v/0/wAA/f8CAP3/9/8CAAIA/f8CAAgAAgAIAAAACwAAAAAACwACAAgA/f/9//3//f/9//3/9//6//T/AAALAAAA+v8AAAUAAAD0/wAABQAAAAUA+v/6/wUA+v/z/wcABQD6/wUA+v8AAAAABQAFAAAABQAFAP3//f8CAP3/9//6/wAA+v/6//r//f8IAAUAAAAAAPr/AAAAAAUABQAAAPr/AAAAAAAAAAD0/wAACwAFAAAA+v8FAAUA+v8AAPr/AAAFAPr/+v8FAAAAAAAAAPr/AAD6/wUA+v/3/wIAAgACAP3/CAAFAAAABQAEAAAA+v8AAAAA+v8FAAQABQAAAPn/+v8AAAAAAAAFAAAAAAAAAAAABQAAAAAAAAD6/wAABQAAAAAA9P/6/wUAAAAAAAAAAAAFAAAAAAAFAAAABQD6/wAAAAD6/wUAAAD6/wAAAAAFAPr/7v8IAAUAAAD6//3/BQAFAPr/+v8AAAsABQD6/wAACwACAP3/+v/0/wAAAAAAAAAA9P8AAAsA+f8FAAAAAAAEAPr/BQAEAPr/AAAFAPr/AAD6//r/AAAAAPr/9/8CAAgA/f8IAAUABQAAAAAABQAAAAAABQAAAPr/AAAAAPr/+v8AAAUAAAAAAAAABQD6//r/AAD6/wAAAAAAAAUA+v/3//3/AgACAAgAAAD9//3/DgAFAAAACwAAAPT/CwAAAPT/BQALAAIA8f/6/wUA+v8AAPr/+v8FAPn/+v8BAAAAAAAEAAAA9P8FAAAAAAAAAAAA+v/9//3/CAALAAAA+v8FAAUAAAAAAAUAAAAAAAAAAAD0//r/BQAAAAUA+v/0/wAAAAD9//3/AgAIAAAAAAAFAAUAAAAAAAUAAAAAAPr/AAAFAAAA+v8AAAAAAAAFAAsAAgD9//3/9//6/wAA+v8AAAAAAAD0/wAAAAAAAAAA+v8CAP3/AgD9/wIA/P8HAAcA+v8FAAQAAAAAAAUA+v8LAAAA9P/6/wUABQD0//r/AAAAAPr/AgAAAAAAAAD6/wIABQAFAAAA+v/6/wUAAAAAAAAA+v8AAAAAAAAFAAAAAAAFAPr/+v8AAAAAAAD6/wUAAAD6/wAA+v/3/wIAAgD9/wIACAACAAAABQAAAAUABQAFAPr/+v8FAAAA+v/6//r/AAAAAPn/AAAKAAQAAAAAAPr/+v8AAAAAAAAAAPr/+v8CAAAA/f8FAAUAAAD6/wAACwAAAAAAAAAAAAAABQAAAPr/AAD6/wUAAAAAAPr/+v/6/wAAAAD9/wUACwAAAAAABQAFAP3/AAD0//T/AAAFAAAA+v8AAPr/AAAAAAUAAAD6/wUABQAFAAUA+v/6/wUABQD6/wAABQD6/wAABQD0//T/AAAFAPT/9/8BAAIADQAEAAUABAAAAAAABQAAAAAA+v8FAAIA+v8AAPr/BQAAAPr/AAD6//r/BQAAAPr/+v8FAAUAAAAFAAAAAAD6//r/+v/9/wIA/f8CAAIAAgAIAAUABQAAAAAACwAIAPf/9P8FAAIA9/8AAPr/AAAAAAAA7v/9/wgAAAD9/wIA/f/9/wgACAAAAAAACwAAAPr/+v8FAAAAAAAAAAAACwD6/wQAAgD6/wQAAgD9//T/+v8LAAIA9//6/wAA9P/6/wIA/f/9//f/CAAIAP3//f8CAA4ACwAFAAAABQACAAIA/f/9/wIA/f/9//3//f/x//r/+v8FAPr/9P8CAP3/CAD3//3/CAACAAIA9/8CAAgAAgD9/wgABQAAAAUABQALAAIA9/8CAP3/9//9/wIA/f/0//r/CwAAAPn/BAAFAPr/9P/6/wQA+v/6//f/9v8CAAgACAALAAsABQAAAAgAAgACAAIA/f8CAP3/9//3//f/9P/0/wAABQAFAPr/+v8AAP3/AgAFAAAABQAAAPr/+v8AAAUAAAD6//r/BQAFAPr/+v8FAAsA+v/6/wUAAAAAAAAAEQACAP3/9//9//r/+v8AAAAABQAAAAAAAAD6/wAAAAAFAAAA+v8AAAAA+v8EAAsA+v/0/wAAAAAAAAAABQAAAPr/+v8AAAUAAAAAAAAA+v8AAAAAAAAAAPr/CwAFAPr/+v/6//r//f8IAP3/AgD9/wgACwAFAAUACAD9//f//f8CAAIA/f/3//T/+v8AAPr/+v8CAAUAAAAAAAUABQAAAAUA+v8AAAAA+v8AAAUA+v/0/wAAAAALAAAA+v/6/wUABQAAAAUAAAD5/wUABAD6/wAABAAAAPr/+v/5//b//f/9//3//f/9/wgACAACAAgACwAAAPr/AAAFAAsA/f8AAAAAAgD9//3//f/6//r/AAAAAPr/9P8FAPr//f8IAP3/BQALAAAA9P/3//3/AgACAPf/CAACAP3/DgAAAAUACwAFAAIA/f8CAAIA/f/9//3//f/9//f/9P/6//r/9//3//f/AAAFAAUAAgAHAAIABwAHAAAABQD6/wAABAALAAIAAgACAP3//f/3//f/AAD6//T/+v8AAPf//f8CAAIACAACAAIABQAFAAUA9P/6/wsAEQD3//r/BQD6/wAAAAD6/wAACwACAP3/+v8AAAUAAgD9//T/AAAAAPr/AAD6/wUAAAD0/wIABQD6//3//f/9/wgAAgACAAIABQALAPr/AAAFAAAABQAAAAAA+v/6//T//v8HAP3/AQACAAIA/f8CAAIA/f8IAAsABQAAAAAAAAD6/wAAAAAAAAAA+v/0//3/CAAAAAAABQD6//r//f8CAAIAAgAFAAAAAAAFAAUABQACAPf/AAACAPr/+v/6//r/+v/9/wIA9/8CAA4A/f/9/wgACwAFAAUAAgD9//3/AgACAP3/9//9//3//f/6//r/AAD6/wAA+f8EAAAAAAAAAAAAAAAFAAAABQAEAPT/+v8FAAAA9P8AAPf/CAAFAAUAAAAFAAUA9P8AAAAABQAFAPr/+v8LAPr/9P/6/wUABQD6/wUAAAAAAAAA+v/0//3/CAAFAAAA+v8AAAUABQAAAAUAAAD0//r/AAAAAAAA+v/9/wgABQAAAAAAAAAFAAUAAAAAAAUA/f/9//r/AAAAAPr/9P8AAP3/9v8HAPz/9v8CAP7/AgAHAA4AAAAFAAUA9P/6/wAAAAALAAAA+v8AAPr/BQAFAAUA+v8AAAsAAgD9//3/CAD9//H/+v8AAAUA+v/u//f/AgAIAAUA+v/9/wIAAgACAAsACwAFAAIAAgD9//3/CAD9//f/9//6/wAA+v8AAPr/AAAFAAUA+v8AAAUAAAAAAAAAAAAAAPr/9P8FAAAA9//9/wIAAgD8//3/AgAHAA4ABAAFAAAABQACAP3//f/6/wAAAAD6//r/+v/6/wUAAAD6//3/AgACAAUABQD6//r/CwAFAAAA9P8AAAUAAAAFAAUA+v/6/wAA+v8AAAAA+v8AAAAA+v8AAAAABQAAAAAABQAFAAAA+v8AAPT/AAAFAPr/AAD6/wAACwAAAAAACwAAAAAAAAAIAP3/AgACAPf/AgD9//f//P/6//r/AAD6//T/AgAEAAAA9/8IAAsA+v/6//3/AgAFAAAAAAAFAPr/AAAAAAAABQAFAAUA+v8AAPr/+v8FAAUAAAAFAPr/9P8AAAUA+v/6//3//f8CAP3/AgACAAIACAD9/wIACwAFAAAABQAAAAAAAAD6/wUACAAIAP3/6//6//r/9P8CAAAAAAD9//3/AgAIAAUABQAAAAAABAAAAAAAAAD6//r/AAAAAAAA+f8AAAAA8f8CAAgABQALAAsAAgACAAIAAgD9//H//f8CAPf/+v/0//r/BQAAAPT/AgAFAPf/9/8CAA4A/f8IABEAAAAAAAAABQAAAAAA+v/6/wsAAAD0/wAAAAD6/wAAAAD6/wUAAAAAAAsABQD6/wAAAAD6//T/AAD9//3/CAAFAAUA+v8FAAUAAAD5/wAABQAAAPr/+v8LAAUAAAAAAAQA/f/9//3/AAAAAPr/AAAAAPT/9/8IAAAAAAAAAPf/CAACAAAAAAAAAAAAAAAAAAAABQAFAAAA+v8AAPr/AAAFAAAA+v8AAPr/+v/9/wIACAD9//3/AgAIAAUABQD6/wUA+v/u/wsAAAAAAAUAAAD6/wAABQAAAPr/+v8FAAUABQAFAP3/+v8FAAIA9v/5/wAAAAD6//r/AAAAAPr/AAAEAPn/9/8IAAUAAAAAAPr/BQALAAAABQD6/wAAAAAAAAAA+v8AAAUAAAAFAAAA+v8AAAAAAAD0/wAACwARAPf/7v8AAAUAAAALAPr/9P8AAAAAAAAAAAAABQAFAAAAAAD6/wAACwAAAPr/AAAAAAUAAAAAAAAA9P/0/wIAAgD9/wIA/f8CAAgABQAAAAUABAAAAAQAAgD6/wAABQD8//3/+f8AAPr/+v8AAPr//f8CAAIAAgAAAPf//f8CAAIACAACAAUABQD6/wUACwAAAPr/AAAAAPr/AAAFAPr/AAALAAAAAAAAAPr/AAD6//T/BQAFAAAA+v/6/wAABQAAAPr/BQD6/wAABQAAAPT/9/8OAAsA+v/6/wsAAAAAAAUABQD9//r/+v/0/wAAAAD5/wQAAAAAAPr/BAAAAPr/BAAFAAQAAAAAAAUA/f8AAPT/+v/6/wAABQAAAPr/+v8CAP3/9/8OAAUAAAAAAAUABQD0/wUABQD6/wAACwAIAP3/9//9//r/+v8AAPr/AAAFAAUA+v8AAAUA+v8FAAUA+v8AAPr/+v8LAAUA7v/6/wUA+v8FAAUAAAD6/wUACwAAAPr/AAAAAAAABQAAAAUA+f/5/wUAAAD6//r/CwAAAPT/BQAAAPn/BQAAAPr/AAAAAAAACwAAAAAABQD6/wAABQD6/wAAAAD6/wAABQAAAAAABQAAAAUAAAAAAAIA+v/6//r/+v8AAAAA+v8FAAUAAAAAAPr/AAAFAPr/BQAAAPT/BQD6/wAAAAAAAAAAAAAAAAUABQD6//r/AAAFAAUABQAAAAAA9P8AAAAA+v8AAAAAAAD6/wAABQAGAAUABQD5//L/AAAFAPn/AAAFAPn/+f8FAAwACQD2//n/AAD5//n/AAAAAPn/BQAFAAUA+f8FAPn/+f8FAAAAAAD5/wUAAAD5/wAABQD5//n/AAD5//b//P8CAAkACQAAAAwABQD5//n/+f8AAAAAAAAAAPn//P8CAAwADAAAAPP/BQAFAAAA+f/z/wAAAAAFAPn/AAALAAYAAAAAAAAABwACAPb/9v/y/wYAAAD5/wwABQDz/wAAAAD5/wAABQD5//n/AAAAAAUADAD5/+z/AgAFAPn//P8JAPz/AgAMAAUAAAAAAAUAAAAAAAAA+f/z//b/AgD8/wIADwAAAAAAAAAAAAAAAAAAAPP//P8JAAwA+f8AAAwABQD5//n/BQD5//P/+f/8//z/AgD8/wkACQD2/wgAEgAAAPL/AAAFAAAACwADAPz/AgACAPX/AgACAPz/8P/z/wwA+f/5/wUAAAD5/wUABQD5//n/+f/5/wIAAgD8//z/AgAJAPz/CQAMAAAAAAAAAAAA+f8FAAAA8/8AAAUABQAAAPn/+f/5/wUABQAAAAAAAAD5/wwADwD2//b/BQD5//n/AAAAAPP/+f/8/wIA/P/8/wkACQD8/wIADAD5//n/DAAFAAAAAAAAAAAAAAAFAAIA/f8CAPb/+f8AAPn/+f8AAPn/AAAAAAAAAAAFAAUA+f/5//n/AAAFAAAA8/8MAAAA+f8AAAAAAAAFAAUAAAAAAAAABQD5/wAABQAAAPP/+f8AAPP//P/8//z/CQACAPz/AgAJAAIAAgAMAPn/BQAMAPP/8/8FAAAAAAAFAAAA+f/5//n/AAD8//b/AgD9//3/DwAIAAUAEgD9//3/AwD8//b/AAD5/+3/AAAMAAUA+f/z/wAAAAAFAAUABQD5//P/BQAMAPn/AAAAAAAABQD5/wUAAAD5//n/BQAAAPP/AAAAAAYABQAFAPn/BQAAAPP/AAAFAAwAAAD5/wAAAADz/wAA+f/8/wIABQD5//z/AgACAAkADAAAAAUAAAAAAAAAAAAFAPP/AAAMAAIA9f8AAAAA+f8AAAAAAAAAAPn/AAAAAAUAAADz/wwADAACAPb/7P/z/wIAAgD2/wIACQACAAwABQAAAAwADwD8//z/AgD8//z/9v8CAPb//P/8//n/+f/5//n/9v8JAAUAAAD5/wIABQAFAAUAAAAFAAAA+f8AAAwAAgD2/+z/BQAMAPn/AAAFAAUA+f/5/wUABQD5//n/BQD5//n/AAD5/wAABgD6/wAAAAD5//3/AwADAAIA/f8CAAIAAgAMAAUAAAAMAAIAAgACAPz/9v/8//z//P/8//n/+f/z//n/AgD2//z/DwD8//b/DwAJAAUAAAAMAAUA8//5/wUABQAAAAAA+f/5/wAA+f8AAAUA+f8FAPn/8/8CAAIAAgD8/wIAAgD8//z/AgACAPz/9v8JAAkA/P8JAAIAAAAAAAUADAAAAAYACQADAP3/9v8CAAMA9v8JAAIA/f/2//D/CQD8/+z/8//5//b/9v/8/wkADwACAPz/CQAMAAUAAAAFAAUA/P/8/wkAAgDw//z/AgACAPz/9v/9/wAAAAD5//P/AAAAAPn//P/8/wIAAgD8//z/AgACAAIAAgACAAIA/P8JAAUAAAAMAAwA/P/5/wkADwD8//b/8P/5/wAAAAD5//n/AAD5//b/9v8JAP3/9v8DAAgACQAIAAUABQAAAPn/AAAAAAUABQAAAPn/DAAJAPb//P/8//z//P/z//P/AAAFAPP/BQAAAPn/BQAAAAAAAAAAAPn/AAD5/wYADAD5//n/BQAAAAAAAAAAAAUABQACAPz//P8CAPz/9v8AAAAABQD8//n/BQDz//P//P8CAAkA+f/8/wIAAgACAAIA/P8CAAkAAAAAAAAABQAGAAYAAAAGAAkA9v/1/wAAAADz/wAADAAAAPn/7P/2/wkAAgD2//z/AgAJAAkAAgAAAAwA+f8AAAwABQAJAPb//P8JAAIAAgD2//b/AgD2//z//P/5/wUA8//5//n//P8CAAkABQAAAAAA+f8AAAUAAAAMAAAA8/8AAAUA+f8FAAwA+f8AAAUAAgD8/wIA9v/5//n/+f8AAAAABQD5/wAAAADz/wMAAwD2//3/AgAIAAIACQAAAAAAAAD5/wUAAAAAAAwABQD5/wAABQAJAPz//P/2//n/BQAAAPn/AAD5//P/AAAAAAAABQD5//n/BQAFAAUA+f/5/wUABQAAAAUABQD5/wAAAAAAAAUAAADz/wAAAAD5/wAA+f/8//b/CQD8//D/AAAFAAIACQAJAAIACQAFAAUAAAAGAAAABgADAP3//f/9//z//P/z/wAAAAAAAAAA+f8AAPn/AAAAAAYAAAAAAAUA8/8FAAUAAAAFAAAABQAJAPD/8/8AAAAAAAAAAAAA+f8FAAYAAAAFAAAA+f8AAAUAAADz//n/AAD5/wIAAgD8/wIAAgD8//z//P8JABIAAAAAAAUA+f8MAAIA/P/8/wIAAgACAPb/8P/5/wAAAAD5//n/AAAAAPH/AwAAAAAA7v/8/wkACAD9/wAAAAAEAPH/+f/9/wAA+P8AAAAABQDr//P//P8JAAUAAAAAAAUA/f/5/wAAAAD4//n/AAD4/wAACAD4/wEA6f8AAAAAAAD4/wUABQD4/wAA/f8AAA0AAQD0//r/9P/o//r/9P/u/+n/CAD5/+v/6v8CAPz/+v8KAAkA+f/6/wUABADp//n//f8LAPr/8v/+//r/AAALAPn/6f8QAPT/BQAYAPH/BADq//z/8v8CAPr/+v/u/wEA8v/8/wkABADs/wIABAACAPr/AQD1//H/BQAFAPz/AgD6/wkAEgDe/wQA+v/2//z/9P/+/+T/8/8CAPz/BAD8/wQA9P8CAAEA6v8JAAEAAAAAAP3/KgD5/wIADAD0//b/5v/8//D/AQABAOD/BQDx/wAA+f8QAPj/8f8AAPb/AgDr/8z/AgDy/wUAAgD8/wQAAQAKABoABAAdANj/DQD8//r/7P/6//z/7v/0//z//P/5//j/BQDz/+H/6f8OAPz/9v/0/wAADwASAAwABwD9//3/5f8FAP3/AgASAPL//P/k//z/8P/4/wAA8f/5//P/DAD8//n/AAAAAPn/+f/e/wkA/P/+/wIA/P/G/wkACQAEAN3/KAAJAAYA8P/+/xcAIQDo/yoAFgDx//n/8P/z/+b/9v/2//H/+P/z//H/7P/z//z/AAAFAOL/GgD9/wwANAD5//H/BwD0/wAAAAD8/+H/CADm//v/DQAAAPD/7f/o/wgA9v8AAPX/HAD0//z/CAAAAPn//P/w//z/+v/x//H/BQACAPT/GgASAAQABwAcAPX/FQDC/+T/CgDs//7/AgD9/97/8v8GAAUAKwDp/+r/9v/4/+3/DwAKAOn/AQDy/+n/CADd/wwA+v/u/wEAIAAYANv/FgD9/+n/+f/Z/y0ACADw/wwAAQD0/+n/AAAAAPj/8//u/wUA0/8IAOH/AAD0/wAACgD6/wgAGAAHAA4A/f/+/wwAAgAJAPX/7v/8/wEA3P8BAA4A9P/5/wsA7f/y/wQA0f8AAAYA+f8CAPr/9f8HAAMABAAFAPX/IgDt//n//P/4//P/4P/+/xYA8//l/wAA+P/y/wAABgAAAOT/FADU/wIA7P8CAAIAAgD6/wwA3P/1/wIA8P8oAMn/IADZ/yAAUADq/xYAGgDh//b/2f/y//r/2f8FAPH/6f/5//n/AAACABYA6P87AOz/JgDm//T/3//3//z/DgDu////8v/y/wQA9P8AABAA7/8aAPX/5f/d/+//7P/y/wYABQACAAEA3/83AOf/6P/8/9P/9//d/93/HAD1//H/KgD6//f///8PAB8A9/8TAP//7P/a////BwDw//j/+P/b//H/EQAJAPb/EwDT/wcABgD3/w8A8v/p/x4A7f/9/0AA2f8NAN////8PAOD/BwDL/yQA0v8BABUA8v/3//X/+/8eAAcA8v8DADgAy/8FAAAA7f8oALn/6v////f/7f8dAAQACADq/xwAAAD4/yQA7P/u/+b/IADg/ykA0f/q//n//v/1//z/+P/s/+7/BQANANX/HwAMAAwAAQAUAMH/NgDo/x4A4f/5/9j/2/8EAO3/EAD+/woA+P8AACkA1P8IABwA0f8AAPD/SQC4/08A0P/t//D/7P8AANj/TADR/xwACQD3//X/+P/8/xoAAQDs//D/FQC+/y4A0/8IAMj/BgD1/zgAyv8QAOv/0f8CABEA8v/M/zwA5f8FABkABADt/yEA6f/r/+j/7P/m//z/BwARAC8A+v/o//r/7P/8/+z/BAD6//7/8/8BAPX/9v8IAOb//P84AJH/HAACAPX/BwAUAM//FAAMAPn/GgAQACgAAQDs/+n/4f/Z//n/yf8zAOb/8v/V/wEA/P8yAAAAUAC1/xYA//8xANX/VwC9/6r/NQDc/w4ANgADANz/5v8AAL7/AgD2/+j/GAD9//b/8P/7//7/CgC9/5gAVf+YAMX/LgDZ/wkA3v9g/4gAjv9hAO//RgAJAPH/NQD8/wEA0f+9/2IAo/9xAJ7/GQDc/9n/w/8sAPT/9P+q/0YA4P8NAAoABADx/zEAUgCY/y0A5/8KAAIATADK//z/AADt/+b/1/+7/wAAEAD2/ycA9f/S/+7//P/g/xgA/P/o/0wAsf85AKn/XgC//x0AMQCK/04Avv8JAPf/MgD9/77/eQD4/woA2/+f/zgA0P9LAML/8v8JAMP/+P/6/ysAFgDi/zYArf8kAPr/3f8LABcAaACp/zsA3//k/xcAGAD8/9H/JAASALj/EADC/zYA3f8YAB0A2P/i/+r/DQDJ//z/JQDw/+v/+P/8/+f/DQDx/wUAEAARAPj//P8vAO7/EQD3//T/KwDW/+z/7P8ZANX/9//4//b/AADX/9//DwD6/00A/P/+/wIAzv/1/wIAJQAGABYA+//M/zAABADQ/+r/AgDn/8L/8f9SAPL/8P8CAPn/8f/4/wUA/P8wAOv/7f8gANP/8/8nAOP/5v/k/+f/6//7//T/+P8TAAEAJQD2/wgACgD9//7/7//o/wYA+f/7//z/8P/m//z//P/L/9//2f9EAPH///8MABoAvf/4/xwAGQAWAP//3v8HAPT/7P/8//P/LAD9/wwA8f8pAO7/+/8HAP//BQDw/w4ABADJ/wcABQAiAN//tf/4/9H/CwDy//b/9v8FACsAy/8lADYAEAAFAPL/IgAAAAcA8f8BAOX/6v/y/+f/9f/l/8j/IgDH/wsAAgAKAPr/IwAoAOn/CAD//xYA4P84APD/5//z/+j/9P/F/wkA9v/2//z/DgDb/wEAEQDp/xoAAwASAP3/+/8fAPL//v/r//3/8v/N//r//v8JAPr/+//8/wUAIwDL/xQA4P82AM7/BQAvAA8A+P/r//n/AQDs/+//+v8PAOT/9f/8//v/9P/y/wMABwAMAAIABQABABkA9//1/+j/8v/o/+v/9f8PAPH/+v8AAPz//P/d/zQA9f/7//b/+P8ZAOn/GwC1/wAA6v8AANT/8//i/wMACgAAABEABAADANn/HQAOAAcAAQAeAO//8/8CAPf/DgDi/+3/5f/9//j/9/8CAPP/9P/7/ycAEwD0////JgD8/xIA9v8CAPT/7//w/w4Ay//y//b/+v8gAMj/CgD7/wcAAQAEAAUA1/8QAPX/BgD5//f/FQDh//H/CgDF/wAA+/8AANf/EQABAP3/DQD+//r/9/8GAAYABgAAAPz/BAAFAPj/+//c/xsAEwDz/xgA6v8YAMf/AwD4/wgABwDW/wkA+/8JAPv//P/5/+7//P/3//H/8//7/9j/DQDk/+3/FAARAAoABQAsAPL/BQAgAPb/8v/2/+H/IQDr//f/0v8IAPb/+f8FAOL/EADz/wsAHQD8/wEA+//Y/yUA+P/Y/wgALADx//L/BQD///P/9//i/wgAAQD9//v/AgD8/xwA/f/2//f/+P8XAOf/8P/P/zQA6//2//n/+P8GAPH//P/y/wgA/f/S////AQAuABMADwDf/8T/CAD3//j/9v/8//P/+/8BAPn/AwAkAAIAAADL/+D/GAALAAgA2f8KAOz/2P8JAPz//P/p/wEAyP8aAAoABQAcABMACwDz/w0ALgAZABAA2/8hAOn/6P8AAO//u/+Z/9r/DQAEAAoAJgBNAA8A2f8oAAkA/f/z//P/5//n//j/IABHABcA4P+r/7X/y/9o/23/Qv9+/0D/Af/x/h3/Lv84/5//NQB/AJAAHQFJAX8B1gHwAecBzgGwAY8BcQHWAFEAyP+F/0H/sP6b/lX+d/42/sX9cv2Q/dL9gv15/WD9kP2r/nL/aAANAggExQQIBrgGEAYMBf4DxwIOAcX/8P6S/hH+Iv4s/kj+5/4H/4H+CP7V/Zr9zfz9+6X7svu1+rj6vvoX+4j81P49AUIDbAVAB9wHbwhbCAMHEQUbAzABOv/E/W/9B/6O/oD/SgDYAIwBwgFCAWgAKP+A/m/9T/wc/AH8V/uj+gb6t/mj+r38bv/mAW0ErQbKB8kHNQflBeADBQIEAH7+af3h/GD9wv4tAFkBKgJKAlkCvgFgAM/+E/1V/Ob7QvvD+7b8p/y0+876+flj+gL8Df8lAv4EnQf7CC8J8Qc0BrMDagG8/xj+iP1r/ej9wf+7AdICLQPLAtUBygCN/+n95fxT/Hv8fvzo+7v8Tv2Y/EX7//k6+Q36rfzoAEgEdAfCCVYKEAkgBgsDTgCU/mz9SP1F/jv/agB8Au8DAARSA/YB3/+4/Z38wvvF+zX8Sv3B/dX9Ev+R/tL8B/tL+QH4t/g2/KIB4QXwCA4LFAvtCAgFNAF+/vH8L/xG/Wb/EAGFAXACegPpApYBPABb/yr+mv2Z/dn9Zv7M/v3+dP7N/rb+Ev2X+9T5aviE+Az7DAFJBt0IlAowCsoHbgP8/sf8gPz1/Jf+fQGnA8ADcAPyAiwCBgAo/rD9tf2z/T7+D/+S/+z+E/5N/YX8BP03/Zj8NPzw+mj5ZPk1/PsCggf0CDAKGgnmBawAGP0s/fj9D/8fAdUDkwRcAxwCMgFgAKP+4/2o/nb/jP91/6n/oP+R/jH92Pyy/Bn9Of7B/k7+Ev3L+lz5EPqT/tUEnAe8CIkIPAY2Amj9NPyY/dv+egCvAskEeQSqAkkBXwBQ/zj+K/4M/xMA/v+7/0L/X/4l/bP8Gf2Y/Wf+UP8T/+P9eftH+fD4aPvCAXMHcgnWCQEI6AQwABH8DPyV/bz/MAKiBLAFHwT1AS0Anv6b/WH9KP54/74AAgFwAGf/7v2Y/Dj87vzS/dP+dv8Z/9r9aPst+fD4MPs/AW4HvgmSCaAHZgQVAD/86vvE/YUA9wKNBPgEoQMuAXz/aP7o/Sf+4f7l/+0A0gAAAOX+fv1g/Dr8DP3v/fn+fv/d/n396frU+Ev5afvwAToIcQqCCtwHFATI/9n7zPu//dAAnAMHBUwFbAOnAND+I/0I/Qr+/f9EAe8BhAHp/8P+aP1y/Gv8g/26/l7/yP9j/ob8V/rs9x74tvqL/vAFcQoAC0sJUAWWASP9TPsC/b//IANUBGkFhQSMAWL/Z/3B/JD9Vf9bAS0CSgLmADn/av3k+6X7ufws/nr/+f/Y/v382/rj+FT5CfuY/ksFmwmDCiEJIQa8AmD+Lvwg/VX/XQK2A/IEbgS9AX3/of3p/Gf98P66ALsBzgGlADD/u/1o/PH7svwa/lf/VP8q/vL82Prb+KP4jvps/BwCSwikCqIJzwbDA58Af/3d/H3+XwFYAyEEpgTvAnMAnf57/YT9kP5IAFoCeAKBAb///f2q/KP7cPzg/U3/9//4/r79H/wD+kL5Sfrk+/b+sgRKCZ4JQgdCBLgBH//1/C79CADmAgoEZwQrBEUC7P8w/oD9j/7Z/zQBKAKAARMATv6A/PD7sPzq/VD/MACB/xr+dPxg+mT5L/qV+xT+LgPMCG4KYwgyBU4CwP9e/Zj87/65AWADDQSVA4ECWgAt/iX94P1m/64AngF/Af3/g/77/B78fvyU/cz+6P/a/3r+7vxT+xj6Dvox+9P8zP9CBbMJywlXB10EeQEA/+78Rv1YAPoCMAQ4BIsDLQLM/6/9QP1v/vH/FAG/AWAB5/8s/nL8+Puj/Iv9xv6w/1j/Lv6i/L/6pfne+Q/7lv1fAlcHGQpDCaAGlQNtAOD9Iv2b/mgBVwPsA7gDugLPAM3+jP1j/Yv+HQB2ARICVQHv/zD+t/xZ/J78o/0H/4f/Av8T/kP8NPpH+Wb5IftQ/5QE7whsCuQI/AW/Apn/bv0o/cj+GwHAApYDsQO5AuAARf8n/uL91P4tAPsA+gA5ACj/zP3T/I38//ze/XT+Wf4G/iD9dvtj+ib6s/pq/coBTwZdCbQJzQfuBNABGf+c/fD9iP8rAYQCfgODA3gCKAG0/8r+pP4U/6z/FAAbAMz/8/4Y/on9RP1n/e39F/6v/T/9Qfz8+or6lfqz+8f+4QJvBnYIagjmBpwE0gF3/2f+z/73/wUBEwLxAgADGALnAK//3/6w/gT/a/+x/8j/iP/t/lf+6P1o/V794f3j/Xr9Jf0h/Dz75vrf+pX8DwDxAwoHNQiYB+kFdwMOARD/bv4//1UAYAFkAg0DCQMfAvgA4P8o/wL/6f4q/2z/gP8L/1P+0f1m/S/9Yf2n/az9fP24/Lb7J/vK+oL7V/7/AagFugfHB8MGzgSVAmsA6/71/rv/jgBBAQYCoQJ8ArEBwQDv/5H/Mv/u/vn+Ef/l/mL+Gv7T/YP9lP2x/Rn+QP7x/RD98Psz+xf7Efwp/6gCiAUlByIHgAb6BNwCnwBE/x7/Y//C/2YAZwEyAkYCwgHtAFYA2v8d/6H+cP6K/mT+GP4g/hz+Bf4H/ir+Rv4x/oH95vyM/Fr8kfyo/VQAEgPlBF4FQwXvBNUDRwLHACAAOQBHAD0AjQAsAYMBmAE9AecAuQBKAKz/Mv/i/rH+UP4L/hT+6P3F/b79Af47/jr+5v2Q/Wb9UP1f/dL9M/9QAfAC3gM4BFsEIAQmAwsCKwHUALAAaQBVAJ0A6AAJAfAAwgCXAF4A3f9H/97+mf5Q/gv+Iv5C/kH+VP5R/m3+VP4V/sr9pP2c/bn9Af6y/hYATwEnAsQCRgOYA4IDCAOMAjMC4gFwAf8AyAC1AKIAlQCGAHkAaQAVAKf/Pf/c/rb+eP5R/lT+QP5I/l3+Wv5d/kn+Af7w/dj98P0k/pX+Zf9WACYB2QFVArwC/gLcArMCdQIwAu4BlwEmAfMAzACZAGoAPwAnAO7/nv9I/w3/8/7A/p7+gf5f/mj+XP5X/lb+af50/kv+Rf5T/mv+kf7W/m//LgDWAFcB6AE1ApQCkgKFAmkCMgL+AbUBUAEUAecAtQCAAEYADQDX/4j/X/8s/wP/3/6+/qn+i/5//on+kP59/oj+o/6I/n7+hP6H/oT+wP4z/9X/aAD3AHsB2AE6AkUCSAI0AhoC6wG4AWoBUAEWAeEAqQBrADcA2P+T/2b/Nv8d//D+0f6//p/+qv6i/rL+rf6s/rf+jf6I/l/+ev5c/mn+GP+7/0UAwABEAbYBLAJYAk0CZgJgAjMC9QGhAXMBKwHJAH4APgDx/6D/av9F/wr/8f69/tL+xv6Y/r7+pv63/rD+qP7I/qf+p/6X/rf+nP6s/mr/2f9EAL4AOwFzAeoBFgIaAkQCHQIWAuoBlgFuASQB0gCbAGEAEgDI/47/TP8U//L+yf7Q/rz+of7B/qv+vP62/rn+3f69/tb+xv7g/tL+2v6L/+3/QQDXAEABlwEDAgsCLAJKAiwCEALgAY0BfAEtAdAAkABXAA8Aw/+U/0j/KP/k/tL+yf6Q/pD+df54/nj+cP6K/nf+hf6M/nD+kv4x/gH/iP/o/4oA+AB3Ae8BDAIuAlkCSgJVAiQC5wHWAaQBHQHfAKAAVQADALr/df9l/yL/5f6s/nz+dP5d/lb+WP50/nD+Vf5j/ln+Zv5t/iX+2v54/+T/ngAqAbQBIwI2AngCeAJsAmkCJALnAdABlQESAboAdQAnAM3/Y/8u/x//DP/I/on+df5p/mb+U/5M/lf+V/4y/jf+P/5e/lf+GP6i/mj/JgD0AIQBLQKwAtAC5ALCAqkCowJRAvoBuQF7AQsBmABXAPb/mP89//j+yf60/nH+V/5M/mb+WP4x/jT+MP4R/gz+6v0H/vr9pP0M/vz+xv+1AFYBLALwAlADWgMuAxkD9wK4AkIC3QGnATwBygCfAFIAAAC0/1X/D//q/pf+WP48/kX+IP4g/ij+G/4k/vz90v2t/Yr9KP10/VD+PP8/ABoBCALjAmkDaANXAzgDHAPYAmACAwLgAXgBAgG6AGAA//+g/zf/6v7E/pX+L/4g/in+AP4W/vH95P3Z/aH9gv1P/QP9ufwr/U7+fv/PACgCMwMGBFIEPQTsA3wDIQO0AigCuAFXAfcAkwBNAOz/o/9d/xj/qf6N/mb+M/5K/kD+Sf5t/jH+Gf7t/Wv9Cv2l/C78/fvg/GD+9v+jAQgDBQSzBMsEdQTzA2gDEgOhAkYCBALHAWwBCQGwAAEAbf8s/7X+UP47/kr+Zf5m/kj+Y/4y/rX9cP38/FX8mPv++qj6KvvX/M7+3gAJA1wELAVxBUoFtAQJBKcDUAMgA+8CeQIkAogBywDj/+D+f/4u/rf9rv0O/rf+7v7j/gz/0P5d/uD9Mv1x/IT75PpJ+oD6cfx+/sIADgOjBJMFowV1BR8FnARmBPYD0AOPA8YCFgJAAUsAJf/9/bv9l/0v/Uv92P3i/k7/Sf+A/zX/j/6V/aT82fur+iX6pvlq+sv8MP+rAaYD5gSUBWcFLAWvBJkEbATIA48D5gLcAdgAzf8y/1L+Vf1T/WT9Sf1x/SP+Y//x/zQAHQC9/yj/EP4B/Qf83/ox+p35fPo7/QgAYgK1A8YETgUtBfIEjQSfBEsEygN0A5oCbAGZAOj/Jf8w/jb9Kf1C/Tv9g/11/vn/ZwCHADwA3/9O/1z+df0K/KT6Zvk/+Sz7D/64AKcC+AP6BD8FGgXeBLQE/wRPBMQDLwP7AeMAGgB1/4n+dP31/BH9FP02/d/9TP9BAGAAVAAHAE3/uP78/Wr90ft4+r75ZPmo+2H+7QDjArcEBAbXBbMFMAUQBcUE4QOrA9sCqQGdAM7///7d/eb8tPzk/Pb8UP1R/rH/cAB9AHIA5v84/5r+0P3y/CL7Mvpv+d75hPwK/zsByAKPBEEFAAXTBN0EEQWTBC8EGQQ3A/wB/QAuABn/y/0G/fj8sPyH/DD9k/6z//L/dACbABsAn/8G/4D+Gv1v+z/6PPkd+oj8J/9pASgDbQT8BOUEBwVvBZcFIAXcBIQESQP3AdAAyf+9/mD91PyO/Cn8Lvwv/aT+QP/s/5wAuAAPAFb/AP8l/rv8Kfvo+Wv58/qL/QMA/AFtA8kE/QQLBfwELQXpBGQEVwSxA3wCXwFoAIv/bf5V/RD9rvxP/LH8s/3L/kj/LwC5AHwAqP8A/43+gv0r/OD6+vk2+vT7bf65ADECngO1BAMFHgUqBZwFJwWbBEsEZAMRArUAof+6/rX92PzI/KL8hPwE/QD+Df+f/zEAdwBRAKr/LP+U/pz9ffxJ+3D6t/pY/H7+mgBNAtMDxATuBN4E0QTkBF0E3QOFA7oCwwGuAO3/BP/7/Wf96PyF/ID8L/0u/vX+of8eAFcA9/+B/wv/L/4N/d377/qF+sz7tf2m/4QBSgO/BB4FSwVUBVsF+ARtBEEEeAN4AiwBHQD2/sz9HP2N/Cj8FPy+/Kj9af5A/+D/bwAvANz/a/+a/mz99Psk+2j6QPv4/N3+4AC6AqUEQwWhBeAFFgaYBdwEzwQhBEwD2gHfAJf/L/5L/Yn8Evyr+x389fyt/Xz+L//0/9X/yv+c/+z+zP1l/JX7nfpO+6r8Sf4AAMMBlwM8BOIEWAW0BU0FwwS0BC4EawMvAkABHgDI/tr9/fxo/O37JvzP/IH9N/74/s7/y//J/7v/Iv8W/tr8IPxM++n7S/2k/h4AowE4A8YDXgTkBDQFEgW3BLoERwSJA3QCgAFgABD/JP5O/an8NPxK/Mj8UP3V/XH+9P73/h//CP+M/r79A/1o/A383/zo/Sf/fQD/AR8DngNdBMwEBwXWBMIEnQQxBH8DfgJ5AUYAHv86/kT9pfxO/GD8j/zb/FP9+f2S/sP+JP8L/6z+5P1g/bj8fvw3/Qn+GP9BAKEBlAJQAwwEqwT7BAQFEAUABZUE9QMHA/cBzwDF/+D+CP5e/fL8uvyq/LD80Pwi/Xj9nv30/Rr+/P2S/T/9AP3f/G79R/4W/xkANgFUAhkD1wOjBAwFJQVNBVYFCwV3BJYDhAJRATgARv9N/pf98fyY/En8IPwq/Fz8sPz1/F79tP3c/bf9o/2Y/aj9Xf4B/+v//QARAgoDmQM/BOsEGAUsBToF9gSQBMcDvAKdAVcAYv+K/tL9Iv24/HX8KPwY/C38gvzO/BD9Y/2Y/YT9Q/1H/VL90f2X/or/uADuAQQDuANcBAkFUQVuBXkFNgXUBBcECAPgAZsAof+5/sz9Ef2K/Dz86PvK+/D7PvyC/ND8Jv1g/Tf9/fzv/Pb8fP1R/mz/qQD0ASIDAQTBBFwFtwXsBfIFjwUPBToEEQP9AcAAo/+5/tz9JP2g/Er8BPzh+w38Zfyz/AD9bf2g/ZH9af1W/Vj9tP1Z/kn/agB/AZ0CeANABOAEQgWPBbIFZwX7BEUERwM7AhEB//8b/0L+f/3r/H/8JvwE/BX8T/yV/OD8NP1w/V79Tv04/S/9gP0Y/u7+/v8sAUUCSgMuBOYEUwWfBcAFiQUTBVcEWANWAi8BEwAi/0n+gP3d/Gn8Ffz7+wf8T/yf/OX8OP2A/Xb9YP1R/Vj9vf1F/g//LABJAVQCSQMbBNIERgWGBasFbAX7BFAEYANYAiYBHwAo/zL+X/26/D/8+vvj+xP8aPy9/C79cP2p/Xn9VP0o/UH9of0t/jv/QAB2AXECawM+BOkEWgWsBckFoQVABY8EpQNwAjQBDQDX/sj95Pwn/Kv7eftu+4X74fs7/KH8/fxW/Uj9Sf02/Yj98f20/qL/sgDhAb8CpgNzBCAFfgW5BdgFrwVDBZoEsgN9AlABLQAD/yH+UP2f/CT8Afzy+/H7Ffxe/K/85PwI/ST9Ff0b/Zb9IP7r/t3/EAEfAgAD1wONBAcFSAV+BVAFBQV1BKgDmAKBAXAAWv9T/or99fxJ/PH73fv4+xT8ZvzC/CL9ef2Z/bH9pP3o/Vb+3v6g/28AXAEjAucCnAM2BJYE5QT7BNgEiQTxAzEDIAIcAQoACv8o/nD90vxd/DH8I/xE/Hj80vwr/W39oP3E/c396v07/rn+Z/8tAAMB4AGhAj8DwwMjBG8EjwR5BFQE5gNIA3MCfAGBAJL/pf7l/VT90PyI/Hf8fvyb/Nv8Kv1w/av91f3j/dv9If6H/gz/0P+nAHABLALIAk4DugMBBCkEQAQXBNEDagPVAggCHgFQAHr/rv4P/oz9GP3I/LP8t/zF/Ov8Mf1z/ar92P0D/hH+PP6w/jL/4P+iAFgBEwKeAhsDhAPFA+UD4wO0A2MD4gI/AoIBpQDc/yD/d/4G/pj9Tv0o/Sv9R/1Z/XP9oP3Q/eH9Af4e/j7+iP7z/oj/IgDUAI8BFQKMAvECTwOMA58DlwNlAwADgALdASABVACZ//H+Vv7n/Yn9UP0o/Sj9Q/1o/Zr9x/36/TX+ZP6K/r7+If+V/xUAqABAAb0BKQKDAs8CDgMiAy0DHgPnApACGQJ5AcsAHQCL/wL/gv4h/tn9lf13/X39iP2m/c39Bf4v/ln+g/6s/gr/cf/Z/2UA6QBeAb8BCAJGAnwCoQKvAqQCgAJUAvABbgHeAFgA3P9a/+T+iP5A/gH+1f2q/bb9vf3I/fn9Ov5m/pv+2P4Q/1P/qf8HAHAA3QA/Aa8B6AEYAkUCYQJoAlkCVQIhAtMBaQH5AIIA+/+X/zb/3f6Q/kz+Iv7w/fL95P30/SH+Lf5K/m3+o/7e/i7/mf8TAJIADQFqAbgBAAIvAj8CRAJOAj8CAwK7AVUB7ABtAOn/gP8S/7T+Yv4e/tj9yf2w/bL90f0H/kH+if7G/gX/TP+s/wwAagDcAEEBjAG9AekBJwItAiICIQIQAuMBnQE/AeIAdwAKAKf/Tf/4/rb+cP41/iD+Hf4j/kP+cP6U/sD+5/4k/17/l//V/ygAkADVAAMBOQFbAWoBdAFwAWoBVQE4ARkB7QDHAIYAPAACALn/gf9E/yL/8/7F/rn+tP7A/tD+7f4O/zb/V/+I/7T/yv/5/xoASgB5AJcAvwDoAAUBBAEMAQQB6QDAAMAAkwDAAHEAMQD2/5X/Qv/j/sf+q/7T/uP+6f4G/03/gP+i/83/BwA3AFgAfQCqAJ8ApQCwAL0AgABqAFgASwAfAAUAAgAVAAwAAgD0//z/BQDs/+X/0f/A/7L/nf+Z/6r/mP+d/6//wf/H/9r/8f8dADAAPABGAGQAZwBZAE4AWABPAEoAMQAOABAA+v/r/9n/0f+7/8j/uv+//8P/zf/Y/+D/5P/n/+3/5//w/+7/7//0//D/BAD8/wEACAAYACgAIAAaABkALAAgABgAFwAVAPf/8//k/9D/0v+5/67/qv+l/7v/z//S/+H/8/8RAB0AGgAxAEcAQgA/AEgARQBFADIAKgARAOf/3v/R/8f/vf+2/8D/xv/O/9r/6//5//D/+f8AAPz/AAARABYAHAAPAAoAAwABAA0ADQAJAAYAHwARAAcAGQAQAAMABQAIAP3/9v/l/+n/9//o/+P/8P/3//n/8v/z//z//v8AAAEAAgABAAgAAwAQAAkACQANABAACgANAPD/9f/7//b/+f/f/+X/6//m/+f/7v/v/+n/8P/y//r/8//4/wMAAAAGAAYA/f8NAP7/BQD2//H/9f/w/+f/9f/2/wQA/v///wwAFQAaABwAFwAYABEACAAEAAUA+P/o/+n/6P/f/+D/6f/y/+X/7P/v//H/8P/+/wMAAQAHAAgAEAAMAA0ABQD9/wAAAAD3//j/6//y//T/9P/5/xUA6P/1//v/9P/t//n/BAAWABEA6P8TAAwA6/8XAPL/7P/a/w4A8v/1//3/+//1/+n/FQDC/wsA8//9/wUA/////yMABQDQ/w0A/f8HACgA8f/W//v/+//6//n//P/+//b/9v8CAAcAAQDY/xQABgD//yYA0P///xwA+/8UAO7/AQDw/yAA7v/+/wcA+P8DAPv/+P8PAPH/1f8JAN3/5f8QAP//2P8DAAcAJwD2//z/AwD7/wAA1P8NAP7//P8BAAQAAQD4/wMA///7//j/IwD2/wEA8//U/wIA+P/Y/wEABQD0/9T/FAACAAYABQABAAMA+//8//L/AgApAPT/+f/z//v/+P/9/wIA+/8bAOj//P/e/+P/5v8NAAYA///Z/woACQAcAPf/9//2/xcA1v/n/xAA/v8BAAgAKgDv/9z/CwD///H/7/8AAP//HgDt/x4A/v/6//v/+v/4/8//LgDm//T/9P/3//j/zP8DAPP/AAD4/wAA/P/4/wIAFgD2/9j/MwDx/9L/BAAlAO3/yf8MAPr/AAAAAOL/CADx//n/AAACABgA9f8FAPj//P/7/ycA9v/S/wQA9v8YAO7/IgDz//z/+v/y//X/8/8AAO//1P/9////2P/9/wIA2f/Y/ykA/P/Y/xEAAQD6/+T/EgABAAAAAQD7/wUA3v8VAAcAAQD//wAAAAACAAgA+////wEAAgADANv/BgD8//v/HgACAAUA3P8HAP//+P/9/wMA/P/x/wgAAwABAAAABAAIAPv/BAD8/x4A6v/8//T/AAD0/9L/5P/U/9f/9v/+/wMAJQDd/zAAAwAKAAIAAgAAABgA0//5//j/8v8jAPT/IwDD/wcAvv8KAAsA+/8uAOz/NQDY////9P/v/9j/AgAjAPD/BgDz//T/7f8GAP7/8f8eAOj/AgD6//7/+f/4/ysA7P/+//z/AQDy//H//v/p/wAA0P8FAPf/+P8AANX/EAAaAPX/JQD5//j/7P/9//n/+/8LAPr/+v8CAAEA2/8jAOn/FgDt/9X/+/8LAPj/9/8EAPD/IgDQ/wQA/P8BAOH/DQAcAOn/MADj//P/6f/5//7/+v8FAPj/LgDp//3/+v8TAOn/+v/3/wsA8f/7//D/9//7/+7/2/8mAOn/BADx/+//+v/P/xAAzv8YAAUA6P8LAAIADgD1/+j/3f8CAAAAAAAaANT/AAAhAPj/CAABAPf/7//Z/xAA+/8FAAoACAAAAPv//f8XAPD/AQD0/9X/BwAbAAEAHwDw//n/9v8BAPj/AgDQ/wYA9/8DANv/DgD1//n/AAAAAAgA9/8CAP/////N/+j/RADw//3/CADZ/93/CgAIAAAACwAHANX/MADy//j/9f/W/wgAAAAIAAEA5v8FAAgADgABAAsA8v8DAAcA/v8HACIA5//6//n/+P8dAPH/HADj//n/7P/z/yEA5P8FAO7/KADt/xkA6P/y/xwA3f8bAOL/+v/g//X/8f/w//r/FgDp/77/BAD3/9H/CQAsAPb/+v/+//z/+v/7/ygA4f/M/wQA/P/7/wAAAgDz/xcA8//2//D/9v8kAL3/BQAeAPn/+v8kAOr/9v8AAL3/CAALANz/BgAAAAAABgAGAAAA/P/5//X////9//b/AADQ/xEAAQD//wEABQADANb/PgDm//v/zf83APL/JAAUAOj/9//j/wAA9v/7/ycA6P8IACIA4//F/z4A7f/2/wIABwC8/w8ABQAkAPD/BwAeANP/LADb/+j/HQDy/+3/7f/1//b/w/8JAAAA/P8AAAkA+//u/wgA+v/s/wIA/P/5//v/KgDl/8f/BgAoAOj/9f/R/wQA8f8GAAkABgAwAOD/0P8FAPT/+P88AO3/vP8VAP//9////9f/CgAmAPr/AwD8//T/8P8DADoA2P/8/8//CQDz/wcADADH/yMAAADM/00A6/8BAMb/GAD2/wQADQD0/wkACQAHAPX/9f/Q/+D/CwAhAPv/EQAAAP//yP8UAAgA+P8GAAsACAD9////+P8sALL/BADL/xUA///T/yAABgDc/xYAAgDS/wsAQwDm//j/BQADAPP//v8GAPz/BQACAMj/EAAzALr/GAD+//n/8v8UAP7/9P/6/8D/PAAoAP3/AQADAPH/8//+//7/8P/v//j/+v/5//f/9v8yALP/DgD2//H/AwBBAK3/zP84APD/AQA/APL/4/8DAO7/+f8AAPX/5/8vAPL/8/8AAO7/8v/8/8r/8//u/wIAxf8LAO7/wf8LANb/CADF/xwA/v8PAA0ACQAKAND/GAAMAAkAOQASAAQAxf/k/wgAAQANAAoA9f///z0ACwAKAP3/AAD8/w4A/f/6////9f/4//3/AgAEAAQAAgD///7/OADz/8j///+4/zMA+/8GAOL/CQD7////BgAyAPv/9v8wALb/v/88APD/GgD4/wQA1//A/wYAwP/8/7X/EADn/xQA/v/G/xEA/f8aAD0AAgA8AAAA+f+//xoA5/8AAPv/8//z//j///86APv/+P/9/zgA9f8AAPb/4f/r//r//f/0/z8A7//7/67/AgCj/yEARwCv/97/EwDo/w4AHgA/ANn/RADa//L/4f/0/ysAof8TAOf//f/4/w4A9f8CAPz/8//5/wQA+v/7/7L/FQC5/1sAQAACAEEAGwB6/8H/+//Q/wgAGwACAPT/CwD7//7//v/x/zwA4v8BAPb/9//t//b/BQD7//7/AAD9/wAAAABIAOT//v/8/+//5f////j/8/8AAK7/AQC6/x8ABwAUAA0ASQAoAO3/AADc/+D//v88AB8A9////+D/2P/w/8P/CACv/x8ACABPAPb/EAAxALv/8P8AAOT/3//F/xIA+v8TAND/FwD6/wkAFAAPAPH/AgC6/wkAAAAEABIABADy/wEABAAEAAAA/v/2/7v/FAD//8z/5f8XAEAACwBmAOL/+P+p/8T/9f8NAAcABQAOAPv/EAAfABMAGgAKAAAABAD//wkA9P8AAPX/7P/4//X/+v/w//v/+P/s//L/+P/3//H/+P/q/+3/+//0/+n/+P/y//D/8v/4//z/9P/8//T/9f/4//3//f/w/wQAAQACAP3/AAACAAAAAgAAAP3/8/8JAAAA9P8DAAAA/f/8/wkAAAD0/wAAAgAAAAUAAAD9//j/BAALAPz/+v8AAP3//P/z//n/+P/7//D/7/8DAPf/+P/6//X//v/v/+v/AQDx//H/+//r//T/AAD9//L/9f/7//r/9//8/wMA8v/s//7/AgAAAAAA/P8AAAUA/P/9/wMA/f8AAP3/+f8LAAsA+f8AAP7/9P8AAPz///8BAPz/AgADAP3//f8JAPz/BwAKAP//AAD6/wYAAAAAAP////8LAPz/+v/0/wYA+f8AAAUAAAACAAAAAAD6/wAAAAAAAPr/+f8AAAAA/P8CAAIA/P8CAAEA8f/6//3/+P/4//j//f/4//3/AADu//j/+v/1/+7/+P/4//j/8f/9//j/+P/y//L/8v/0//r/+f/9//j/+P8AAAUABQD//wsA/P/9//3/AwD2/wAAAADz/wAAAAD5//r/9//9/wgACAD8/wIACQAMAPn/BgAAAP//BQAFAP3/7f8AAAUAAAAAAAUABAAAAAAAAAD6//n/BQAFAAAA+f8GAAAA+f8FAAUA+f8AAAAAAAAFAPr/+v/6/wYABQAAAAUAAAAAAAAAAAAAAPr/AAAFAP//AAAAAAAA8/8AAAAABQD//wUABQAAAAAA+v8AAAAABQD5/wAAAAAAAPn/AAAFAPn/AAD5/wAAAAD5/wIABQAFAAAAAAAFAAAAAAD5//r/CwAAAAAACwACAPz/9/8AAAAAAAAAAAAAAAAAAPn/AAD6//P//P8IAAIA/f/9/wkABQAAAPb/CQAFAPn/BQAFAAAAAAAFAAAA+f/5/wUABQD5//n/BQAMAPn/+v/6/wAA+f8AAAYA8//9/wIADAD5/wAABQD5/wAA+f8FAAUAAAAGAAAAAAAMAPz/8/8AAPr/+f8FAP//CwACAPn/+v8AAAQAAAAFAAAA8/8AAAAAAAAAAPL//f/9/wIA/P8CABUADAAAAAAABgACAPz/AgACAO//AgAJAPb/9v8AAAAA+f/5/wAA+v/2/wIAAgD8/wkABQAAAAUABQAAAPr/+f8FAAUA+f8AAPn/BgAAAAAAAAAFAAUAAAAFAP3/AgD9//z//P8CAPz/9v8AAPn/+f8AAAAA+f8AAPn//f8CAAgA/P8DAAUAAAAFAAUAAAAAAAAABQAAAPn/+f8FAAwA/P/z/wYABgDz//n/DAAAAPn/AAAAAAAA+f/5/wAABQAFAAAA+f8AAAAA+f8AAPn/AgAFAAAABgD6//n/DAAMAAAA+f8AAAYA+f/z/wwABQDz//P/AAAAAAAAAAAAAPn/AgAFAAAA+f/9//z/CAAFAAAA+f8AAAYA+f8FAAsABQD5/wUAAwADAPb/9v8DAPz//P/5//n/AAAAAAUAAAD5/wAA+f/5//z/CQAFAAAAAAAAAAAABgAFAPn/AAAFAAUAAAAAAAAAAgACAP3//f/9//n/AAAFAAAA8/8AAPn/8//9/wIAAgACAAIAAgD9/wIACQAAAAAABQAFAAUABQACAP3//f/9//n/AAAAAAAAAAAAAPn/AAAFAAAAAAAAAAAA+f8AAAAA+v8FAAAAAAAAAPr/+f8AAAAAAAAAAAAADAAAAPn/BQAAAAAABQAAAAAABQACAP3/8//z//n/AAD8//b//P8JAAkABQAFAAAABQAFAAAABQACAPb/AAAJAPz//P/2//n/AAD5/wAAAAAAAAAAAAAAAAwAAADz/wUAAADz//n/AgAFAAAA+f/9/wIAAgACAAIA/P8CAAIAAgAFAPn/AAAFAAAA+f8AAAAABgAAAPn/CwAFAAAA+f8AAAAAAAAAAPn/+f/5/wUAAAD5//n//P/8/wkAAgACAAUAAADz//b/DwAMAAAABQAFAAAA+f/5//n/BQD5//P/DADz//b/CQD8//z//f/8/wIAAgAJAAIAAgACAPz/AgAJAAAAAAAFAAAA+f8FAAUA+f/5//n/BQAFAAAA+f/5/wYABQAAAAUA+f/6//n/8/8FAAAA9v8IAAAAAAD5//z/CQAAAPz/AgAFAAUAAAAFAAUAAAACAAIACQACAPD//P8CAPb/8/8AAAUA8//z/wAAAAD8/wIA9v/8/wkACQD8/wkABgAFAAwA+f/5/wAABQAAAPn/AAAFAAwA/P/5/wAABgD8//P/+f8FAAUA+f8AAAAAAAD5/wAA8/8CAAIA/P8IAP3/AgACAAMA/f8CAAcAAAD5//z/AgACAAIAAgD8/wIAAgD8/wkAAAD5//z/AgAJAAUA+f8FAAwAAgD8//n/BQD5/wAABQD8//P/+f8FAPn/+f8AAPn/9v8CAAkAAgACAPz//P8JAAwAAADz/wwADAAAAAAAAgAJAP3/9v/8//b/AAAFAPz//P/z//n/AAAAAAUAAAAAAAAA+f8AAAAAAAALAPP/8v8LAAAAAAAAAAUAAAAFAPn/AAAAAAUABQAAAAAA+f8FAAAAAAAFAPz/8//5//n/BgAAAPn/BQAFAAUA+f8AAAUAAAAAAAAAAAAAAAAABQD5/wAADAACAAIA/P/8//z//P/8//z/+f8AAAAAAAAAAPn/+f8AAPn/AAAAAAUABQAAAAAABQAFAAAA+f/5/wAA+f/5/wwAAAAAAAwABQDz/wAABQAAAAAAAAAAAPP/8v8CAAsAAAD5/wUAAAAAAAAADAD5//n/AAD5/wUABQD5/wAAAAAAAAAABQAAAPn/+f8AAAAAAAAFAAAABQD5/wAAAAAAAAAAAAD5/wAAAAD5/wUAAAAAAAAAAAD5/wAAAAAAAAUA+f8AAAUAAAAAAAwAAAACAPz/AgD8//D/+f/5//n/AAAAAAAADAAAAAAAAAAAAAUA+v/5/wYABQAAAAAABgAAAPL/AAAFAAwA+f/5/wUABQD5//n/BQAAAAAABQAAAAUA/P/5/wAABgAAAPn/EgACAPD/8//5/wUA+f/5/wAAAAD8/wIA/P8CAA8ABQAAAAAABQAMAAIA9v/8/wIA/P/z/wAAAAD5//n/AAAAAPn//P/8//z/AgACAAkAAgD8/wIAAgACAAUAAAAAAAYA+v8LAAAAAAAAAAUAAAD6/wYACQD8//b/+f/5/wAAAAD5//P/AgACAAIA/P8CAPz/9v8JAAkABQAAAAUABQAAAAUABQACAPz/AgACAPb/9v/8/+z/BQAFAPn/+f8AAAAA8/8FAAUA8//8/wkABQAFAPn/AAAAAAUA+f8AAAUAAAD5//n/9v8CAAIA/P8JAAIABQD5//z/AgAFAAYAAAAAAAAACwADAAIA/f/2//z//P/5/wAAAADz//n/AAD8/wUA+f/2/wIACQAFAPn/BQAAAAUAAAAFAAUAAAAAAAAABQACAPb/8/8MAAIA/P8CAPb/+f8AAAAA8//5/wAAAAD5/wIABQD5//z/CQAMAPn/+f8FAAwABQAAAAIAAgD9//b/AgACAPz/9v/5/wAAAAAAAPP/8//8/wkA/P8CAAIA/f/8/wMACQACAAIABQAFAAUADADz/wAAAAAFAAkA/P/8/wIACQD2//z/9v/2//n/AAD5/+z//P8PAPz/8P/8/wkAAgD8/wkACQAMAAwABQD8//z/AgD2/wAAAgACAPz/9v8JAAkA/P/2//z/9v/5/wUAAAD5//P/AAAFAPP//P/8/wkA/P8JAAwA8/8GAAwA+f8FAAUAAADs/wAABQD5/wAAAAAGAPn/8//9//3/CAACAP3/AgACAAIAAgAFAPb/9v8JAAkABQAFAAAA+f8FAAAA8/8AAPn/AAAAAAAA+f8CAAUAAADz/wIABQAFAAAAAAAAAPn/AAAMAPn/+f8MAAAA+f8AAAAA+f/z/wIAAAD8/wIAAgD8/wIACQAAAAUAAAAFAAAAAAAFAA8ACQD8//b/8P8CAPz/9v8CAAIAAgD2//L/+f8AAAUAAAD6//n/AAAGAAAAAAAAAPn/+f/8/wkAAAAAAAAABQAMAAAA+f8AAAUAAAD5/wAADAAAAPn/AAAAAAUAAAD5/wAAAAAAAAAA+f8AAPP//P8CAPz/AgACAAIACQAMAAAA+f8AAAAAAAAAABIA+f/5/wAAAAAAAAAABQD5/wUAAAD5/wUAAAAAAAAAAADz//n/BQD5/wAA+f/8/wgABQDz//b/AwAPAAAA9v8CAPz/AgAJAPz/AgAJAPn/BQAAAAAADAD5/wUAAAD5/wAABQD5//P/AAAAAAUAAADz/wAA/P/8/wkA/P8CAAUAAAAFAPn/+f8FAAAABQAAAAUABQD8//z/+f8AAAwA/P/2/wAABQD8/wIAAgD2//z//P/8//n/8//5/wUAAAD5/wwABQAAAAAA+f8AAAAABQAAAAAAAAAAAAAAAAAAAAAABQD5/wwAAAD5/wUAAAD5//n/AAD5//b//P8CAAIACQAFAAUAAAAAAAAAAAAAAAAABQD5/wAABQAAAPn/AAAFAAUAAgD5//P/+f8AAAUA8//2//b/AgAJAAIA/P8JAAwAAAAAAPn/BQAFAAAAAAD5/wUABQAAAAAA8//5//P/AgAJAPn/AgAFAAwABQDz/wAACwAAAPn/+f8AAAAA8v/9/wkA+f8CAP3/AgAMAAAAAAAAAAAABQAAAAUA+f/5/wAAAAAFAAAADAD5//P/BQAAAAAAAAD5//n/BQDz//z//P8CAA8AAAAAAPn/9v8CAA8ABQDz/wAADAAMAAAAAAAAAAAAAAAAAAAAAAD5//n/BQAAAPP/AAAAAAAAAAD5/wAAAAAAAAAA9v8CAAkAAAAFAAAA+v8AAAAAAAAAAAAABgAAAAAAAAAAAAAA+f8AAAAAAAAAAAUABQAAAAAA+f8AAAUA+f/5//n/AAD5//z/AgACAAIAAgACAAUAAAD5/wUADAAAAPn/AAAFAAAA+f8AAAUAAADz//n/BQAFAPn/AAAFAAUA+f/5/wUABQD5//P/BQAFAPn/AAAAAAAABQAAAAAABQD5/wAABQAAAAYA+v8AAAUAAAAAAAAABQACAPb/+f/5//n/AAAAAAAA8/8CAAkAAAAFAAUAAAAFAAAAAAD5//n/BQAAAAAA+f8AAAAAAAAAAAAAAAD5/wUADAAFAAIA/P/8/wkA/P/2//b/AAD5//n/+f8AAAAA9v8CAAIA/P/8/wkADAAFAAAAAAAFAAUAAgD2/wUAAgD2/wIA9v8AAAUA8//5//n/7//9/w8AAwD2//3/BwAJAAMA/P8CAAIABQAAAPn/AAAFAAUABQAAAAUAAAD5//n/AAAFAPn/AAAAAAAAAAAAAPn/AAAAAPn/BQAFAPn/AAD5/wAABQAAAPn/AAAAAPP//P8CAPz//P8JAAIACQAAAAAABQAAAAUAAAAFAAkA8P/z/wAAAAAAAAAAAAD5//P/9v/8/wkA/P8JAAkAAAD8/wIA/f/8/wgABQAGAPn/AAAGAAUAAAAFAAAAAAAAAPn/+f8AAAAAAAAFAPn/8/8FAPn/+f8FAPn//P8JAPz/AgACAAUAAAAFAAAAAAAFAAAADAD2/wAAAAAAAAAAAAAFAPz/+f8AAPn/+f8AAPn/AAAAAAAA+f8FAAwAAAAFAAAAAAAAAAAAAAD5//n/AAD5//n/AgACAAUABQD5//n/BQAFAAYAAAAAAPL/BgAGAPr/AAD6//n/AAAAAAAA+f8AAAAAAAAFAAUA+f8AAAAAAAAMAAUA+f8FAAIA/P/2//n/AAD5/wUABQAFAPP/AAAFAPn/BQAAAPP/AAAAAAAA8//8/wIA/P8CAPz/AgAJAAIACQAAAAUABQAAAAAADAACAPb/+f8AAAUAAADz//n/AAD5//n/BQAFAAAA8//8/wIA/f8PAAAAAAAFAAAA+f8AAAUAAAAAAPP/AAAMAPn/+f/5/wUABQAFAPn/+f/5/wAABQAAAAAAAAAAAPn/BQAFAAAAAAAAAAUAAAAAAAUA+f8AAAAA+f8AAAAA+f8FAAAAAAAAAAUAAAD5//n/BQAAAPn/DAAAAAAAAAD5/wwAAADz/wAAAAD5//b//P8JAPz//P/8//z/CQD8/wIA/P8IAAkAAgAFAAAAAAAAAAYABQAFAPz/AgD9//b/AAAAAAAA+f/5/wAA+f/z/wIAAgD8/wkA9v/9/wkACQAFAPn/AAD5/wwA+f8AAAwA+f/5/wAA+f8FAAAA+f8FAAAADAAAAAAAAAAAAAAA+f/5/wAA+f/5/wUA8//2/wkAAgAJAAAA+f8CAAwAAAD5/wAAAAAAAAUAAAD5/wAABgAAAPn/AAAFAAAABQAFAPr/+f8GAPr/AAAAAPP/+f8FAPn/9v8JAAUA+f/8/wkABQD5/wAA+f8FAAUA+f8AAAYAAAAFAAUA+f8AAPn/+f8GAAAAAAD5//n/AAAAAAUA+f8AAAUABQD5//n/AAAFAAAAAAAAAPn/BQD5//n/AAAMAAAAAAAAAPn/AAAFAAwA/P/8//n/+f8MAPn/+f8AAPn/AAD5/wAABQAAAPL//P8JAAAA/f8DAAUA+v8CAAUAAAAFAAAABgAAAAUAAAAAAAkAAgD2//b/AAAPAP3/5v8AAAAA+f/z//z/AgACAAIAAgACAPz/CQAAAP3/BQAAAAAABQAFAAUAAAAAAAAAAAD5//n/+f/5/wUADAAAAPn/AAAFAPn/+f8FAAUAAAD5//n/BQAAAAAAAAD5//n/AAD5//b/CQAIAPX/AgACAAMACQAAAAYABQAGAPr/AAALAPz/AgD2/wIACQD2//D/AAAFAAAA8//z/wAAAAAAAPb/9v8JAAkAAgACAAIAAAD8/wkABQAFAAAAAAASAPz/9v8AAAAAAgD2//n/AAD5/wAAAADz//z/CQAAAPz//P/8/wIAAgACAAIACQAAAAwABQAAAAAA+f8AAAwAAgD2/wAAAgD2/wAA+f8AAAYA+v/5/wAAAADz/wMAAwAFAPn/AAAAAAAAAAD5/wUAAAD5//z/DAASAAIA9v8AAAkAAgD2//b/AAD5/wAAAAD5/wAABQAAAPn/AAAMAPn/8/8FAAAAAAAAAAAABQAFAAAABgAAAAAAAAD5/wAA+f/5/wUABgAMAPP/+f8AAAYA+f8AAAwA+f8AAPn/8/8CAAwA+f/5/wUA+f8AAAAAAAAFAAAABgAFAPn/+f8GAAUAAAAGAAMA9v/5/wAAAAD5/wAAAAAGAPn/AAAGAPn/DAD5//r/AAD5//n/BgAAAPn//f8JAAUA+P8AAAYA+f/y/wIADQAFAPL/DAAGAAAAAAAGAP3/AAACAPz//f/5/wAABQAAAAAAAAAAAPn/BQAAAPP/BQAAAAAA+f/y//z/CQAFAPn/AAAAAAAABQAAAAAAAAAFAAAA+f8AAAsABQD5//r/AAAAAPn/8/8CAAUAEgAAAPn/DAACAPz/9v/5/wAABQD5//n/+f/5/wAA/P8MAAAA+f8FAAAAAAAFAAAAAAAAAAAABQAAAPn/AAAAAAAAAAD5//P/AgAFAPn/AAAAAPz/AgACAAIA/P8CAAwA+f/5/wUAAAAAAAAAAAD5/wAAAAAAAAwA+f/5/wUAAAAAAAAAAAALAAMA7P/5/wAABQAAAPn/AAAAAAAAAAAAAPn/BQAAAAAABQAFAAUA+f/5/wAAAAAAAAUAAAAAAAAA+f8AAAAAAAAFAPP/+f8FAPP/9v8CAAkAAgACAAIAAgAFAAAAAAAAAAAABQAFAAAA+f8MAAIA9v8AAAIAAgDw/wAAAAAMAAIA8P/5/wAABQD5//P/BQAFAPP/AAAFAPn/+f8CAAsAAADy//3/BwALAAYA8v/5/wAABQAFAAAAAAAAAAUAAADs/wAABQD5//n/9v8CAAkA/P/8/wIACQD8//b/AgAPAAAA/P8JAAUABQAFAAAAAAAAAAAABQACAPz/8/8AAAUAAAD5/wAAAAD5//n/AAAFAAAA+f/5//D/AgACAA8ABQD5//n/AgACAAAABgD5/wAADAD5/wAAAAAAAAAABgAAAAAA+v/5/wUAAAAAAPr/BgAFAAAAAAD5/wAAAADz/wAAAAD2//z/CQACAPz/CQAAAAAADAAAAPn/BQAAAAAABgAAAAUA/P/5//n/BQAGAPn/AAD5//n/BQAAAPP/AAAAAAAAAAD5//z//P/8/wkACQAFAAUA+f8AAAwAAAAAAAAADAACAPz/9v/8//z/8/8AAPn/AAAAAPn/AAAFAAAA+v8FAAAA+f8AAAAAAAAFAAYAAAAAAAUAAgD8//z//P8CAPz/9v8AAAAA+f/5/wAABQD5//n/BQAFAPn/+f8FAPn/AAAFAPn/AAAMAAUABQACAPz/AgD2//z//P/5/wUACQACAAIA8P/z/wAA+f/5/wAABQDz//z/AgACAAIAAgAFAAAAAAAFAAUAAAAMAPn/BQD8//n/BQD5//n/AAAAAAAA+f/y//3//f8DAPz//P8PAAsAAAAAAAAABQAAAAAABQAAAAUACQD8//b/+f/5/wUAAAAAAPP/8/8FAPn/9v8CAAkABQAAAAAAAAAFABIA/P/5/wAABQD5//P/AAAMAPn/+f8FAPP/9v8CAAIA/P8CAAkABQAAAAUAAAD5/wAAAAAFAAAABQAFAPn/DAAJAPz/AgACAPb//P8CAPX/7P8AAPn/8v8GAPn//f8IAAAABgD5//z/AgACAAIABQAAAPn/DAAAAPn/AAAFAAwA+f8AAAAAAAAFAAkAAgD2//z//P8CAAkA/P/8//D/8/8MAAAA+f/5//P//P8CAAIA/P/8/wkAAgD8/wIAAgACAAIACQAGAPn/DAAMAPn/AAAFAPn/+f8AAAAAAADz/wAAAAD5/wIAAAAAAAAAAAAFAAAA+v8AAPr/AAD9/wMABgAAAAwABQAAAPn/BgD5//n/8//8/wIAAgACAAUADAAAAAUABQD5/wAABQACAPb/AAACAPb/8/8AAAAA+f/5//z//P8JAAUAAAAFAAAAAAAFAAAABQAAAAAA+f/5/wUAAADz/wUAAAAAAAAA8/8FAAUABgAAAPP/AAAFAAAA+f8AAAUAAAAFAAUAAAAAAPn/BQD5/wAA+f8AAAAAAAD6/wAACwAAAPn/+f8MAAAAAAAAAAAAAAAAAAYA+f8AAPn/BgAFAAAA+f/5/wAAAAAFAPn/AAAFAAUA8/8FAAUA+f8FAAAAAAAAAAwA/P8CAPb/AAAJAPb/AgD8//b/+f8AAPn/8/8FAAAA8P8CAAIACQACAPb/AgACAAkAAgAFAAUAAAAFAAUAAAAAAAkA9v/5/wAAAAD6//n/AAD5/wAABQAAAAAA+f/5/wUABQD5/wAAAAD5/wwABQAAAAUACQD8//z/AgAJAAIA9v/2//b//P/5//P/BQAFAPn/+f/5/wUABQD5//n/AAAAAAUAAAAAAAAA+f8FAAAA8/8CAAUA+f/2/wIAAgAJAAUA+f/8/wIADAAAAAAA+f8AAAUA+f8AAAAA8/8CAAAABQAAAAAABQAAAAAA+v/5/wAABgAAAAAAAAAAAAYAAAD5/wAAAAAAAAUABQAJAP3/9v/8/wIAAgD2//P/AAAFAAUAAAD5//n/+f/5/wUAAAAAAAUAAAD5//n/AAD8/wIABQAFAAUADAD8//n/AAAGAAIA/P/2//n/+f8AAAAABQD5//n/AAAAAAwAAAAAAAAAAAAFAPP/AAAMAPn/8/8FAAUAAAD5//L/AgAGAAAA+f8FAAYAAAAAAAYAAAAAAAUAAAD5//n/+f/5/wAABQAAAPn/+f/2/wkAAgD2//z/AgACAAIA/P8JAAIAAgAJAAUADAAAAAAA+f8AAAAA+f8AAAUA+f/5/wAA8/8CAAUABQAAAAAA+f/5/wUABQDz/wYADAAAAAUA+f8AAAUA+f/5/wAAAAAFAAAAAAAFAPn/AAAAAPn/+f8FAAAAAAAFAPn/BQAAAAAA+v/5/wAAAAD5/wUADADz//P/CQAAAPb/9v8CAAkAAgAJAAUAAAD5/wAAAAAAAAAABQAFAAUAAgD2/wAAAgD8//n/AAAAAAAABQDz//P/AAAAAAAAAAD5//z/CQAFAPP//P8CAAkA/P8JAAAAAAAMAAAABQD5/wUABQD8//z/+f/5//n/AAAAAAAA8//8/wkAAAD9/wIAAgAFAAAAAAAAAAAAEgAAAPn/BQACAPb/BQACAPb//P8AAAIA/P/8//z/CQD8//D/+f8AAAAA8//5//z/AgD8/wIAAgACAAIA9v8CAAIACQASAAAAAAAAAPn/BQAFAAAA8/8AAAUAAADz//b/AgACAAUA+f/8/wIAAgAFAAYAAAAAAAAAAAD5//P/AgACAAUA+f/2/wIADwAFAPn/+f8AAAAA+f8AAAsAAAAAAAYABQD5/wAAAAAAAPn/AAAFAPn/+f/5//n//P8CAAIAAgACAAIAAAAFAAUABQAFAAAA+f8AAAAABQACAAIAAgD2//b/+f/5//n/AAAAAAUAAAD5/wAAAAAAAAUABgAAAAUAAAAAAAAABQD9//n/AAD5/wUAAAD5/wUAAAD5/wAAAAD5/wAABQD5/wAABQD5//n/DAAAAAAAAAD5/wsAAAAAAPr/8//9/wgAAAD5/wUAAAD5/wUABQAAAAAABQAFAAAA+f8AAAAAAAAAAAUAAAD5/wUAAAD5/wAABQAAAPn/AAAAAPn/AAAFAAUA+f8AAAAA8//8/wkAAAAAAAAA+f8FAAUAAADz/wUADAAAAAUAAAAAAAIA+f8FAAIA9v8AAAAA+f8AAPn/AADz//z/CAD9//3/CQADAAMACwAFAAUAAwACAP3/7/8FAAIA9v8AAAAAAAAAAAAADwACAPD//P/5/wAAAAAAAPn/+f8FAPP/9v/8/wIAAgD8/wkACQACAAIABgAAAPn/DAASAPz/9v8CAPz/8/8AAPn/+f8FAAUAAAAAAPn/8//8/wIAAgD8/wkABQAFAPn/8/8JAAAABQAAAPn/BQAAAAAABQAFAAAAAAAAAAAACAD9//3//f/2/wUA/P/5/wAAAAAFAAAA8/8AAAAA7P8CAAwABQD5//n/BQAAAAAADAAAAAAAAAAAAAUA+f8AAAUA+f/5/wAAAAD5/wUADAAFAPn/BQACAPb/AAD5//n/AAAAAAwABQDz//n/AAAAAAUABQAFAPn/8/8FAAAA+f8AAAAABQD5/wAAAAD5/wAAAAD5/wUADAD5/wAABgD5/wAABQD5//P//f8IAAAAAAAAAPn/BQAMAPn/+f8AAAwABQAAAPn/AAAMAAIAAgD2//P/BQACAAIA9v/5/wAAAAD5//P/AAAAAP3/CQD5/wYABgD5/wUAAADz//z/CQAGAP//AAANAAAA+f8AAAwA//8DAP3/8v8AAAYAAAAAAAYA+f8AAAAA8/8AAPn//P/8/wMAAgD8/wIAAgAJAAAAAAD8/wUAEgAAAAAAAAAAAAUA/f8CAPz//P/8//n/+f8AAAUAAADz/wAABgD5//n/+f8CAAIA/P/2/wkACQACAAUAAAAAAAAABQAFAAAAAAAFAAAAAAAAAPn/+f8AAPn/AAAAAAAA+f/8/wIABQAAAAAADAAAAAAABQAAAAAA+f/5//n/AAD5//z/AgACAPz/AgD8/wIACQAFAAAABQAMAAIA9v8AAAcAAgD2//b/AgACAPX/+f/5//n/+f8MAPn/8/8CAAUABQAAAAAA+f/5//3/DAAAAPP/AgAFAPn//P8MAAAA+f8FAAUABQAAAAUA+f/5/wUAAAD5//n/+f8AAAUABQAAAAAAAAD5//n/BgAAAPP/BQAAAAUADAD5/wUAAAAAAPn/BQAJAPb/AADz/wAABQD5//n/+f/8/wkADAD6/+3//f8PAAYAAAAGAAAAAAAFAPn/AAAAAPn/AAAFAAAA+f/5/wAA+f8CAAUAAAAAAAAA+f8AAAAAAAAAAAAABQD5//n/AAAFAAUAAAAFAAAAAAAAAAAAAAAAAAAA+f8FAPn/+f8AAAUAAAD5/wUABQAAAPn/+f8AAPn/BQAMAAUAAADz//n/AAD5//n/AgD8//z/AgAJAPz/9P8CAAcABQD5/wAABgD+/+r/8f/9//H/+P/4//3/+f8AAAwA+f/5/wUAAAAAAAAAAQD5/wEACAAUAAAA+f8AAAAA+P/x//j/8P/j/+b/8v///+T/8v/y//L/9f8EAP3/AAAAAAgACgAKAAwADAAMAAwAFAARAAsACwAdABAAAQAIAAAABQD4/+T/7P/q/+T/4v/p/+L/4v/l/+T/5f/t/+T/6f/+/wIAAAAFAAUABQD9/wsA/P/2/+v/AAD4/wAA8/8AAPn/7v8BAPr/AQDw/+n/8v/q/+D/4P/g/+X/6f/4/wwACAAdACEAIgAcAA4AFgAYABEAEAAdAAkACQAQABUACQAJABAAEAAIAAEA/P8CAPr/7P/k//H/7P/R/9H/0v/Y/9j/3P/q//X/BAAAAAAADQAAAAgA+/8AAPj/8/8AAP3/AQAIABsACgALAB4AIAAZABgAHAAVAAEA9f/t/+D/yf/I/7n/vf/A/7P/yP/d/+z/8P/4/wgAGAARABkAKAAtACgAKQApADgANQA4ACkAKAAgAB0AFAAAAPD/4P/R/8z/qv+e/4n/iP+U/3z/hP+S/5b/sv/E/9z//P8LADUASABdAHgAgAB8AIkAlQCJAHwAdgByAHEAYQBVADgANQAdABQA8v/U/7P/mv92/1b/RP86/y3/Jf8k/yn/SP9g/4D/mf/R/wgARQBwAJsAwADUAOoA4gDSAL0AqACNAH0AaQBgAFAAQABEAC0AFAASAPT/4v/R/57/fP9e/0T/G/8J/wj/6f7w/uj+9P4R/zH/Uv96/7T/AgBRAIQAygDyAAgBHQEcAf0A4gDBAKkAsQC3AJQAhgB0AGkAWQBFACAAFAD4/9b/y/+l/3//Xf9A/yn/Af/o/sj+wf64/rj+yv7m/vv+Jf91/8v/GABoAMEA+AAfAUoBTgE3ARYB8ADgANgAxgC2AKQAegBnAGYAXAA2ADAAKgANAAsA7//I/7P/iv9d/yn//P7Z/rr+pP6R/oj+j/6i/sP++/5X/6r/+P9NALoABwEpAT8BTQExAfkA3QDLAMQAyADCAKYAqACvAJMAdQBfAFIAOwAhAPv/0v+//5b/a/9D/x//5v7C/rD+pv6Y/ov+jP6//gP/Sv+d//X/SwCQANkACgETARMBCAHQALsAyQDjANoAygCyAJAAiAB3AE8AJAAaAA0A8P/O/7P/hP9u/1T/NP8g//f+2v7C/rX+r/6v/tL+7v4l/4j/7f83AJEA6wA/AWABdwF2AWwBJAHVAKsAtACfAIQASAAWABcAAQDn/9b/zP/N/8D/sv+Z/4T/fv9n/1D/Pf8f//7++v7w/u/+7P4L/0T/kP/z/1IAoAAFAWQBkwGYAYwBeAFGAecAYgAnADIALQD9/7X/iv+c/6j/pP+i/7j/uv+//8T/sP+g/5b/f/9b/03/Mf8Q/wT/AP8B/xP/K/9j/83/NwCdAO4ATwGgAbgBrAGJAWgBHgG7AEUACAAbABkA6f+6/5//qv+//9L/1P/o/+r/3v/R/8L/pf99/1X/Ev/n/qr+gP5t/m7+df6w/gL/bP/w/5YAIAF3AdMBGAInAggCxwFcAewAkABVAFAAOgD1/9j/1P/T/+j/8//3/wYA/v/m/8H/qP94/1L/Ef/U/pz+bf4+/h/+Gv4n/mX+w/48/9P/kAArAY0B+AE4Ai0CEgLKAUkB8ACYAIMAiABgACoABAAPACEALgAwADkAHgAEAN3/rP9q/yz/8f6o/m3+OP4A/uH94P3a/Qz+Xf7T/m//MADVAG0BDgKKAoQCUAIaAo8BIAG9AIgAXgAlAPP/4P8KADQAWQCAAIoAbABPAEQAKADI/2n/4f5z/iX+sv0l/dH8lvyG/Nn8T/33/fP+UwCYAegC5ANWBD8E4gNaA4QCpQH4AJIADQDJ/6j/gP9e/27/lP+O/47/pP/V/8v/of9m//n+of5n/vf9n/1H/Qf9G/28/Zv+n/8dAaAC2QOuBBIFrgTSA84CsQF8AIv/N//0/sz+4P7I/tv+8P50/+T/KgAhADkA9/9f/93+Uv6//XD9Xv3h/IP8gPxW/Kf89/1c/0gBqwOcBaMGAgdkBvwEOgOwASUA6f6J/lP+Nv49/nb+gv7E/j3/gP9//5T/gP82/wP/zf6C/nv+V/6u/Qn9evzm+9n79Pxz/pwAPwOcBSMHqQcoB8oF8AMLAmsAAP+g/nr+kf60/gf/KP9P/7b/1P+0/5T/Y/8S/9n+0v64/s/+wf48/nD9ivyr+2n7Pfyo/dr/lQIJBdYGiAcPB5cFbwMyAUz/8/20/Qj+lP4o/6T/7P///x4ACADJ/5z/Yf/j/qX+dP5g/pL+vP5h/rT9yPzE+5z7jvwv/s4AyQPqBaAH5wfXBugEUAIMAE/+mP3a/br+cv/5/xEA3v+e/4X/ef9U/0H/Ev+C/hD+1P3P/TD+kP5N/qD9hPx1+4H74fw8/9MC0AX7B8sIvgfJBeQCUACm/uD9WP5m/2AA3QDXAEEAWP+6/nH+VP5a/rf+qv6F/m/+HP4w/nD+H/5g/Wn8R/sK+0f8g/4NAi0FxAfFCAsITQaJAwoBRP9n/q7+yf/QAFoBbQG9AKP/tP4w/qj9bf2h/eH95P0p/g3+KP5o/hj+iv2N/J37a/ue/Nn+eALCBWMIQwlQCAoGCANiAM/+U/4P/2kAaQHHAYUBegAS/3b+A/7S/f/9Fv4i/ub9zP3O/TH+kv5v/pP9M/zQ+oP6qfuV/oUCJgb3CCwJYAdpBPQAh/7N/ZP+bQAzAr0CEgKSAJz+i/38/YH+Sv+D/xL/S/6F/R/9YP0u/tD+qP6G/YH79vkT+jX8cwAFBW4IwQkPCKIEOAG//i3+o//KAesDjQRaAw8BwP5U/ZD94f4VAJgApv80/g/9w/yY/cH+7P8AAJP+MPyQ+fP4xfq7/u8DeQfDCCUHgwMwAFP+lf6eAMYCGQTvAwgCm/8i/qj9sv40AAABwAAg/3r9UvxU/H79Iv9QAB0AZP6U+zX5C/la+wUA1QSuB0IIxAVdAuj/Cv+LAJgCKwRxBP4ChwC4/v390P59AE8BKwEg/6r8evtp+xb9Ev+dAM8AT/+Q/Ej6zvj3+fX88QCUBPsFXQXAA7ABLAHvAfIC1wNbAw4ClgAo/wr/3P/ZAJ4BAAGV/3b9+Psj/E79IP8iADAAWf+3/Sj8Q/uV+rD7aP0aAOECbwTABEEE+wKKAnoCXgJmAtgBaAEzAcgAzgDVAJ4AWwCc/5b+j/3d/CT9Jf4o/4v/cP/z/gD+NP1I/Ej7cPuD/BH/RgI4BCcFsgRJA08C7AH5AVgCEwKdATgBjwBZALYA/wA1AcYATf+f/T78avzH/Yn/aAA2ACD/uv2o/Nf7Afv3+vL7Qv6MAUAEbAU5BdwDaAL/ATMCnwKDAsgB+ABxAFMAGQGcAWQBWgDR/jD9bvys/P79YP83AA8AWv84/jf9b/yD+zb76/vS/bIAoQMeBUIFAAQYAnUBkAFwAtACQgJOAVcAwP9lACUBQwGUAAf/av2n/Az9H/5F/7z/jv/2/jr+kf24/Jr76/ph+0T9YQCTAzEFRgXuA/EBWQG7AccCdwPLApYBlAAQAKgAggFsAUgAZv6m/Pz7xPwY/lf/rf9P/9r+dv5+/hj+9vxg+9r6QfxA/08DxQUIBmgE8gHKAFsBrQKoA+oCIAHP/2L/YADjAQECzQCW/p/8MPwZ/Z/+z//5/2v/5v6X/sz+o/4u/Qj7f/mc+vD92wI+BsUG4wTtATAA6wC6AlcE0AOaAbP/AP8YAOkBlwIvAc7+NPx4+4H8Xf75/zkAhP/c/mj+rf7N/vj9MPxR+lH6s/wgAdkEYQYuBb8C0wDkAGUCdwOCA4wBwf9o/1QA7wHZAtIBmv+M/Uj8y/zN/dL+Zv+z/5D/Mf/o/mD+u/2b/Cr7//lI+xX+pQLIBX8GCQXwApwBNwI5A4IDtQKKAID/9/8kAWMCUAJIACr+mfxO/D/9MP4D/5v/HADE/w7/KP6Y/S79ufyF+xL7Vfx5/+sDUAY+BvcDkAG/AP0BjAMaBBEDvgBV/9X/7wDBAXsBEP/D/PH7Vvzv/dT+C/8i/9j/CQBY/1D+ev23/aD9fvz0+iv7Hf6FA00HSQfjAwYARP/dAc4EdwWTA0YAd/6j/88B6wLwATb/Sfzi+3f8RP74/j//VP85AAoBAABd/nr82vwa/ib+YfzQ+i/8lAG1BuMHMQQf/6j9lQD8BPYFAQQ7ADj+gP8yAiEDgAEA//f8k/xo/UP+wf7U/oL/fwCvAQkB0P67/Dn8J/5P/7r90fpY+Rr9VASuCEcHtwGa/b7++QJgBvkEWwG4/lb/8AFvA8gB1P47/UL9If4O/mL9Bv0z/msAAwKvAfz/pP0a/SL+gf8a/wD8DPkU+SD+gAX5CFgG0wDd/SYAYAQBBtgDOgBT/28AOAIiAtr/mf7j/tD/Q/9L/R/8+vzQ/6sBpgHP/0P+iP3R/aj+3f6F/rv81/rp+Wz8+AHYBgIHiwP1/38AbgNJBVcEugFKAPIAfgHfAXcA2v/Q/6T/Q/4S/J/7CP1CAMsBTAFT/zL+aP6//pn/VP///sz9BvxV+mT6GP7QAyAHdAWGAUj/oQGoBGoFSAOUAGkANgFeAXwAEP9U/7X/fv88/W37ivt3/qABTALuAOv+0P76/lH/Jf+A/nD+dv3n+wT6HvrU/ckDggfjBagBGf93AS8FPwYFBLUADADbAGQBpwAn/8H/8f/J/wf9ivsN/F3/swE1ApYAL/82/1j/e/5K/qD+0v9X/4H8cPnK+AX87AJQB0IHCgPW/2AAigOIBS8EiwHN/0AAXwDP/1L/C/89AKD/D/7T+wL8aP4LAecB7wDD/4z/MACR/y3/vP6a/wP/ev11+nX5Mfpk/RID3AXcBX4CmgA5AWwDwgR9A4sCcQF2ASYA1P4l/1EAkAG3/+/8GfsK/Mv+7QCqAWIBwAA/AL3/vv7A/p//ngCU/+r8n/pX+oj73/zpAAsEOwXlAhMAnwDpAisFLwSdAt8BpwElAYj/6P4vAGEBPgCF/VX7Wvxy/iYAtwBDAeIBGQEAAKv+6/4XAHMAY/+5/AT7c/o0+7/6KvzyAPcErgVQApgATwIdBdkFTAOgAWoBdgETAJX+H/9YAN0Ahv6Q/O/7i/1C//r/5AA9AcQBgQDA/3H/EAD0ANX/GP9N/YP8wPu/+wL8d/yIAFgD5AQdA8AB0AL8BEQFiQLiADMBGgGQ/6X+tP9LAfcALP9e/SD9MP3J/b/+LwCBATYBaAA9/4T/0f/+/xj/2P4F/0D+sfsQ+sz6Ofxp/C3/dgI9BZcErwJqA8YFBgbvAi4BGQIwAnkAVf7g/l0AQgCW/jX9jP0I/jz+Cf+QAIcCcAJoAVUATQB7AJ//Xv4a/g7+iP3J++v6SftA+yb7b/67Aj0FaATwAmUEsAWnBYcDAQKoAj4CJAAt/vr+eAAgANr92fxq/fL9+P1t/jcA0AFDAnoBGAGCAED/7f51/of+Bv4v/aT8GvwV/L37+fpv+0j+6AGSA0ADdgMoBQEGRwQbA6UCwAIHAhUADP+S/8L/V/8N//T+Hv8x/vj9IP/AAPgAwAAVAaUBUgGW/8z++P6n/vn9Jv05/Vf9sfxJ/P77R/sT/MP+ZwM3BfAEuwNVBF4F+AMLArkBbAJLAWH/rv6Y/0gACf8t/jP+kv4o/g/+Vv9IAa0B9gA9AVwBPgHw/8v/TgDU/3n+A/0N/Un9xfwu/KP8lPzr+7b8aACxA8kE4QMlBEYFfAS/AjECZgLyAY4AcwBlAFUAtv8B/5z+3/10/e798f4nANwAmAExAgsBAAB0//z/KAAs/1T+i/0i/aD8L/x5/O38afyS+zj7Mv3mAJID6wTtBCkFTQUnBEcDCQOxAlwBcgA4APj/o/+X/3D/zP7Y/bf9df4+/ywApgCZAdUBYQHNAJAA8P87/4L+Zv7X/Tn96fy4/NH87vzQ/Hv8BvzL/MH/ywJ4BPcEZAWVBZIEJwOeArcCtgEuAN7/3P+j/0j/Kv/x/jz+sv3C/Sn+RP9hAEkB5AHTAYIBGgFiAJ//+/7E/mb+tP0E/dD8Fv0p/WD9gP3x/C38Ivzc/lACDASxBIsFMwZYBZIDrQLdAjECWgCh/9r/rf8m/zX/hP8D/wn+xf31/bv+gf9PAEMB3gG/AWEBaADT/5P/9f6M/hT+i/30/NT8C/05/X/9If1S/MH7ivzV/+kCggQ9BRIGIAbQBE0DwgJfAngBdgALALD/KP8i/0z/B/9V/vX91P0E/rX+7P8MAfEBVgJnAuQBswDk/1H/qP7//Xj9C/3G/JP8h/wI/XL9Mv3O/K788f2gANkCFwQsBb0FbgVwBIAD7wInAiwBagDv/2z/Gf8c/zj/G//I/oT+UP5b/rv+gv9iAC8B6QHpAZoBvwDI/zL/l/4O/qb9Rf0R/e780vwc/Xj9vP2d/Wr9f/0a/2IB5AIMBEoFvgUzBUcElgPmAtMB0QD4/5f/Jf/O/u/+Ov9Y/yX//f7O/tv+NP8TAOsAtQEaAt4BSQFRAIT/t/4V/pL9JP3H/Iz8fvyY/Cj9gP3A/QT+vf2m/fv+QgH7AlMEnQUHBnoFcQSgA8cCsAG2AMv/Z/82/+3++v41/2T/XP8m//z+8P4a/8z/fAAoAd0B3QGRAQMBLwAw/2r+zv1G/dH8gfx0/GT82Px6/cP9Gv7Q/WL99f3i/9YBcgPPBJ4FwQUsBWQEeANoAmcBUADS/6D/W/8R/xf/LP/+/vD+2v7B/gL/hP8jALoAawGOAWEBFgFoAJH/w/4z/rL9Kv3e/ML8rvzU/Dv9pf0G/gT+af2F/ff+wABrAuEDBwWpBdAFWAWRBIADYwJgAV4ACABw/1L/R/9T/z3/DP8L/7T+vP4G/33/AACvAD0BQAE6AcgA/v8F/zX+iv3w/IP8PPxN/JH86vyL/e39Lv4//hX+Df4i/7UAQwKmA7QEewW/BWwFwwT3A/ECzgHbAGUA2f9P/z7/Kv/7/tT+3v6T/ob+5v5B/6v/VQDoACIBNgEIAX8Axf/6/l7+if3c/Fb8Ifwd/Df83PxS/aj93/3r/Rz+CP+bACUCVgNiBGEF0wW4BVAF1QQCBNAC1QEhAVEAbf8F/9D+iv42/kL+Nv5G/nn+4/54//j/fQDrAC8BHwG9AD8Amf/o/in+e/3s/Iv8RfxR/Jj83fwh/WH9kf0t/iv/TACXAbsCxwOfBA0FNQUyBfIERwRsA68C6gHqABUAT//J/kr+7P24/bz93v0c/oz+1/5l/+b/UQCkAN0A4wCKACAAmP/6/mH+zP1X/e78rvyz/PD8F/1a/Zf9vf1C/h//CgAbAQ0C8gLUA3AEwAQHBQAFswRABNcDKwNkAogBngDj/xT/ev4I/tX9tv2t/cj9/f1R/pr++/5V/6P/u//H/7//kf9S/w//tv5d/u39oP14/Uv9OP0//UT9g/0a/uD+1P/IALsBzAK0A2AE/gRaBWkFSQUJBX0EqgPPAscB0wDG/9P+F/6B/Qb9yfy+/Nn8GP1o/dn9Wv7A/hX/bf+e/6X/oP+U/13/Cv+1/mD++/25/Xb9S/18/fD9jv5h/1UAZQGOAn8DWgQZBZcFxwXDBYcF3gQQBCIDFQIEAeD/7v4S/mT90/yV/Hr8k/zK/Cr9nv0R/on+3P48/3X/jP+m/5P/Wf8L/6n+MP7T/Xn9Ef39/E/9xf2H/oL/hACxAecC0wOlBGAFzgXoBdUFigXYBP0DAAPqAdgArP/A/vL9P/3K/I78d/yT/NP8NP2g/RP+ev7g/iH/X/+L/5P/dP9A//D+hf45/sf9Ov0A/UP9gP0Q/hD/CgAeAWICbQNLBCAFpgXmBfQFrQUUBTsEUANEAhwBAQAP/y7+VP3I/Gj8R/xM/In81/xN/cr9Sf7G/jf/d/+r/9v/0P+q/2T/7f6a/kD+tv0v/Sj9cv23/Xj+Yv9jAJEBsgKeA1cEHAV2BaAFiwUoBWoEnwPAArcByQDo/x7/Rv6v/UH98vzN/Nb8Af1Y/b39If6P/vD+QP90/5H/o/+E/zr/2/6I/jL+wv0//Tr9lv3u/bT+lv98AJQBmgJ8AwYErgQNBTgFLwXIBDsEZwOkArABvADv/xH/S/6+/VT9D/0K/RD9Rv1+/c39Ov6X/vX+MP9h/4n/hP9b/xP/pf5X/gH+gP1a/Yj95P1z/k3/EAAAAf8B1gKtAzsEzwQHBRMFvgQ8BIcDoAK8AdcACwBA/4v++f2a/W/9Xf1e/ZH9z/0Q/mP+tP7t/hX/Pf9Y/1z/M//1/pT+R/75/Zj9eP2g/fv9kP5m/zsAMAH5AdECjwMZBJAEugS0BIEE+ANKA5kCuwH2ACMARv+K/vX9h/1D/TT9Qv1k/Zb94P0t/nT+sP7W/hX/Nv8h//3+tf53/jH+4P2o/db9GP6H/lb/GADwAMsBmQJaA+8DXQSKBKEEbwQYBHgDyQIUAlQBjADQ/yv/i/4K/rr9jP2D/Yv9rv3o/S/+bf6o/tX+EP88/zv/NP/o/rj+ev4l/vn9BP4t/oD+G//D/4wAXAEZAskCbgPZAwwEKQQcBMIDMAOYAuMBMgFwALv/Hf+B/g3+uP2N/Y39sP3W/SD+e/60/vX+Ov9n/4D/iP98/0H/DP/O/nj+NP5E/mj+qv43/7f/ZAANAa8BRQLOAkUDhwOwA6EDVgPwAlkCuQH4AEIAkf8D/4T+GP7J/bb9yf3o/Rf+YP64/gD/Kv9P/3L/hf9r/17/Hf/c/nn+QP4y/lD+jf73/qv/NQDxAJMBIwKwAiADUAN7A4EDPQPHAj8CpAHwADAAmv8h/5r+MP7k/cj92P36/ST+bv7R/h//S/91/6v/sP+x/6X/hf9U/wj/zP7G/u3+Av9f/+f/WQDpAG0B1AFKApsCvQLTAuACowIzArYBKAGEAO7/a//7/o/+Of4D/tz93f0O/jD+dP7P/iH/Vv+N/8j/3f/0//j/5v+9/5D/Xv9T/2n/bf++/y4AgQD2AGMBuwEMAjkCagJ9An4CQgLiAXgB+ABhANb/Z//6/pD+Pv4J/tj92/31/Q7+Rf6E/sb+CP9B/2D/kf+w/7j/v/+4/6X/iv+T/6j/vv/+/00AsgD/AF8BqQHeARUCNgJGAkYCFgLDAW8BDAGYACYAuv9g/wL/tf55/kf+Mv5D/kj+Z/6U/sX+4v4P/0L/af+I/5L/nP+T/5D/of/H//P/LgCEAOEAMAF0AbIB1AHmAQIC+wHlAakBXwEcAbYASwDV/33/Jv/F/pr+Vv4+/i3+KP5C/mj+jf7B/gD/LP9o/4//rf/X//H/JgBLAIQAvwDyADQBVwFpAX8BdwGGAXABWAEzAQsB2ACjAFsADwDL/4//Qv8J/8v+r/6i/pr+oP6l/sz+3f4A/zL/Dv8V/xD/AP///hD/NP+D/9v/OwCsABQBWgGtAd4BCQIIAgMC9gHMAXkBOAHXAG4ACQCp/z7/9P7Q/sD+tf7Q/vr+E/8w/1D/ZP+M/5H/Zv9o/03/J/8o/wj/Tv91/6z/HwB2APEAQwFiAZ8BtwGsAZwBewE/AQoBwQBeAAsAvP9w/yr/AP8H/wD/Bf8x/2f/ef+n/8P/yv++/6f/sv+M/3L/Zf9V/1H/b/9p/5r/4v8ZAF0AeQDZAA4BGwElASgBFAHyAKkAcQA4AAkAxP+Q/37/Wf8+/0X/Zf9n/3//oP/Y//D/AAAgAEgAKgAGAAAABwDP/5z/x//T/83/3P/9/yoAQgBTAHYAkwCmAI0AugCRAHkATgA0AAQAxv+5/6b/iP90/3//i/96/4z/tv/N/8z/1/8DAAgA9//j//H/9//Z/+f//f8RAAwACwAmADAAQgA9AEcAaABZAGQAUQBWADAAEAD9/9T/0P+r/6f/sv+a/5//l/+2/7//yP/N/9L/7f/v//L/8P/y//X/6f/w/wAADAASABAAIQAyACwAKAA8AEwAOgBDADwAKAAkABAA+//o/9f/yf+5/8b/wP/E/8z/zv/e/+D/2//q//f/8//v//j/8f/8/+//9P/w//D/AwD3//z//v8LABwAFQAkACkAJwAxACgAJwAgABQAEAAbAAIACgAWABYADAAIAAUAAQDq//v/5f/l/+j/6f/o/9H/2P/a/93/3v/h/8r/1f/m/8v/2//r//f/8v/3/wgAAgAMAAgADAAdAA8AIQAmACcAIAAmACoAKwAnACcAIgAiABkACAACAPv/8v/r/93/0P/P/7//w/+3/7P/tv/F/73/wf/F/9D/4P/k/+n/9v8EAPz/BQAcACUAJAAjADAANAAwADIALAAqADQAMQAoAB0AGgAQAA8ABgDm/+b/3//P/8f/wP/A/9D/1P/T/9r/5f/m/+D/7P/7//j//f8BAA8AGwAdABoAIAAZAA8AIAAeABoAJwAiACAAIAAbABoAEAAAAPf/9//q/+f/4//T/9X/3P/Y/9j/zf/W/9X/1//i/+T/8f/m/+j/+//+/wAA/P8AAAYABAAJAAIABAAKAAMAAAAEAB4AEAARAB0AFwAXABkAEAAeAA0A+P/5//X/4P/z/+n/5f/g/9z/3//j/9r/3//r//v/8P/+//L/+//9/wcABgAGABsAFQAXAA0AEAAWABMADAAFAAcAAQAEAP/////3/+///v/5//j/9P/2/+z/+P/6//n/9P/o//D/6v/w//T/7//v/wIAAQD8/wkAAwD7//n//P8AAPz/CAAIAAkACgAIAAcA+/8CAPr/+//7//r/+P/z//D/9P/5/+7/9//8////BQAHAP3/+f8CAAUA7f/z//n/AADx/+///P/2//7/BAACAPj//f8NAAQACQAKAAQACAAEABMABQABAP///f/2/wEA+P/s//D/5f/w//D/+P8CAPX/+v/0//n/AwAHAAMA/P/9////BAD/////AQD+////CgAAAAYACAD9////AAD///7/+P/0/wEAAAAAAAAA9v////z/8P/2//z/+v/s//H/8f/x/+//6v/u//L/7v/t//X/+P8CAP///f/8/wMAAwAIAAAABwD8//n////7/wgABwAKAA0ACAAEAP3//f8EAAIAAQABAPz///8EAPv//v/w/+f/6v/t/+v/5v/v//P/7f/7//P/8//4//v/AQAIAAcACAAFAAEA+/8FAAgA+v/9/wUACgAHAAUABgAGAAAA/f8DAPP/+f/9/wEA9f/4////8P/0/+//7v/2//j/9//2/+//7P/u//P//P/1//T/+P8FAAAA+v8EAAIA+P/1/wAA+f8QAA0ADAADAAYABAAKAAcA+////////v8EAAIA///+/////v/x//P/8P/9////9f/5//r/+v/2//r/+P/7//X/+//y//T//P/1//b/+f////D/9P8EAPj/8v/x/////P/s//j/9f/u//v/9f/z//v//f/t/+////8CAAoA8//6//3////3//n//f/4//f/AAABAPr/+f/0/+7/8/8GAAcAAwD5//v//P/9//z/AAABAP7/9P8FAAkA/v8AAPz/9v/8/wQA9P/7//7/7//0//b//v8GAPz/8//3/wAAAgD3////BQD4//j//P/3//T/+f////3/AAADAPf/BAAAAPr//P/8/wMA9//8/wUA+v/8//z/BAD4//X/9//3//r//P///+v/9P/+//n/9//7//T//P/8//D/+f/1//H/+P/5//X//f/9//n/8//6//P/9v/6/wEA+//7/wYA+//8/wEAAwD+//z/BgACAAAACQABAPj/BQACAAAA/f8BAPv/+v8CAAUA///1/wMAAQD1/wAA//8CAAIA/P8GAPr/9P/4//j/8//2/wAA8//y//r//P/2//j/+v/5//b/+//5//r/9f/x//b/9//4//n/8P/0//r/+P/2//j//P8DAPH///8MAP/////6//z/AwABAAAA+f////z/AAAAAPb/9/8JAP3/+f8PAPr/7v8HAAIA/f/9/wwAAAD9/w0A9//2//7/AgABAP//AAADAAAAAQD//w0ABgDw/wcAAAAAAAUA+v/3////AAD4/wEA/v/9//b/BwAEAPf//f8CAAgA+P8BAAYABQD+/wEAAAD4/wMABgD2//j/AgACAPr/AAACAP//BAAAAPn//v8CAAAA/f/8/wYA9////w4A/P/0//v/AAADAAAA+//8/wIA/v8BAAAAAwD+////BAD3/wAABQD///n/AAD///z/BAADAP//9v8CAP///f/+//z/+v/+//j//P8OAAgA+v8CAA0A///9/wsABAD5//3/CAD9/wAAAQAFAPX//f///wAA/v/4/wAAAQD2/wIA+f/9/wMABQAEAPz/BAANAP///v8GAAAA9/8BAAAA9//7//n//v///wAABwD+//3//v8JAP//9v/9/wQA+v/0/wsAAQD6/wIAAwABAAcA/v8HAAcAAAD9////BAD1/wQA///y/wAA//8AAPv/+v////j/AAABAPz//f/7/wAADgABAPv/CgD9//j/AAAGAPv/+//3/wcABAD3//3/AAAAAAgAAQAHAAYA+P8CAAkA/f///wMAAgD8//f/+//7//r////4//b//v8FAP///f8AAP7/BQAJAAIABwALAAMAAAABAPz/AgD4////BQDy//j/AQABAAIA+v8EAAIA//8CAPn/AQD///v/9v8EAP7/8v/5/wIA/f8EAPL//P8FAAUACAAFAAYAAAAPAP3//v8EAAMAAAD2/wAA/f/9////AQD8/wAA//////n/AAD6//3/AwD8/wEACAAAAAAABQAAAPn/AAAAAPr/BQAAAAAAAAD+/wQABgD1/wAAAwACAPn/AQABAAAABAD+//j/+f8AAAEA/P/7////+v8GAP//AAAIAPz/AAD+/wgAAwACAP7////+//n/BAD///n/BQACAPr/AAAAAAAAAAAAAP//AAAAAPT/BAAEAPP/+v8AAP3/AgACAAIA/P8HAAoAAAACAPv/CwAEAP//+f8EAAgA+P/1/wYA///5/wAA+P8EAPr/+v/7/wIAAgD8/wEAAQABAAUA+v8AAAYA+v/6/wEABAAAAPT/AwAFAAUAAAAAAAUABQACAP7/+v///wcAAgDx//r/BQD///P/AAAAAPP/BQD//wAAAAD6/wAABQD5/wAAAAAAAPr//P8LAPn/AAAGAAAAAAAAAAQABAAAAPv/BwD5/wUABQD5/wAA+v8AAPn/+v8AAPb/AgACAP3/CAABAAEABQAAAAAABgAAAAAABAAEAAAAAAD6//n/BQD5//n/AAD5/wUABQAAAAAABgAAAAAABQAAAPr/+v/6/wYA+v/0/wIAAQAEAAAA9/8KAAYAAAAFAAsAAQACAAIA/f/3//b/AgD1//n/AAD0//f//P8HAPz/9/8DAAMAAwACAAcABwAEAAYA+//7/wAABAD+/wUAAAD6/wYAAAD5/wAA+v8AAPr/+v8FAAQA//8FAAUAAAAAAAAA+v8AAAUAAAD6/wAABQAAAAUAAAACAP3/+f8FAPr/+v/6////BQD5/wAAAAD6/wAABQAFAPn/BAALAPr/9f8AAP//BAD///n/AAAAAPr/+v/9/wgA/////wUAAAAAAAAAAAD6////BAAAAPr/+v/9/wEAAQACAP3//f8PAAUAAAAFAAsA/f/6/wAAAAAEAP3/9P8AAAQAAAD5/wAA+f8AAAAA+f8AAPr/AwD9//z/DgAFAPr/+v8GAAAABQAAAP//CwACAPf/+v8AAPr/AAD//wUAAAD5/wAAAAAAAPr/AAD//wUAAAD6/wAA+v8AAAAA//8EAAUA+v8AAPr/AAAFAP//BQAFAPr/AAD6//n/BAALAAAA9P/7/wYABAD//wUA8//6/wUA+f/6/wAAAAAAAAAAAAD6//z/CAAFAPn/BgAFAAAABQAFAP3//f8AAAAAAAD5/wAABQAAAPr/+v8GAPn/+f8LAAAA+v/6/wUAAAAAAAAAAAAAAAAACwAFAP3//f8CAAIA/P/8/wIA9v/8//z/+f/5//P/AAD9//b/AgACAAIAAgAJAAIA/f8CAAkAAAAFAAAAAAAMAAAA8/8AAAUA+f8AAAAAAAAFAPP/AAD5/wAACwAAAAQAAAAAAPP/+f8FAP//AAD5/wAAAAAAAAAAAAAAAAAABQAFAAAABQAAAAAAAAAAAAAA8/8AAAAAAAAFAAAA+v8AAAAABQD5/wAAAAAAAAUA+f8AAAUAAAD6//r/BQAFAAAAAAD0//r/AAD//wUABQAAAPr/+v8MAAsA/P8AAAIA/f/5/wAA+f/5/wAAAAD5//r/AwAAAP7//v8DAAEACAAAAAAAAAAFAAAA+f8AAAYAAAAAAAwAAgD2/wAA8/8AAAUABQAFAP3//f/6//n/AAAFAPn/+f/5/wUAAAAAAPn/AAAGAPn/AAAFAAUABQAGAPr/AAAAAAAADAD8//b/AAAAAAAAAAAAAAAAAAAAAAAABQD5/wAABQD5/wAA+f8AAPn/+f8FAPn/AgACAP3/AgACAAEACwALAPn/8/8AAAUA+f8AAAUAAAAAAAAA+f8FAAwAAAD5/wAABQD5//n/AAAAAAAA8/8AAAUAAAAAAAAA+f8AAAwAAAAAAAYAAAAAAAAABQAIAAIA/f/2//b/AAD5//n/AAD5//n/AAAFAPn/9v8CAAIAAgD9//3/CQACAAkAAAAAAAAABgDz//z/DAAFAAAA+f8AAAAA8v8FAAYAAAAAAAAABQAFAPr/+f8FAPn/8//5/wIA/P/2/wIACQACAAIAAgACAAUAAAAAAAAAAAAFAAUAAAAAAAAA+f8AAAAADAACAOz/+f8FAAAA8/8AAAAA+f8FAAAAAAAAAPn/BQAFAPn/+f8FAAAA+f8FAAAA+f8AAAUAAAAAAAAAAAAFAAUA+f/5/wAAAAD5//n/AAAAAAAADAAFAAAA+f8AAAAAAAAFAPn/+f8FAAAA8v8GAAAA+f8AAPn/AAAAAAAAAAD5/wUAAAAAAAAAAAAAAPn/BQAAAAAABQAAAPn/BQAAAAAABQAAAAAAAAAFAAIA9v/5/wAA8/8AAPn/AAAMAAUAAAD5/wAAAAAMAPn/+f8MAPn/+f/5/wUABQD5//n/AAAAAPn/BQAFAAAAAAD5/wAAAAAAAAAA+f8AAAAAAAD6/wAACwAAAAAA+v8FAAAA+f8AAAUABQAFAPz/AAAAAAIACQD8//D/AAACAPP/+f/5/wAA+f8CAPz//P8PAAwA+f/z//z/AgACAAkAAAAMAAUA+f8AAAAADAD8/wAAAgD2//n/BQAAAPn/AAAAAPP/+f8CAAUA+f/8/wkAAAAAAPn//P8CAAIABQAAAAAABQAFAAUAAAAFAPz//P/9/wAAAgD2//r/AAD5/wAAAAD6//n/AAAFAAUA8/8AAAAABgAAAOz/AgACAPz/CQACAAAAAAAAAAUABQAAAPn/+f8AAAUAAAD5//n//P8CAPz/9v8CAAkAAgACAAIAAgD8//b/AgAJAAIAAgACAAAABQAFAPn/+f8FAAAABQAFAAAA+f8MAAIA/P8CAPz/9v/2//n/AAD5//P/BQAFAPn/8/8CAAsABgAAAPP/BgALAAAABQAAAPn/+f8FAAAAAAAAAPn/+f/w/wIAAgAJAAwAAAAAAAAABQAAAAUA+f/5/wUA+f8FAAAA+f/5/wAAAAD5/wAADAD5/wAAAAAAAAwABQD5/wAAAADz/wAABQAAAAUA+f8AAAwA+f8AAPn/+f/5//z/CQAMAAUA8/8AAAAAAADz//b/AgD8/wIAAgACAAkAAgAAAAYABQAAAAYAAAD5/wAADAD9/wAAAgD2//n/AAAAAPn/AAAFAPn/+f8FAAAAAAD5//n/AAAAAAwA+f8AAAAA+f8AAAAABQD5/wAAAAD5/wUAAAD5/wUABQAFAAAA+f8AAAAAAAD5//P/DAAAAAAABQD5/wUAAAD5/wAA+f/5/wUABQD5/wUABQAAAPn/+f8FAAUA+f8FAAUAAAACAP3/AgD8//3//f/9//3//P8AAPP/AAD5//n//P8JAAUAAAAMAPn/+f8AAAUADAAAAPP/AAAMAAAAAADz//n/BQAAAAAA+f8AAAAAAAAAAPn/BQAFAAAAAAAAAAUA+f/5/wAA8/8CAAUAEgD5//P/AAAAAAUABQAFAPn/+f8AAAUADAD5//n/BQD5//n/BQAFAAAAAAAAAAAA+f/5/wUA+f/z/wIABQAAAAAAAAAAAAAA+v8GAAAA+f8FAAUABQAAAAAA+f8AAAAABQAAAPP/DAAFAAAAAAD5//n/AAD5/wAAAAD5/wAA/P8CAPz/AgACAAIAAgD2/wkACQD5//b/AgAJAAIA/P8CAPz/AgACAPz/CQAFAPn/AAAMAAAA+f8AAAUA+f/5/wAAAAAAAAUAAADz//n/BQD5//z/DAAAAPP/AAD8/wgABQAGAAsAAwD2//z/CAD9//b//P/8//z/AAAAAPn/BQD5/wAAAAD5/wAAAAD5//n/AgAFAAAA+f8AAAAADAAAAAAADAACAAIA/P8CAPz//P/8//z/9v8AAAAAAAAFAPz/AgD8//3/8//z/wAABQAAAAAA8//8/wkAAgD8//z/CQAFAAAAAAAAAAAAAAAMAAUAAgD8//z/+f8AAAAA+v/5//r/AAAGAAAA+f/2/wIACQAFAAUA+f/5/wUAAAD5/wUABQAAAAAADAD8//z//P8AAAIA9v8FAPn/8/8FAAUA+f/z/wUABQD5/wAAAADz//z/DwAAAAAAAAAFAAwAAADz/wAABQAAAAAA+f8AAAUAAADz/wAADAAAAAAA+f8AAAAAAAD5/wUAAAD5/wUABQD5/wAABQAAAPn/8/8AAAAABgD6/wAABgD6/wAAAAAGAAAA+f8AAAUAAAD5//n/AAAFAAAAAAAAAAwABQDz/wAABQAAAOz/AAAAAAAAAAAAAAAA8//8//z/DwAGAAAAAAAAAAUAAAD5/wAABQAMAP3/+f/z/wUABQD5/wAAAAAMAAAA8//5/wAADAAAAPn/AAD5/wAABQAAAAAAAAAAAAAADAACAPb/+f/y/wAABgAAAAAAAAAGAPP/AAAFAPr/AAD5/wAABQD5//n/BQAAAPP/AgACAAIABQAAAPn/BQAAAAAAAAAAAAAAAAAAAPn/+f8AAPn/BQAFAAUA+f/5/wAAAAAFAAAAAAAAAPn/+f8FAAAABQD5//P/AAAFAAUAAAAAAAUADAD8//b/+f8FAAYA+f8AAAUAAAAAAAAA+f8AAAYA+f8FAAAA8v8FAAYAAAD5/wAA8//9/wkAAAAAAAAAAAD5//z/AgAJAPn/AgAFAAUA+f8AAAwADAD8//z//P/5//n/AAD5//P/9v8CAA8AAAD2/wkAAgD8/wIAAgACAAUABQDz//z//P/8/wkAAgACAAIABQD5//n/AgAFAAUABQAFAAIA/P8CAAIA9v/8/wkA/P/2//3/9v/z//n/8//2/wkACQAFAPn/9f8IAAUABQALAAYA+f8AAAAAAAAGAAAA+f/5/wAAAAAAAPP/BQAFAPn/AAAFAAAAAAD5//n/BQAFAPn/+f/5//z/CQAAAAAABQAAAPn/AAAFAAAAAAAFAAUA8/8AAAUAAAAFAPn/+f8FAAUAAAD5//P/AAAAAAUA+f/z/wIACQAFAPn/AAD5/wUAAAAAAAwABQAAAAAAAAAAAPn/8//y/wkABgAAAAAA+v/5/wIACwAAAPr/+f8FAAUA+f/5//n/BQAAAPn//P8JAAAAAAAFAPn/AAAAAAAABQAAAPn/BQAFAPn/+f/5/wAABQAAAPn/DAAAAPP/AAAAAAAAAAAFAPn/+f8AAAAAAAAAAPn/AAAAAAAAAAD5//z/AgAFAAUABQD5//n/AAD5/wAABQD5/wUADAD5/wUAAAAAAAAAAAAFAAIA/P/z//L/+f8AAP3/AwACAAIA/f/2//z/AgAPAAwAAAAAAAYABQAFAPz/+f8FAAIAAgACAPz/9v/8//z//P/5//n/BQD5//P/AAD5//z//P8JAAIA/P8CAAkAAAAAAAwABQAAAAAABQACAPb/8/8FAAYA8//5/wAABQAAAAUAAAD5//n/BQAAAPP//P8JAPn/BQAFAPn/+f/8/wIABQAGAAUAAAD6/wAAAAAAAPn/BQAAAAAABQD5//n/AAAFAAUAAAAAAPn/BQD5//P/AAAAAAAABQAAAAAAAAAAAPn/BQAAAAAABQAAAAAA+f8FAPn/8/8FAAUA+f8AAAwAAAAAAAAAAAAAAAAAAAD5/wUAAADz/wAA+f8AAAAAAAAAAPn/AgACAAAAAAAFAAAA+f/5/wwABQD5//n/AAAFAAAAAAAFAAAABQACAP3//f/8//r/AAAAAPn/AAAFAAAAAAAFAPn/+f8AAAAA+f8AAAAAAAAAAPn/AAAFAAUAAAD5/wAAAAAAAAUA+f8AAAAABgAMAPz/AgACAPb//P8CAPz//P/2//n/AAD5//n/AAAAAPn//P8JAAUABQAAAAAAAAD5/wUABQAFAAAAAAAAAAAAAAAAAAAA8/8AAAAAAAAAAPn/BQAAAAAABgDz//r/BgD6/wAA9f8IAAwAAAAAAPP/BQAFAAYABQAAAAIA+f8FAAIA/f8CAPb//P/8//n/+f8FAAUA+f8AAPn/+f/5/wAAAAD8/wIAAgD8/wIACQAGAAUAAAAAAAAABQAAAAUAAgACAPz//P8CAPb//P/5/wAAAAD5//n/8//2/wkADwAAAPn//P8JAAAABQAAAPn/BQAGAAUA+f8AAAUAAAAAAPn/8v8AAAUABQDz//n/BQDz/wIACQD2/wkADAAMAPn/AAD5//n/BQD5//n/AAAAAPn/AgD8/wIADAAFAPn/AAAAAAAABQD5/wAAAAAAAAAAAAAFAAAAAAAAAPn/+f8AAAAA+f8AAPn/AgAAAAAA/P8FAAwA+f/5/wUAAAD5/wAABQAAAPn/+f8FAAUAAAD5/wAAAAAAAAUABQAGAAIA9v/5/wUAAADz//L/AAAAAAAA+f/8/wIADAD5//z/BQAAAAAAAAD5/wUABQAFAAUAAAAAAAIA9v/5/wAABQAAAAAABgD5//n/+f8FAAUA8//5/wUAAAAAAPn/AAAAAAUABQDz/wUADAAAAPn/AAAAAAAAAAAAAAAA+f8AAAUABQDz//n/BgAFAPn/+f8FAAAA+f/5/wwAAAD5/wAA+f8GAAUA+f/y/wIAAgD9//z/CQASAPn/AAAMAAUA/P/8/wIA9v8AAAkA/P/8/wIA/P/w//n/AAAAAAUA+f/5//n/+f8CAAIAAgD8/wwABQD5/wAABQAFAPP/+f8AAAUABQD5/wAABQAAAAAAAAAFAAUA/P/z//P/BQAGAAAAAADz//n/AgACAAAA/P/8/wkABQAFAAAABQAAAAAABQADAP3//f/9//z/+v8AAAUA+f/5/wAA+f/5//z/CQAAAAAAAAD5/wIA/P8CAAUABQAFAAAAAAAAAAAA+f/z//z/AgACAAIA9v8JAAkA+f8CAAUAAAD5/wUAAAD5//n/AAAFAPn/+f8CAAUAAADw/wIAAgACAAkAAAAFAPn/8/8CAAUA+f/2/wIACQACAAUABQAFAAAAAAAFAP3/AgAIAAMA/f/2/wIA9v/v//r/AAAFAPL/+f8FAPn/AAAAAPn/AgAMAAUA+f8AAAAA+f8FAAUAAAD5/wAABQAAAAUABQD8//z/AgD2/wAAAADz/wAABQAFAAAA+f/5/wAAAAAAAAAAAAAFAAAA8/8AAAAAAAAAAAAAAAD5/wUABQAAAAUAAAAAAAUAAAAAAAkAAgDw//n/DAD2//n/+f8AAAAA+v/5/wMA/f8CAAkABgAAAPn/BQAMAAUA/P8AAAAAAAACAPn/8/8AAAAA+f/2/wIAAgACAAIAAgAFAAAABQAAAPn/BgAFAAAAAAAAAPn/AAAAAAAABQDs//D/AgAPAAAA/P/8/wkABQD5/wAA/P8CAAIADAAFAPn/BQAAAPn/AAAFAAAA8//5/wUA+f/5/wwABQD5/wUAAAAAAAAAAAAAAAUABgD6/wAAAAAFAAgA/P/9//X/+f/5/wAABgAAAAAA+f8AAAAAAAAAAPn/AAAFAPn/8//8/wkABQAAAPb//P8JAAIADAAAAPn/BQAMAAUA+f8FAAIA/P/2//n/AAAAAAAA+f/5//n/AAAAAAAABQD5//n/DAAAAPn/+f8FAAUA+f8AAAwAAAD5/wUABgD5/wAABQD5/wAAAAD5/wUABgDy/wAABQD5//n/+v8DAAUA+f8AAAAAAAAAAAAAAAD5/wYAAAD5/wAAAAAAAAAABgAFAAAADAACAPz//P/2/wAAAgD8//z//P8CAPb/AAAAAPn/AAAAAAAAAAAAAPP/+f8CAPz/CQAAAAUAAADz/wkAAAAAAAYABQD5/wUAAAAAAAAADAD8//n/AAAAAAAAAAAAAPn/AAAAAAAA+f/5/wYABQAAAPL/AAAGAPr/AAAAAAYACwAAAPn/BQAJAPz//P/2/wAABQD5//P/AAAGAAUAAAAAAAAAAAD5//n/+f/8/wkABQAAAPn/BQAAAPP/BgAAAPn/BQD5/wAABQAAAPn/+f8AAAAABQAAAAAA+f8AAAwAAAAAAAAAAAD5/wUABQD5/wAA+f8AAPn/AAAAAPn/AAD8/wIABQAAAAAA+f/9/wUAAAAAAAYA+f8AAAAABQAMAAAA+f8FAAIA/P/5/wAAAAD5/wAA8/8AAAUA8//8/wkAAAAAAAAAAAAFAAAA+f8AAAUABQAAAPn/AAAGAAUAAADz/wUADADz//n/AADz/wAABQAFAPn/+f8AAAAABQDz/wUAAAD5/wwAAAD5/wAABQAAAAAABQAFAPn/AAAGAAAACQD8//b//P8AAAAA+f/6//n/+v8AAAAAAAAGAAAAAAD5/wAAAAAFAAAA8/8AAAUABQAAAAAABQAFAAkA/P/2//n/+f8MAAIA/P/2//P/AAAAAPn/+f8CAAAAAAAAAPz/AgAFAAAA+f8FAAUABQAAAAUAAAAAAPn/AAAFAAUAAgD2//n/+f8AAAUAAAAAAAUA+f8AAAAA+f8AAAUA+f8AAAUA+f/z/wIAAgAAAAAAAAAAAPr/AgALAAAABgAAAPn/AAAAAAUABQAAAAYA+f/5/wAA8//5/wIA9v8JAAkA+f8CAAIAAAAFAAAA+f8FAAAABQAFAPn/+f8MAAUA8/8AAAAA+f8AAPn/+f/8/wkAAAAFAAYAAAAAAAAAAAD5/wAAAAAAAAAA+f8FAPn/+f8AAAAAAAD2//b/CQAJAAIAAAAFAAUABQD5/wAAAAAMAPr/AAD6/wAABgD6//n/+v8AAPn/DAAAAPP//P8CAAwAAAAAAAAAAAAAAAAAAAAAAAUABQD5//n/AAAAAAAAAAAAAPn/AAAFAAAA+f/5/wAA+f8CAAUAAAAAAAAAAAAFAPn/8/8FAAAA+f/2/wkADAD5/wUABQD5/wAABgAAAAAAAAD5/wAADAAAAAAAAAD5//n/BQAAAPn/DAAAAPn/BgAFAPn/+v8AAAYA+v8AAAUA+f8AAAAA8/8AAAAAAAAGAAUABQAAAAUAAAAAAAIA/P/8//n/+f8FAAAA+f/5/wAA8//8/wkAAgACAAAABQAAAPn/AAAFAAAAAAAFAAUAAAAAAAUA/P/5//P/+f8GAAUA8//5/wwABQD5/wAABQAAAPn/BQAAAAAABQD5/wAAAAD5//n/+f8FAAAA+f/9/wIAAgD8/wkAAAAAAAUABgD6//n/BQAAAAAAAAAFAAUA8//z/wAABQAFAAUA8//5/wAA+f/8/wIAAgACAAIA/P8JAPz/9v8JAAkAAAAAAAAAAAAAAAAAAAAAAAUABQAFAPn/+f8AAAAAAAAAAAAAAAAFAAAAAAAAAPn/+f/5/wUAAAD5/wUABQD5//n/BQAAAAAAAAAAAAUADAD8//n/AAAGAAIAAwADAP3/9v/2/wMA+v/5/wUAAAAAAAAAAAAAAAAA+f/z/wUABQAAAAAA+f/5/wAAAAD8/wIA/P/2/wIADwACAPz/CQAMAAAA+f8GAAAAAADz/wAAEgAAAAAA+f8AAPn/+f/5/wAAAAD8//z/CQAFAPn/AAD5//b/AgACAAIAAgAMAAUA+f8FAAUAAAAFAPz/+f8AAAUAAAAAAPn/+f8AAAAA+v8AAAYA+v8AAAUA+f8FAAwAAAD5/wAA8/8AAAwABQACAPb/+f8AAPn/+f/5/wUAAAD5//z//P8CAAIAAgAMAAAA+f/5/wUABQAAAPn/AAAAAPn/DAAMAAIA/P/2//n/AAAAAPn/AAAAAAUAAADz/wUABQD5//n/AAAFAAAAAAAFAAUAAAD5/wAADAD8//n/+f8MAAIA/P8CAPb/+v/5//r/BgAGAAAAAAD6/wAABQD5/wAADAAGAPn/8/8FAPn/BQAFAPP/+f/8/wIABQAAAPn/AAAFAAUABQAAAPn/AAAFAAAA+f8AAPn/AAD5/wAA+f/8/wkA/P8JAAUABgDz/wAABQAAAPn/BQAMAPP/BQAFAAAA+f/z/wAAAAD5/wAABQD5//n/DAAMAPP/8/8FAAUABQAFAAAAAgD5/wAABgD9//n/8//6/wYAAAD5/wUAAAD5/wUAAAAGAPn/AAAAAAAADAAGAPn/+f8AAAAAAAAFAAAAAAAMAPX/AAAGAPn///8AAAAABQD//wAAAADz//n/+f8DAAIA9f8CAP3//f8IAAIACQAGAAAA+f8GAAYA+f///wYABgAFAPj/+f8AAPn///8AAAYABQD4//n/AAD5//j/AAAGAPP/AQAFAAAABQD5/wAABQAFAAUA8/8AAAUAAAD5//P/DAAFAPn/AAAGAAAAAAAFAAIAAgD8//D/AAAAAPn/+f8FAAAABQAAAPn/BQD5/wAAAAAAAAUADADz//P/AAAFAAAAAAAAAAAA8/8AAAUAAAAFAAUAAAAFAAAA+f8AAAAABQAFAPn/+f8AAAAAAADz/wYABQD5//n/AAAMAPn/+f8LAAAAAAAAAAAAAAAAAAUABQAAAAAAAgD5//P/DAAAAPn/AAD5/wUAAAD5/wAA+f/5/wIA/P8JAAAA/P8CAAUAAAAAAAAAAAAFAAAAAAAFAAUA+f8FAAIA+f8AAAUA/P/5//n/+f/5/wAAAAAAAPn//P/8/wIACQACAAAABQAFAAUABQAAAPn/AADz//P/CQAAAPb//P8CAAIADwAAAAAABQAAAAAA+f8FAAAA+f8AAAAAAAAGAPP/8v8JAAAAAAAAAAUABQAAAAUA+f/5/wUABQAFAP3/+f8AAPn/AAAFAAAAAAD5/wAA+f8AAAAA+f8AAAUAAAAAAAAAAAD5//b/AgACAAIABQAAAAwABQAAAAUACQACAPb/9v/8//z/8/8AAPn/+f/5//b/AgAJAPz/CQAFAAAA+f8AAAUAAAAAAAAABgAAAAAAAADz/wAAAAAGAAAAAAAFAPn/AAD5//n/BQAFAPn/+f8FAAAA+f8AAAYABQAAAAAAAAAFAAUA/P/z//n/AADz/wIAAAD2/wkADAAAAPP/AgAFAAAABQAAAAAABQAFAAAA8/8FAAwA9v/5/wUAAAD5//n/AAAAAAAABQD5//n/AAAFAAAAAAAAAAAAAAAAAAAA+f8FAAAAAAAFAAAAAAAAAAUAAAD5/wAABgAFAP3/AAD5//n/BQAAAPn/+f8AAAwA+f/z//z/CQAAAAAAAAAAAAAA+f8AAAUABQAAAAAABQAFAAIA/P/5//n/AAAFAAUA/P8AAAAA+f8AAAUAAAAAAAAA8//5/wAA+f8CAAIAAAAAAPz/CQAAAAAABQAMAPP/BQAFAAUA+f/5/wUABgAJAPz/AgD8//z//f/w//L/AAAAAAYA+f/6/wAA+v/9//3/CAACAPz/CQD8//z/DwAFAPn/AAAFAAUAAAAFAAUACQD8/wIAAgD8//z/9v/2//z/AAAAAPn/+f8AAPn/+f8CAPz/AgACAPz//P8JAAkAAAAFAPn/BQAMAAAA+f8MAAkAAgD2/wIAAgD2//b/AgACAPb/7P/5//n//P8CAPz//P/8/wIAAgD8//3/+f8FAAgADwASAPn/+v8LAAUABgACAPb/+f8AAAwA/P/8//z/+f/5//n/BQAFAPn/8/8AAAAA+f8AAAAAAAAAAAAAAAAFAAAABQAFAAAAAAD5/wAA+f8AAAAAAAAFAAUABQD8/wIA/P/2/wUA+f/5/wAAAAAFAAAA+f8AAPP/AAAAAPb//P8CAAIA/P8JAAIAAgAJAAAAAAAMAAwA+f/5/wAABQD5//r/AAAAAAAAAAAAAAAA+f/5/wwABQD5/wAABQAFAAAAAAAAAPn/AAD5//n/BQAAAPn/AAAAAPn/AAAFAAAABQAMAAIAAgD8//b//P/8/wIAAgD2//z//P/5/wAAAADz//P/CQAAAPz/AgACAPz/CQAFAAAAAAD5/wUAAADz//b/CQACAPb/AgAPAAwAAAAFAAUAAgACAAIAAgD9//z/9v/2//3/7P/y/wMAAgD9//X/AgAJAAIAAgAJAAUAAAAAAAUADAD8/wIAAgD8//z/9v8CAPz//P/2/wAA+f8AAAAA+f8FAAAA+f/z//z//P8CAAIAAgACAAIADAD5//z/BQAFAAUABQAJAAIA9v/8//z/AgAJAPz//f8CAPD/9v8AAPn/8//w//b//P8CAAAAAAAAAAUADAACAAIAAgAJAAgACwAGAAYA+v8GAAIA9v8CAPL/AAAAAPn/AAAGAPn/+f8AAAAAAAD5//n/AgAAAPz//P8JAAwAAAD5/wUABQD5/xIAAgDw/wAAAAAFAAIAAgD2/wIA/P/2//n/AAAFAAAA+f/5//n/BQAGAPn/AAAFAAUAAAD5/wAABQAAAPn/+f8FAAAA+f8FAPP/AAAAAPn//P8CAAIA/P8JAAYABQAGAAUAAAAAAAAAAADt/wAABQD5//n/AAAAAAAA+f8FAAUAAAAAAAAABgAFAAAAAAAAAPP/AAD5//n/AAAAAAAA9v8CAA8AAAD5/wAABQAFAAAABQAAAAAAAAD5/wAAAAD5//n/+f8CAAAA/P8CAAIAAgAAAAAAAAAFAPn/+f8FAAAABQAFAAAAAAAFAAAA8/8FAAUAAgACAO//+f/5/wUABgD6//P/BQALAPn/8v/5/wUAAAAAAAUAAAAAAAAA+f8AAPn//P8CAPz//P8JAAIAAgAFAAAA+f8FAAAA+f/5/wAADAD5/wAABQD5//n/AAAAAAAA+f/8/wIAAgAFAPn/AAAAAAUADAD5/wAABQAAAPn/BQD5/wUABQD5//n/BQAFAPP/+f8FAAAA+f8AAPn/+f8CAAwAAAD5//n//f8SAAUA+v8GAAYAAwD8//b/AAAFAPz//P8AAAAA+f/5/wAAAADz//b/CQAJAAAA+f8CAAUAAAAFAAUA+f8FAAwAAgD2//z/AgD8//z/8/8AAAAA+f8FAAAAAAD5//P/AgACAAIABQAFAAUAAAAFAAAAAAAFAPP/+f/5//n/BQAFAAAA+f8AAAUA+f8AAPn//P8CAPz//P8JAAkA+f8CAAwABQD5/wAABgAAAAUAAAD6/wAABQAAAAAABQACAAIA9v/8/wkA/P/2//b/AAAAAAAA+f/5//n/AAAFAAAAAAAFAAUAAAAAAAAABQAFAAIA/P/2/wAAAgD5/wAAAAD5/wUA+f/5/wAAAADz//z/AgD8//z/CQAJAAIABQAGAAUAAAD5/wAABQAAAAUAAgD8//z/AgD2/wAAAADz/wAA+f8AAAAABgD6//n/BgAAAAAAAAD5/wAABgAFAAwA+f8AAAwA/P/8/wIA/P/8/wkA/P/w/wAAAgD2//n/8//5//z//P/8/wIA/P8JAAIA9P8JAAIAAgD8/wkABQAFAAAA+f/5/wUABQAAAAAAAAAFAPn/BQAAAPn/+f8AAAUAAAD5//n/8/8JAAwA8/8AAAUA+f/5//r/DADx/wAADAAAAAUAAgAIAPz//f/9//b/AwD2//r/AAD5//r//P/8//z/DwAFAPD/9v8JAPr/CgAJAAwADAAAAPn/BQAFAPT/+f8AAAQA/P/r/+v/+P/4//n/8P/m/9z/6f/U/9n/1f/Y/87/3P/k/+T/8v8vADUATQBYAFkAbQB+AG0AcABgAFgASAAYAAAAwf+j/3n/VP9E/zL/Mv9J/0D/SP9g/3n/ov9t/47/kP+Y/63/vf/o//3/HAA8AFYAgADwAAEBKAFBAakBuAEAApsBAgLkAZABWQEBAc0AXQCg/wD/gf4N/qT9WP1I/fj8GP3x/Bz9K/21/XD+of5Q/zEA5QCgARECwQJgA3EDbgN6AzIDtgIhAmoBtAAvAG3/8f6F/jj+AP7w/RX+IP5I/pj+DP8c/wn/KP9Q/yn//v4J/yj/Of9J/3v/zP8/AJoA5gBKAZgB4QEPAjoCJgIhAhMCvwFJAewAiAAQAK7/Pv9L/0j/Jf8Y/wv/Gv/u/q7+rP6e/qL+2P4G/2L/r/8CAHoA3ABUAc4BLQKIAqACnQKEAkMC1QFTAZcADgCR/+D+Uf7o/aL9af1j/Yj9wP3u/Sj+iP6g/qr+yP6z/o3+pf6q/rr+4v4Z/1j/vv9ZAOsAWgHqAWUCygL8AhoDPwMXA9oCewIIAp4BBAFsAPv/gf8E/+D+1/6p/n/+ff6J/or+Xf5N/lD+Lv76/Q7+Pv5c/pH+7P5Q/9r/TQDWAG0B3gE7ApICygLjAtACqQJSAusBZQHbAF4A+P+P/zf/GP8F/+3+uv6j/pn+fv5S/kH+Ov4T/uT98/0c/ir+YP6w/hj/g//r/4gAFQGIAQECdALAAu0CAgPjAsQCZAL9AVYB9ABlANf/ff9L/yL/6v6r/tX+ov5z/l7+YP5Z/i3+Nv4y/hP+Hv44/lT+jP7P/iL/l/8HAIkAEwGSAQUCYwK9AvcCAAPvArkCewL6AX8BFwGaACwA3f+X/0j/7P7F/q/+WP4x/h/+Hf4I/gT+EP4L/gz+LP5n/pD+zP4Q/2j/zP8yALgAOAGlAQgCZgK5AtgC0QKyAooCWgL6AXQBGwG5ADIA2v96/0H/6/6m/pf+hf5Z/kj+Lv5A/jr+QP5Z/lf+av6R/tP+8v45/4j/1v8wAHIA8gBBAYMBxAH5ASsCLwIWAgEC2gGeAW4BDwGlAFgAGACq/0L/IP/g/qr+f/5u/ob+gf5Y/nL+if6n/qv+sv7t/uz+Hf9O/4X/rf8GADkAcQCzAOgARwGFAbcB5gEFAiQCCQLmAcYBmQFgAf0AowBfABgAuv9c/yv/9/69/oj+Yv55/mP+Pf5S/nz+lP6L/sL+2/73/j7/cf/C/9//MABbAKAAygD4AEsBfAGiAcIB2gHcAcYBrAGNAV4BGwHQAI8AKgDk/5P/Pf8F/8v+t/6A/mb+YP5X/lT+b/6X/rv+3f4Y/zv/gf/H//f/KABbAIMArADSAO0AFQEvATwBSAE6AVYBLwEUAfYA0wCqAHIAUwARAML/pv9h/y//Ef/r/uz+y/64/r7+ov68/tT+Bv8o/1v/hP+U/9T/9f8uAFoAfACfALMA6ADlAAoBAgEKAf0A4gAWAe8A5ADOALoAgwBbAD8AAQDi/5//cf9m/yD/If/v/uP+4P7g/vj++P4g/yr/UP94/5X/0//w/yAAKwBtAGkApADCALQA0gDGAOUA0wDkANwAvgCwAJIAjgBdAEQAIQD+/8//q/+U/3z/Tf9L/yr/GP8S/xf/Hv81/y7/XP9Q/3r/lf+8/97/8f8bADAAQwB3AIYAmgCeAKMAugC4AL8AtQC7AKkAlwCUAHAAZwBSADwAGAD9/+f/0/+y/5j/cP9q/1j/RP82/zP/Nf88/0//T/9d/3P/lv+l/7z/5f8IACwAOgBbAHYAhgCfAKkAqgDAALEAqQCnAKMAbgB+ADYAQAAgABsA+f/a/63/v/+L/5L/bf9w/3D/aP9s/2z/Xf+T/4j/iP/D/63/3//1/w4AGgA+AF4ATwB0AIYAgQCcAIgAogCOAIAAmQBlAEAARgAGACQA+v8OAOf/mv+v/77/if+M/3X/jv9x/33/YP98/1j/mf+c/3j/0f+6/+r/CAAYAFwASwBkAHMAeACWAJkAlACYAJMAbgByAFUAJwAsABMAEADQ/7T/2v+K/6D/i/+B/3v/aP9y/2H/Wf97/57/gP+Y/9D/wv/4/x8AOABXAFoAfAB+AI0AyACOALgAlwCrAJIAhgBWAFgALwBDAAMAz/8AALD/ov+a/33/df9W/0n/QP8l/xj/Vf8x/zD/aP9t/5j/1v8AABMANgBuAJMAjgDwALYA9wDFANEA7QC6AMAAhQCDADoATAAAAMj/2f+I/z7/gP81/0n/Gv8m/zD/0/5C/1H/K/9g/5H/qP/I/y0AVgBOAHIAugDGAOYACgETASoB9gAhAfwA5wC0AJwAcwA4AP7/qf+Z/5D/K/9D//r+B/+o/or+8v7S/sb+2P4o/yP/WP/D//j/BgBIAJoAuwDgAFgBmQFRAV8BfgFfAVkBLAFYAdEAeABtANL/pP9q/z//Av/x/p/+b/4Q/mr+Nv4o/oP+rv6i/vP+c/+o/7n/MgCQALgA+ACJAbYBdwG8AdIBsgGPAYoBqgFZAecA4gCkAA0A3P/l/1D/GP+7/oz+Df4n/tz95f3y/bf95/0J/hT+ZP7O/j3/cv89APwASAHAAWYCvgKQAs8C+wKyAiwCGQL1AXkB1wC1AGMAkf9M/5j/5f6b/sL+oP7o/fv9rf0f/Rv98fwN/Q79gP33/U7+O/8UAK0AsAFoAhQDWgOhA98DoQNRAyADwQJCArYBSgGFABUAj/9v/+P+tv7P/kb+Ov7v/cj97Pwe/c/8WPyJ/PX8JP31/av+i/9NAHgBVgLyAqkDQARYBFUEKwSYAxUDYQLYAREBVgDz/1//If/L/qH+mf5H/kj+IP7F/Uz9Cv2d/Bj8Cfw+/Ff8Af3Q/bD+vf8bATUCNAMQBNwEDwURBcAELQQUA0oChAFqAIz/GP+P/mv+PP50/pj+iP7M/oP+Uf6i/Rr9lPze+4v7//vk+xf9uP36/j0A6QH/AiAECAU/BhMGOQbOBcgEnAOWAjIB2v/V/jb+hP2E/cn99/1t/s/+0P6e/gb+Q/2b/Kj7x/pg+xz7V/xY/an+ZgBKAtgDCQUfBksHCwePBlUGxgRGAygCgAD3/tn9J/2y/Fj8Nf1o/Qf+zf70/vT+z/4J/hD9WPxI+wP7I/t3+9H80P2D/5wBWQO4BPoFUAegB/kG8QbBBTAEsQIsAXj/Pv5j/cj8i/wY/Tj95f18/t/+5/7X/sL9Xv1w/Av7e/tT+8L7Kv2J/ur//AEDBC0Fdgb+B8wHRwcSB44FvwMrAkQAaP5E/Vv8ovvi+1/8p/yi/TX+qP7f/qj+uv0w/df7lfr8+qf6Mfv6/Hr+GwBgAp4E8wUsB8cIewjMB3QH2wWwA/wB3P/i/aj8t/si+4f7HPyk/Lb9y/4Q/5b/b/93/uT9Z/wD+7b7Avup+2/9lf4zAFwCaASvBdUGXAgqCH8HPgdLBUIDzAEe/7P9h/yY+2r76/s1/Or8R/4B/1b//P+e/6D+//03/NP6Sftv+g77I/1U/qIA9AIsBdwG/QdLCZ4I2gfGBk0ESwJkAMT9fPyS+8P6+vqO+xj8AP1u/jL/x/9EAP3/Fv+R/hD93/sa/IH72/u5/dX+oQDDArsEKAYkB2YIrgdEBxIGBwRPAn4APf74/Ef8XvuV+y78fPxg/b/+Y//H/0sA0//p/gv+lvxC+8z78PpY+zD9T/74/4MCfQS4BZQHlQjVB8cHfgYKBHgCjwAe/rb8Dvz9+jf78/tC/En9y/4+/7b/UAC//+H+S/64/Jv7F/yV+6D7hP2w/sH/iAJoBBUFIAdfCG0HnQfSBlgEDwOAAf7+Tv3J/FT7F/vS+7X7rPwy/sv+ev9XAPP/Qv/Q/kn94fsT/HX7HfuQ/A/+/P5NAdUDlQRUBjwIwwePB4wHZwWqA4YCMABC/of9U/x7+xD8E/xr/Mj9m/7Z/oL/if/4/nX+qP1Y/PD7KfyM+0T81f37/lEA4gJ9BEcFQgcRCGAHbwdrBjYE8QIxAaf+bP1k/G77a/sZ/ND7UP2E/tP+tv/z/03/7/42/rH80Ptq+zT7SftN/Nf9TP8PAUoD7AQlBv4H7QeRB6AHwAX4A84CYwB//qj9Vfzt+478p/za/HH+7P5C/3AA2/94/3j/t/26/Aj8WPtq+7D7gvw8/qr/KgElA70EiwUxB3UHsgYCB0sFZgNqAlIAPP6E/UT8jvsg/GL8avzI/QH/GP+SAMgABwBOACv/jP3J/Kf7LvsJ+2H7sfwo/lz/oQERBOsEFwcoCGcHqAfeBm8E9QJ1AdX+ev2W/EL77vqb+wr8Zfw5/lX/f/8YAeoANgBgABr/oP1x/Kf7B/vI+mb7n/wP/oL/CAKABDsFKAgICTwI6gixBzwFkwOfAcb+H/0l/LT6ZvoI+637Ofz0/Uv/vv/8ABwBqAB9AEj/6f14/Kf7D/u1+kT7g/wA/rD/6gEeBGgFNAdwCMMHhQeiBqcExwIuARD/W/0M/Kr7I/tI+7D8Sv0T/sb/kADDAHgB9QBTAKD/If6d/Ej7vfrM+u/6EvyO/cb/mAHrAwIGLAe3CCUJJwhEB9sFmgMSAX//Xv3A+2z6YPqe+i/7yfzO/fr+pAB7AaQBxQETAR4AEP9x/fH7j/oj+nf6+Pr++9/9KQAoAlkEVwZoB58I3gjIB5MGJwXYApUAwf75/IP7XPp1+ub6i/sS/UL+Rf/TAKcBywHUARoBHgAb/4r9BPyA+k36ovov+0T8Hv5sAJUCzQRWBqQHwQjsCBIIpwYmBdkC4gCc/tr8QftW+n36KPvz+4P9zv4NAKMBNAJGAgACHQHm/3f+L/1q++z5rvkN+sz6xvuK/c3/HgIhBMEFMwdNCKgIBAi4BmsFUgNUAQr/OP2Q+3j6fvrO+o378vxV/rD/TwEcAlQCgwICAugArf89/rT85Pri+ZP58/l++gP80f0wAKICZgQUBnoHYAgvCFIHRQahBJEChgCG/tj8rvvy+t76aftr/K392P5qAJ8BHgKNAnYCvQG1AIn/Vf7u/N77svrr+RT6zfrG+4n9gP+NAcgDWAWzBpMHHwjgB8YGfQXnA+0BCACY/i39T/zO+9H7Yvww/Uz+4/5X/7//qf/1/ygA//++/33/XP8m/xn/IP81/1r/kP/M/w4ATgB+AJ0AuQC4AKoAmAB/AE4AGAD0/93/wP+x/6z/sv/R/+T/8/8QACgANQDIAFgB+wGUAl4CLQJuAXgAJf///bz8Yvuc+kz6XPq++hz8dv02/0QBEQOUBOkFDgdWBx4HkwZMBa0DAgIgAFH+B/3v+2n7evv6+wf98P1D/3cAKQG+AfMBnwH1ACsAM//Q/dD8FvyI+/b6w/oE+9r7Tf3K/nUA9wGZAyIFIwbBBusGqQbtBdEELQOIAen/if5t/ZD8KvwI/Gz8Vf1h/oz/kwBnAdYB4gG0AdoA+f8L/zX+Jv2B/Ar8cPsf+0T79/sV/aP+GACAARkDrAS1BVwGxAamBgwGEgWeA+kBRwDq/rP9sfxf/Dr8mfx9/YD+uv+NAFkBvQHbAaIB/wAEANT+zP3k/BD8cfs1+xL7O/ur+6D85P2M/x0BQwKcA9UEiAXdBQAGngXoBO0DjAIVAcz/wP6+/Sv9Dv3//I79XP6J/5EAKAGrAdEBvgFiAbAAUf9G/nD9yPw5/L77qvvC+xP8efw9/Vj++/9fAVQCeANwBAkFZwVcBfkEVwRwA0YCBAHW/9X+CP5e/Tz9bP3Q/Vr+Qf9IANMATgF5ATgB7QB5AJD/k/7q/Ur97/y+/H38lvyZ/LD8IP26/Xf+uv8IAfUBDQMKBKgEHgVUBRUFwwTwA9cCmwF5AHr/fv6x/Yf9wf0X/oL+Dv/T/3EA/gAWAcoAkgAvAJ//x/4H/oL9Hf3h/N383fzw/O78HP2c/ST+8f4JAOEAtAGvAmgD7ANRBGMEJgTEAw4DHAIxAWEAlv/N/lD+S/5w/sP+G/+g/ycAoADwANIAlQA7ALb/Bf8//mz9Af3E/Lz85fwC/Qf9Iv3K/Uf+qP50/38AYQFsAlUD0ANgBMgE0ASXBPgDGwMwAkgBXACw/8z+P/4v/lv+vP4a/4j/CACRAOsAqQA8AN7/SP+1/hH+O/3t/K/8wPwL/Tn9Uf1k/en9WP6Q/kX/QAAuAT4CKgOmA10E4ARMBQIFPAQrAx0CIgFKAHj/UP6T/Zv9+v2A/iP/m/8wAPEAZwF3Ae4AKQB8/8r+N/6A/cz8lvyD/Ov8YP14/XD9fv32/Wr+iv5A/2wAcgHXAs4DKQRsBNQEIAW6BMgDXgIpAUMAqv/z/gf+cP2x/WL+JP/Q/0cAvwA4AYQBaQGqAL//Cf9d/uj9SP25/Jz8tPww/Yv9vf3o/fn9R/5p/nD+HP9XAI8B5QLNAzUEggToBC0FtASkAz8CDQEyAJv/6/7+/Xn9zf2T/mT/EACMABMBiAG2AXwBoACx/+v+Lv6h/QD9cPxa/MX8Lf2P/aP9xP0O/oz+Wf7Q/Q/+Vv/4AJkCNQOzA1sEYAX3BaoFYATnAv0BTAF+AF7/RP6w/Rb+1f4g/3X/5P+CABEBOAHiAB0Agv8c/5H+8P1I/cj82fxY/Z/9wP3Q/fH9aP7b/m3+rf3Y/e7+ewDyAVICqQKCA5oELQW+BK8DmwIoArAB0wCp/6r+av7R/kj/TP90/9b/fQAYAS8B4gA6AO7/rP8c/3D+2P1q/Y391f2v/Wj9V/11/ej9Tf7W/Tz92/0U/5oA1AFXAtECxQO1BAkFhwR3A5gCFAKJAZsAe/+U/o7+EP93/5n/5/9VAMIANQEhAZ4A//98/xD/Xv6x/WD9Y/2f/e39zv2Y/Zv92v1D/pj+KP6i/Tz+X/+wAL4BHwLWAvQD1QQIBWkEZAOJAu0B/gDV/7/+L/5V/vj+cP+k/yIAtQAwAWcBIQF9AM//TP/W/iv+pf2C/Yz9Gf6Y/sD+nf48/v79Xv7t/kz/HP8j/tn9qP67//MAoAEuAk0DOAR4BOwD7QL5AYMB2QCT/4H+8P3z/XD+5/4c/8L/vQByAa4BgQEYAY0AFQCx/x3/g/4I/hv+bP7o/h7/Af+7/kD+OP65/j3/of86/53+8v7j/6wAeQG0AUkCVQOYA2kD1wIlAroBWwGAAFD/bf7//fL9Ov5V/uj+EgAgAc4BMwL8AYQB6gA7AI3/DP+a/i3+Kf5w/tz+Ff+v/ir+of2l/SH+oP7+/qH+R/7D/vH/1gBAAVQB1wHDAk8DbgMFA0kC4QGJAcMA6v/4/kn+eP74/in/hf9YABYBtgH+AZQB+ABoANz/o/91/y3/wP4X/4r/o/8X/2n+7/3a/c397/02/un+GP/2/uz+a/8QAJIAjgDBALABgAIlAwMDUgLZAYYBHwFiAJP/xf6q/iX/eP+3/2sAMQGlAe0BVAGnAAUAZP+t/q7+yP6+/gj/WP92/xH/w/5q/jn+IP5H/mb+Af95/zf/6v4q/4D/xv/k/00AWAGNAh0D+AI9AjMC8gFgAUoAUf+O/sj+bf/a/w8AygCKAdYBuQHYABgAoP/0/oH+q/4O/yD/gv++/6H/Mv/b/jP+vf3J/Qj+af4p/9r/s/+g/97/JAApACgA8/9HAFgBHQPCAwYDjQJkAugB2gCo/9n+jv4x/yIAmADIAHABwgGOARsBFwDE/6f/6P59/rr+9v7b/vX+Gv/c/oz+Tv7V/YP9vP04/pT+SP+U/yz/QP/Q/z0AIwAmABcAVACQAW0D1AP8ArECkQLEAZIApv/9/rv+ev9zAMwAKQHQAf4BegG5AMn/U//g/kj+UP74/oX/i/+i/7f/Rv+s/mr++P2j/b/9Gf57/mn/r/8j/0f/2/8rAPz/0v+T/7v/NgEiA7MDLAMUA9MCEALiAML/G/8F/2n/BgBEAO4AmQGVARcBUABi/4T+P/6F/nj+nP52//j/sf8z/+3+jv7Y/a/9z/0E/nT+4/5V/wsApwDo/yv/Zf/9/2IAawAzACUAWAGEA2AEiwPAAl8C3AHSAJb/7v4s/+X/DwC3//D/mwDsAKsADgBH/97+Iv86/7r+1f6J/6P/Rv+t/rX+g/5P/nn+d/4+/kr+mv4I/9X/AQAX/+r+rf9gAIkAagDwAH0BFgOBBBwEBANCAuwB2gAiAKf/tf9pABoBAQHBAPoAsAAbAIT/+/6m/sH+Nf93/13/Kf8c/0H/BP+i/kb+EP4I/mD+qf6I/hj+Cv5h/oz/FQCH/5P/yv8KAOQAjQHOATcCcwJKAqkDlgQRBD8DKQIDAXUAVwCJ/zH/kv/Y/zAAmwCPAA8AxP9K/7L+V/5P/of+2f7t/rr+0P4G/9r+j/5R/g3+GP4S/vz9Mv7q/gT/+v6T/8T/ZAD+ALEAkwAvAZcBrgIcBCYEjwPYAqIBkwA+ALf/QP+O/8n/6v9XAHUAZABUAAAAdf8V/8/+z/4E/xL/RP+E/7r/Sv+r/iX+Ff4L/g7+X/7F/tf+jP5T/mH+bf84AA8ALwBIAGAACgF7AToBXQFkAUkBogLxA+QDfgP/Av4BYQGsAAb/Iv6M/vr+WP/b//r/HAAwAML/Iv+x/mn+f/7w/hz/Df8N/0f/+/6C/jr+OP4l/jD+If5f/hT/x/98/0H/gP8IAJYAmAAvAHQAUAEUAmMDgARuBPoDDAPvATYBlADQ/2r/cf+I/93/MABaAGAA/f9T/8b+gv6B/qP+v/43/8H/EgDH/1b/s/6C/mj+Tf6D/ub+xP50/kb+ef6m/1cAYACWAKoAfQDWACoB9wDZAKQAYAAKADABCQPYA5sDmQKUAQgBDAG+/zH+DP77/tf/XAA1AA0AOAAxAKP/zf5N/hj+eP4u//X+rP7w/iv/8f6T/mj+bv6Y/qD+iP6Z/lD/6f8sABQA5P9LAMYA5wDCALUAKAFDAuYD5gSUBLcDmALhAW4BjQCh/yz/T/+U//X/FQBKAG8AEQCC/4H+xf27/VT+vf4+/3v/k/9//0b/lP4d/qL9cv36/a3+Df/9/tD+xP6F/5EA0ACPAD8AawAQAdABlwHWADUA+v8ZALAA7QHbAloDMANXAmoBAQFoAIn/DP/p/jj/z/84AEgAJADz/3T/7f6C/mv+gP7a/hb/Fv8s/xP/5v79/g3/8v6U/kb+R/7W/rv/LwAPAJf/m/8bANoAFwGoAC4ACAAzAJkAlAG5AmoDdwPPArAB8AB8AAgAt/+N/3f/0f/+/yoALwArABgA4v9//w7/tP7Q/h3/Xf+F/3T/O/8E/8X+yP7s/vL+4P67/sD+Gv+w/x0A6v+G/5v/9/9vAJAAMwD2//n/6v8BACgAYQEAA/UDCgTYAn8B7ACnAFEAkf/G/s/+i/9NALwAhwBRAFAAQwDa/wb/Yf5a/s7+Xv9i/x//2f74/i//SP8X/5j+R/6J/vn+hP+g/4j/OP9e/4//2v+E/zD/7/4R/8n/swBBAowDQgQ7BIcDmQKuAQ0BXwDA/0v/bf+t/0YAwAD6AAYB1ABaALf/Nf/0/vn+IP9E/wr/2P6C/qD+vP6s/m7+Lf46/mD+uP7+/nj/AABxAKkAKQCR/1v/uf8sAE4A4f9H/1f//f94AQUDzQPeA0ADfwK9ATEBnwDw/3D/Xv92/83/QQBfAHsAawBSAAQAgP86//j+3v7Z/rz+o/6h/rv+vv6r/pH+Sf4i/mX+yP55/wQAPAAPAJ//ZP/D/zgATwAVAJn/YP/Q/+MAPgJQA+IDpQMEA08ClAEJAW8A0/9h/x//Q/+S/9r/NQBgAD8ADgDl/5j/K////u3++/4f/xD/+v7//gP/9v7d/sD+b/5R/pL+kf4B/47/JQBOACAA8/8BADMALgD2/5b/Xv/Z/wgBbQJfA74DWgO3AhECgwHoACMAcf8L/wj/Z//Q/yAAdwB2AFAAHgDR/2r/Ev/r/uj+4P7M/qv+tf7K/vH++P7Q/pP+av7I/kP/t//9/wUAr/9//4//3v8UAOL/hv8//2D/HwBjAbYCkAMEBMMDPQOPAtABAAEvAIv/GP8K/zX/ff/t/zQAQgA2AAcArP9B/+j+u/6u/pv+eP5//qH+9P4X/yH/7f6f/oL+hP4B/2f/q/+4/57/cf9Q/4T/3v8YAEcAQAB2AGcAswBMARECDwPKAwAEbQOoAuIBPwHEAF0Awv86//3+R//p/4wA2wCvABIAff8a/wj/7f6D/h7+zv3u/Xv+0f7n/p3+Nf4R/mv+T//6//z/vv9X/y3/WP+3/+z/3//A/77/KQBkAMAAKgGUAWkCPwPAA4gD2wIAAjABtwBbAA0Avf+D/3j/k//j/y4ALADw/4//Nv/m/sD+oP5s/kL+Mv5w/tf+JP86/xD/zf65/u3+ZP/O/+f/wv98/2j/jP/C/9n/xf+y/67/CwCzAIcBSQLrAlwDewNlAyIDuALpAQIBJwCh/3P/bP+S/57/pv+3/8T/rv+U/1D/y/53/iP+9/38/Q3+HP5C/j7+YP6Z/t3+Kf+G/8//EgA5ABsAzf+P/1f/R/9w/6j/8v8kAFUAnwD+AH4BDAKTAukC/gLGAoMCKAK9AT0BpgAUAML/ff+C/7X/0f/s/+r/0P+o/4b/H/+6/mD+Ff7z/fz9Kv5B/nX+if6p/uD+Kv91/6L/v/+s/4T/c/9+/53/7/8OACYAMgBUAKUALwG8AUkCqQIbA0oDMAPsAn8C8QFPAbAADwCq/1f/O/9O/2X/b/+W/7//z/+A/yP/uv4j/tf9nP2m/cr9+v0d/jj+ef7X/jD/cP97/3f/V/9b/4n/zP/z/9f/qf+J/+H/lABzATwCeAKMAqMC+gJjA54DfAPYAu4BAwFhACUAGAANANf/a/8W/wn/N/9Z/0j/+f5s/ur9mP2z/f39QP5q/nD+gP69/iT/fv+X/4X/Wv9X/5n/8P84AC4A7v+b/6//JgDWAKQBMAI4Av8B4wEDAn8C9gIsA8YC/AEgAVwA//8IAAQA9v91/7v+XP5c/pn+3/74/rT+KP6V/ZX95P1Z/tD+8P7T/rf+wv4a/3z/2f8BAOj/0/+w/7L/2/8OAGEAgQCpAOQAPQGKAd8BLgKNAsQC3gLYAqgCVwL4AVQBtwAPAIr/Jv/U/pj+cP5K/iH+Bv74/fX9Dv4q/nL+sP64/sf+qP7V/g7/Vv+b/6//rv/C/97/GABIAIwArwCwALgA0AAMAUgBkQHlAT0CagJyAmoCVwIPAo8BAQFrANb/Xv/3/p7+XP4i/gf+Af7//Qv+Fv5J/mj+zf41/5X/3f/E/7f/qf+e/7T/wf/h//H/2//9/zIAeADKAP4A7ADcANwA8QAsAYIB7gEdAuEBuAF1AUUBEAHMAHEA//+E/xr/zf6i/on+h/6I/l7+Nv4c/iD+Rf6C/v7+Z/+e/7n/cP84/0z/aP/I/w8AHwAiAAIA+/8+AIYA5QBFAUUBRAE5ASoBawGrAcsB4QHOAcQBrAGBAU4BDgGlADwA2P+C/zL/BP/e/qr+cf4s/vX92P3c/Q3+ZP6m/tj+E/8S/yz/cP+j////QgBQAEcAGwADABkAOwByAKkApgC4ALMAzAAUAUcBcQF+AWwBWAEuAS8BNQEuASkB9gCmAEcA2v+P/0j/KP8I/9v+vf6w/q7+t/65/sP+zv64/q7+vP7W/gf/QP9d/4D/lv+u/9j/CABBAGgAfACZAJwAmACmAMYADAFaAW4BbQFjAVABQAEYAQUB5wC7AIEARgBEAAcA1P+r/3X/Nv8Z/9/+0P7D/sT+tf7A/tn+5/70/un++f4Y/z7/g/+y/9H/7//n/9L/y//R//H/KABIAFgARgAzADMAaADUAEMBsgHkAdwBzAG4AZwBnQGPAXIBLgHMAH8AIADf/6b/av83/+P+oP5Y/jL+Mf5F/kX+Vf5u/nX+kP7G/gH/Kv9A/0z/Uf9y/8P/CAA6AGAAawB8AKQA+wBSAagByQG3Aa8BowG1AdUB4wHLAVsBBwGqAEgAIwD1/9D/j/9B//n+xP6w/qH+rP6u/qT+gP5o/nn+oP7R/t7+7f7y/vf+JP9y/6n/y//P/+f/FgB5APYAUwGkAbgBuQGvAZQBtwHxAf8B3wGeAVkB/gC8AKMAfwA3ANb/b/8r//r+7/7l/tb+v/6l/n/+Y/5x/oL+nv6c/pX+qf64/vX+Mf9R/1n/Yv9r/5j/7v9rAMEA/AArATMBTwFWAW4BlwGsAZ8BfAFYASoBBAHnAMUAjwBbACEA6f/D/6f/kP9y/1X/OP8Z/wL/8f7k/uT+0P7G/sj+yv7h/v3+9v74/gH/Gv9X/5//2v8QAEsAaQCOAMEA6gAcATsBWQFpAWUBbAFgAU4BJwEBAegAsACSAFYALQAAANf/tP+c/3v/R/85/zb/LP8i/zD/KP8Z/yD/Jf8c/w7/Ev8g/x3/Gf8X/yL/Uv+I/9T/FgBQAIEAnQDaABEBQAFVAV0BZwFZAUEBLQEOAdQAnQBzAEsAIAD//97/5f/g/8//u/+y/7D/t//E/7D/mf96/2v/Wv9K/yH/CP8A//v+EP8T/yD/Pv9o/5//6P8WAGIAigCqANgA+AARAS4BJAEMAQEB6QC8AJwAfgBfAC4AEAD7/+7/7f/b/8z/uP+q/7f/rv+s/6r/gP9c/1r/U/9H/zb/MP8l/yj/Jv8m/z//Xv99/67/+P8wAGwAoQDPAOMA6gDnAO8A+ADgALYAkABoAEQAJwAQAPT/4//N/9D/2//3//r/6f/1/wQA/v8OAAsA5//S/6b/hv90/1//Vf9B/y3/MP9Q/3P/j/+6/+H/FABDAFwAbwCIAJgApwC2AKwAngCIAG0AUAA5ABoABgDy/9z/2//h/+H/4P/m//j/9P/2/+b/2//R/9X/vv+w/6f/nv+h/6P/n/+h/6v/wP/c//j/AAAVACAAHQAwADgAOAApABoABAAKABAADAAAAAgABwALABoAHQAgABsAHQAiACYAJQAiABYABwD3//7/9v/i/+n/3P/a/+L/5f/a/9P/z//Y/+b/3//i/+n/9//9/wUAAQDw/+//8/8CAP7/8//u//n/BAD9/wAAEAATABMAFgAYABkAGAAhAA8AAAD2//f/BwD7/+j/6f/9//L/9v8DAAAA9v/5//v/+v8YAAIABwD6/+7/8P/j/9P/0v/a/+H/1//X/+j/9P/8/wUABAAXABUAEQAfAB0AJwAfABkADwAFAAMA+/8BAP3/AQADAAYAAAD3//v///8CAPL/6//w/+f/4//v//n/8v/v/+j/3//y//H/6//j//D/8//7//3/AAD//wMAEQAIAAYA//8FAAsA+////wAA+v/8/wAA+f///wgAEQAKABEAEwALABAAFgAYAAUA9f8GAAIA/P/n/+r/6P/o/+r/3f/e/+D/5v/r//r/+//5//z/9/8BAAMA8P/0//b/9//8//b/+P/8//X/9/8JABUABQAKABcAEwARABEABwAKAAgAAAD6/+7/8P/5//T/8P/k/+v/8f/w/+b/5v/v//r/AADy/+7/8f8AAAMABwANAAEAAQAMAAwA/v///wgAAwD4//n//f/9//X/AwD+//r/BgAEAPz//v8DAAIAAQD8/wIA/P/4/wAA/v8EAAEA/f/3//3//f/3//P/+P/5//n/+//2//3/BwADAAEA+P/4//r/+f/4//P/+P8AAPb//f/z////AwD9//3/9f/+/////v/9//X////9//r/+P/z//7/AwAAAPb/+f/8//j/8//4/////P/v//b/AwD4//T/9f8BAAIAAQABAAAABAD+//7//P/0////AgAFAP3/9f/4////BAD//wAA+f///wsAAgABAAAABAAAAAAABAAAAAEA/v/8/wAA+//+/wQA///9////AgAAAP3//v///wAABwACAAAA/v/7/wMAAAD9/wAABQD5//H//v8HAPv/AAAEAP////8EAAcAAwD9/wUAAwABAAAA/f8AAPr/AAACAP//9f/+/wAAAAAAAP7/BQACAAAAAAAAAPr/AAAFAAAAAwD8////+//3/wUA/v8AAAUA+P/+/wAA/f8BAPf/CAAHAAAA/P8FAAEAAwAIAPX/AwACAPn//f/+/wYAAAD7//3//f8EAAAA+f8JAAUA+v8BAAAAAAAHAP7/+v/8//f/BAADAPn/9f/8/////f8CAAIA+/8KAAgAAAABAAAA/v8EAAcABgAAAPv/BgAAAP///P8AAAEA9//3//3/+v/2/////P8AAAMA/f8DAAYA//8BAAAA/v8JAAMA/v8AAPz//////wUA+P///wQA/f8GAP3//P8AAAUA///6/wAA/f8GAPz/+P8CAAIA+v8AAAAA+v/9/wEA/v/6/wAAAgAFAAAA/P8EAAMABQAAAPv/AgADAAkABAD7//7/AgD9//7/AgAEAP3/+f8BAP3/9P8AAAAA/P/+//z//f8AAPX//v8AAAcABwD+//v//f8IAAAAAQABAP3/AQAAAP7/+/8CAAQA/v/8//3/AAACAAMAAwAEAAAAAAD5//f/+P/9/wAA+P///wEA/f8DAP7/AQAAAAMAAwABAP//AQAHAAYABwAAAAQA/P///wAA///9//r//v/z/wgAAAD8/wAA/f8LAAIA+v/1/wQAAAADAPj/BAAKAPn//f/+/wIAAAABAAIABAD9/wUAAAACAAUAAAD8/wAA+P8AAP7/9v/7//r//v/+//v/AgAAAAAAAgABAP///f/+//r/AQD+//3////8/wIAAAAAAAkADwABAP//AwD//wMAAQAAAAAA/f/8/wgAAgD7//r/8v/5//v/+//0//P//v8AAP7/+v8HAAoAAAAAAAQAAgAFAAcABQAEAAEABQABAP7/AAD9//j/AAD9////BAAAAP7//f/+//r/7/8AAAEA/v8AAAAABwD9/wAABwABAAEABAACAP7///8GAPr/AAAFAAgAAAAAAA8A9v/1/////P8AAPb//////+//+//+////AQD6//z/AwAEAAgAAAAAAAQABAACAPj///8EAP3/AgD8/wEABAADAAMAAwAFAPv/AAAAAAIABQD6//f/BQD///X/8//7//v/9f8CAP3/9/8AAAsAAwAAAAYAAgD+//v/BgAEAPn/AQAIAP///P/8/wAAAQACAPv/AQAHAPf/BQABAAAAAwD8//z//P/0//b/CQD8//b/AQAAAP3/AAAEAAcABgD9/wMACAAAAAYABwAAAAkAAgAAAAYAAADz//7/AwD3/wMA+P/3//P//v/5////BAD4/wAAAgAAAAcAAQACAPz/BwAHAAAAAADz//3/AAD8/wAAAAACAPr/AgAGAP//AgAEAAQAAgD+/wUA///8//3/AwD////////0//n/8/8AAAAA+v/9//7//v/2/wsACwACAAMA//8GAAAABgAMAP7//f8AAAUA+v/2//7////6//v//f8AAPf/AQADAPX/AwD+//v//v/+/wUA/f/9/wIAAgAHAAYAAgD8/wIABgACAAIAAAD//wQAAAAAAAIA+//4/wUABAD6/wEA/v/6//r/+v/5//v//f///wAA//8AAAgACgD8/wYA/v/+/wcABAD+/wQABAAIAP3/9/8DAP//9v/6//z/+f/9/wMA/P/8/wAABQD5//n/BQAGAPv//P8EAP3/AAADAAkA9/8EAAYAAAD///7/AgD4/wAACQD///3//f////n/+P8EAAAA/f8AAP7/+f/2/wQACwD+/wEABQADAAIA///8/wMAAAD9/wAAAQACAPr////y/wQABQD7/wAA///9/wIA//8BAAQA/v/7//3/+v8AAAAABAAFAAIACgD8//z/AQD+/wAA//8CAPv/9f/5/wAA+v/5/wQA+f/6/wAABgD6/wQABAD//wAAAQAHAPr//v8CAP///P/3/wEABAACAPb//v8FAAIA/v/9////AQABAPf/BgACAP7/9v/8/wUA/f/4//z/CQAAAPT/AwANAAAA//8BAAQAAAD8//v/AgAKAP7/BAAGAPv/AQAAAAQAAQD8//3/+f8AAAAA9P/6/wAABQD5/wAADAD5/wAABgD6/wAABQAAAAAA+//5/wMACAAAAPD//P8GAP//BAALAPr/BQAIAAIA/f/+//7/9//8////+P////r/+v/5//v/AQD9//j//v8IAAEAAgAIAAIAAgAFAAAA+/8AAAUAAAD5/woACwD9//v/AAAAAAAA///4/wUA+f/6/wAA9P8CAAQAAAD6//3/CAAEAPn/AAAAAAAAAAAAAAUA/////wAAAAAAAPT/+f8LAP//+f8AAAUAAAD7/wAABQAEAAUAAAAAAAAAAAD0//r/AAD///n//f8DAPz/AQAIAAYA9P8DAAUABAAFAPr/AAAFAAAA+v8GAPn/BAAFAPv/AAD6/wUAAgAGAAEA9//+//7/+v8AAP//////////BgDu//T/CwAEAPn/+v8FAAUAAAD6/wYABQD//wUAAwD6/wAABAAIAP3/8v/6/wQABwD8//f/+v8AAAAAAAAAAPr/+f8FAP//AAD6//v//f8CAAEABwAAAPf/AwD9/wIAAgACAAgABQAGAAAAAAAGAAAABQAAAAAAAgACAPb/+v8AAP//+f/5/wAA+v/6//3//P8OAAAA+v/9/wkA/P8CAAUAAAD6/wAABgAAAAAACwAFAAIAAwD9/wIA/P/8//z//P/8//f/7v/0/wgABAD//wAA+v/6/wMA/f/9/wIACAAFAAAAAAAAAAYAAAD6/wAABQAEAAUAAgD9//f/AAD//wUA/P/6/wAA+f8FAP//+f8AAPr/9P/9/wIAAQAIAAQAAAAAAAAA+v8AAAAAAAAAAAAAAAAFAAAABQAFAPr/+v/5/wUA//8AAPr/+v8AAAAABQALAAUA/f/6/wAABQD5/wAA+f/z/wUA+f/5/wIA/P8CAAIAAgADAP3//f8JAAUA+f8CAAUAAAD5/wAABQAFAPr/8/8GAAwA+f8AAAwA+f/z/wYAAAD5/wAAAAAAAAAAAAAAAPn/BQAFAPn/+f/5/wAABAD//wAA+v/6//b/CAAEAAAABQAAAAAAAAAAAAAAAAAAAPn/BgAAAAAADAAAAPn/AAAGAPr/8/8AAAUABQAAAPn/BQAAAAAA+f/5//r//f/9//3/CQACAAIADAAGAPr/+v8AAAwAAAAGAPn/AAASAPz//P8CAPz/9v/5//n/AADz//n//f/8/wIA/P8JAPb/AgAIAAgAAAD9/woAAAAAAAQACwD5//n/DAAAAAAABgAJAAIA9v8DAPb/8P8AAAAA+f8AAPP//P8CAPb/AgD9//3/AgACAAgACAACAPz/DAAAAPP/AwAAAAsABQAFAPr/+v8GAAUAAADz/wAABQAAAAAAAAD6//r/+v/8/wUADAD5//P/BgAMAPn/8/8FAAwA+f/z/wYA+v/2/wIACAAFAPn/+v8GAPn/BQALAAAABQADAAMA/v/2/wMACAD8//3//f/2//3/+f/5/wUA8//z//3//P8CAAIAAgD9//3/AgACAAIACQACAAIAAwD9/wIADAAMAAUA/f/9//3/AAAAAAAAAAACAAIA/f/9/wIA9v/2/wAABQD5//n/7f/2/wkA/P8CAAIAAgACAAkAAAAAAAYA+f8GAAUAAAAMAAIA/P8JAAkAAAD2//3/AgD9//z//P/w//n/AADy/wAA+v8AAP3//f/2//z/CQD8/wkACQD9/wkADAAFAAAAAAAFAAkA/f/2/wIAAgACAAkA9v/9//b//P8JAPb/8P/5/wAA+f/5//z//f/9//b/AgAJAPz/AgD9/wIACQACAAkABgD5/wYABQAAAAwA/f/9/wAAAAAJAPz/8P8AAAAABQACAPb/+f8AAAAA+f8AAAAAAAAAAAAA+v/5//3//f8DAAIAAgACAAIABQAAAAAABgAAAAUAAAAFAAAAAgACAAIA/P/8//3/9v/8/wAAAAAAAAUA+f8AAAAAAAAFAAAA7P/2/wkAAAAAAPb/9v8JAAIAAgACAAIACQAFAAYAAAAFAAUAAgACAP3//P/9//z/AgACAPb/9v8AAAAABQD8//n/8/8AAAAA8//2//z/CAAJAAgA+v/8/wkAAAAAAAAACwAFAAAABQACAPz/AgACAPb//P/8/wIA/P/2/wAAAADz/+z/AgACAPz//P/8/wkA/P/2/wkAAgACAAIADwAFAAAADAAAAAUAAgD2//z/AgACAPz//P/8//b/AAAAAPP/AAAAAPP//P8CAPz//P8CAAIACQACAPz/AgACAAIAAgACAPz/CQAFAAAABQAFAAUA/f/9//z/AwADAP3//f/2//z/AgD2//P/+f8AAAAAAAAAAPn/BQAFAAAA+f/z/wIAEgAFAPn/AAAFAAUA7P/z/wIADAAAAPn/+f8AAAwA+f/5//n/DAAAAPP/AgAAAAAA/P8MAAwABQD9/wIACQD8//b//P/8//P/AAAFAAAA+f/5//n/AAD5/wUAAAD5/wAA/P8CAAIA/P8CAAIADAAFAPn/AAAFAAYAAAAGAAIACQADAPb/8P8CAAIA/P/8//b/8//z//z/AgD2//b/CQAJAAIA/P8CAAkABQAFAAUAAAD5//n/BQAAAAwAAAD5/wAAAAAAAAAA+f8AAAwA+f8AAAAA8/8FAAUA+f8FAAwA/P/z/wAABQAAAPn/+f8AAAAA+f8AAAUA+f/2//z/AgACAA8AAAAFABIA+f8FAAIA9v/9/wIACQD8//3//f/2//n/BgD8//n/+f8FAAUA+f/5/wAAAAD5//n//P8CAAkA/P/2/wkADwAAAPn/AAAAAPn/BQAFAAAABQAFAAAABQAJAAIA/P8CAAkA+f/w//b/9v/5//n/AADz//z/AgD8/wkAAgD8//z/CQAJAPz/AgACAAUABQAFAAAAAAAFAAAACQACAPz//P8CAAIA/P/8//b/9f/5//r/+f/6//3/AgADAPz//P/2/wIACAACAAIACQAFAAUADAAAAPn/BQAFAPz/+f8FAPn/+f8FAAAAAAAFAAIA+f/z/wUABQAAAAAAAAD5/wAA8/8AAAAA9v/8/wIAAgACAAIAAgAJAAAAAAAMAAAA8/8MAAwA/P8CAAkA/P/2//z//P/8//z/8//5/wAA+f/5/wAAAAD2/wIA/P/8//3/AgD8/wMACQACAAIACQAAAAAABgAFAAUAAAAAAAUACQACAPb//P/8//z/AgACAPb/8P8AAAAABQAAAPn/+f/5/wUA+f8AAAUA+f/2//z/CQACAPz/AgD8/wkAAgD8/wIACQAMAAUABQAAAAAAAgACAAIA/P/8/wIA9v/8//z/9v/5//P/+f/8//b/AgACAPb//P8JAAkA/P/8/wkACAALAAYABQAGAAMA/f8HAAMA/P/8//b//f/2//n/+f/z/wAADAD5//n/BQAAAPn/+f8CAAIAAAAAAAAAAAD5//z/AgACAAIA/P8CAAkAAAD5/wwADADz//n/BQAAAAUABQAAAPn/AAAAAAAAAAAFAAAA8//5/wAAAAAAAPn/AAAAAAAABQD5//n/BQAFAPn/+f8AAPn/BQAAAAAAAAAAAAAACwAGAPr/+f8LAAAA7P8FAAAA+v8GAAAAAAD5/wAAAAD5/wUABQAFAPn/+f/5/wAABQD5/wAAAAD5/wAAAAAFAPn/AAAFAPn/AAAFAAAA+f8AAAUAAAAAAPn/+f/5/wIAAAAFAAAA+f8AAAAAAAD5//z/CQAFAAUAAAAAAAUA+f8SAAIA9v8CAAIA8P/8/wkA8P/s/wAABQAAAAAA8/8FAPn/9v8CAAMACQAAAP3//f8IAAsAAAD5/wAAAAAAAAUAAAAFAAUAAAAAAAIAAgDw/wAADwD8//b/9v8AAAAA8//5//n/BQD5/wIADAD5//n/AAAAAAAAAAAFAAUAAAAAAPn/BQAAAPn/AAAFAPn/+f8AAPP//P8JAAIAAgAAAAAAAAAAAPn//P8CAAkA9v8CAAIAAgAFAPn/BgAMAAAA+f/5/wYAAAD5/wAAAAAGAAUABQD8//3/8/8AAAAA+f8FAPP/+f8CAPz/CQAMAAAA+f8AAAAABQAFAAAAAAAAAAUAAgDz/wAAAADz/wAAAAAMAAUAAAAGAPz/+f/5/wUAAADz//n/AAAMAAUA8/8AAAAAAAAAAAUABQD5/wAABQAAAAAAAAAAAPn/BgAFAAAAAAD5/wUAAAD5//P/+f8FAAUABQAAAAUACAD2//n/AAD6//n/AAAAAPn/AAAFAAUAAAAAAAAA8/8AAAUA+f8AAAAAAAD5/wUAAAAFAAUAAAAFAPn/AAAFAPn/AAAFAPn/AAD5/wAAAAD5/wAABQD5/wUAAAAFAAUAAAAAAPn/AAAFAPn/+f/5/wUAAADz/wIABQD5/wAAAAAAABIAAADz/wAA+f8AAAAA+f/8//z/AgD8/wIAAgAIAPz//f8PAAYA+v8GABIAAgD1//n/AAAFAPz/AgD2//n/AAD5//n/AAAAAPn/BQAAAOz/AgAPAPn/AAAAAAUAAAD5/wUADAAFAPz/8/8AAAwAAAAAAAAA8//5/wAABQAFAAAAAAD5/wAABQD5//n/AAD5/wAABQAMAAAA+f/5/wAADAD5//n/BQAAAPn/AAAFAAUAAAD5//n/AAAFAAwAAAD5/wsAAgACAPb//P/2//n/+f8AAAAAAAAAAPn/9v/8/wkAAgD8//3/CQACAAIAAgAFAAwA+f8AAAwAAgDz/wAAAAD5/wAABQAMAPn/AAD5/wAA8//2/wkA/P/2/wIAFgAAAPn/AAAAAAAAAAD5//3/CQAAAAUABQAAAAwAAgD2/wIAAgDw//P/BgAFAPn/AAAFAPn/+f8AAPn/AAD5/wAAAAAAAAAAAAAAAPn/AgAGAAAAAAAAAAAABgAFAPP/+f8AAAUAAAAAAAAAAAD5/wUAAAAAAAAA+f8FAAAAAAAAAPn/AAAAAAAAAAAAAAAAAAAFAAUAAAAAAAUA/P/5/wYAAAD5/wAAAAAFAAUA/P8AAAAAAAAAAAUAAgD2/wAA+f8GAAAA+f8AAPn/DAD5/+z//P8CAA8A+f/2//3/CAAJAAMABQAAAAYAAAAAAAUABgACAPL/AAAFAAAAAAAAAAAABQACAAIA/P/2//z/AAD5//n/AAD5//n/AAAAAPz/CQAMAPn/+f8AAAYABQAAAAAABQAFAPn/AAAFAPn/+f8FAAAABQAAAPn/AAAFAAAA+f8AAPn/+f8AAAAAAAAAAAAABQAFAAAA+f8AAAAABQAAAAUAAADz/wUAAADz/wYACwD5//r/+f8GAAAA8/8FAAAAAAD5/wAABQD5/wAABQDz//z/CQAFAPn/DAAGAAAABgAAAPn/BQACAPb/AAAAAAAAAAD5/wAABQD5//n/BQAFAAAA+f8AAAUAAAAAAPn/+f8FAAwA+f8AAAUABQD8//n/BQAAAPn/BQAAAAAABQACAPb/+f8AAAUAAAD5/wAAAAD5/wAAAAD5/wUAAADz//z/AwADAAcAAAD9/wYA+v8GAAsA+f/5/wAADAAAAAAAAAAAAPn/+f8FAAAAAAAAAAUABQD5/wUAAADz//n/AAAAAPn//P8JAPn/BQAAAAAABQDz/wUABQASAPz/9v8JAPz/8P/5/wUAAADz/wAAAAAAAAAAAAAFAAAADAAAAAIA/P/5/wAAAAAAAPP/AAAAAOz/CQASAPP/AAAAAPn/AAAAAAUABQAAAAAABQD5//r/BgAAAAAADAAAAAAAAAAAAAAABQACAPb/+f8AAAUAAAAAAAAA7P/5/wIABQAAAPn/AAAFAAAA8/8CAAUABQD5/wUADAAAAAAAAAAAAAUA/P/5/wAA+f/5//n//P8CAAIA/P/2/wkACQACAAAABQAAAAAADAAFAAAAAgACAPb/+f8AAAAAAAAAAPn/+f/5/wYABQD5/wAABgAGAPL/+f8AAAAAAAAFAAAA8/8AAAAAAAD5/wIAAgAFAAUAAAAFAAUAAgD8//n/BQD8//n/AAD5//n/BQD5//P/BQAMAAAA+f/z//z/AgD8/wIAAgACAAkADAAFAPn/+f8AAAAABQAFAAAAAAAAAAUAAAD5//n/AAAAAAAADAACAPb/AAD5/wAAAAD5//n/AAD5//z//f8CAPz/AwAJAAIABgAFAPn/AAAAAAAAAAD5/wUABQAAAAUA+f8AAAUAAAAFAPz/+f8AAAUA+f/5/wUABQACAPP/+f8AAPn/+f/8/wIAAgACAAIAAgAFAAUAAAD5/wAADAAAAAAAAAAFAAAA+f8AAPn/AAAAAAUABQD5//n/AAAAAAUAAAD5/wUAAADz//n/AAAFAAUA7P8CAPz/CQAFAPn/AAAAAAYABQAAAAYA+v/5/wAAAAAAAAUABQD5//n/AAAAAPn/AAAFAPn/8//8/wkAAgD8//z/CQACAAAABQAAAAUA7P8CAAUA+f/8/wkADAAAAAAAAAAAAAUAAAAAAAAAAAAJAPb/AAD5//n/AADz//z/AgACAAUAAAAAAAAAAAAAAAAAAAAMAAUA+f8FAAAA8/8AAAAAAAAAAAAA+f/5/wYA+v/5/wMABgAAAAAACwAFAAAAAAD5/wAAAAAFAAAAAAAAAPn/AAAAAAAAAAAAAAAAAAAAAAUABQD5//n/AAD5/wAADAAAAAAAAAAAAAAAAAD5//n/BQAFAAAA+f8AAAUA8/8AAAUA+f8MAAUA8//5/wUABQAFAPn/AAAFAPn/AAAMAPz/+f/5/wAABQAAAPn/+f/5/wAAAAD8//3//f8CAAkAAwD9/wIAAgADAAMAAgAGAAUABQAAAPn/+f8MAAYA+f8FAAAAAAAAAAAA+f/5/wAAAAAAAAAAAAD5//P/9v8JAAkAAAAAAAAADAD5//n/BQAMAAUA/P/8//n/+f8FAAUAAAAAAPP/BQAAAOz//P8CAPz/CQACAAIAAAAFAAwABQD5//n/AAD5//n/+f8CAAIAAAAAAAAABQAAAPn/BgAFAAUABQD9//3//f8AAPr/AAAFAAIA+f/5/wAA+f8GAAAA8/8AAPn/AgAFAPn/AAAAAPz//P8JAAAAAAAFAAAABQD5//n/AAAFAAUAAAAAAPn/AAAAAAUAAAAAAAUA+f8SAAkA8P/2//n/+f8AAAUAAAD5//P//P8MAAAAAAAFAAYAAAD5/wwAAADz/wAABQAAAPn/AAAAAAUAAAAAAAAAAAD5/wAAAADz/wMAAAD8/wIACwDy//z/DwD5//b/AgAJAAAA/P8CAAUADAAFAPn/BQAFAAIA9v/5/wAAAAAAAPn/+f/5//z//P/2/wkACQACAAIAAAAFAAAAAAAAAAUAAAASAPz/9v8JAAIA9v/8/wkA9v/2//3/+f8FAAAA+f8AAAAAAAAAAAAA+f/z/wIABQAAAAAAAAD5//z/9f8IAAIA/P8JAAcABgAAAAUA+v8AAAsABQACAPz//P/2/wAAAAD5//n/+f8FAAAAAAAAAPn/AAD5//z/AgD8/wIAAgACAAkA+f/8/xIABQD5/wAAAAAAAAAA+f8AAAUAAAAFAAUA/P8AAPn/+f/5//P/AgACAAUABQD5//n/BQAFAAAAAAAAAPn/BQD5/wAAAAD5/wAAAAAFAAwA+f/5//n/AAAFAAYABQAAAPn/BQAAAPr/BgD5//L/AAD2//z/DwAFAAAAAAAGAPn/AAAFAPn/+f8AAAUABQAAAAUAAAAAAAUAAgD8//z/AgDw//n/+f/5/wAAAAAAAPn/DAAAAPP/AAAAAAwAAAD5/wAAAAAAAAAABQAAAPP/DAAFAAAAAAAAAPn/+f8FAAAAAAAAAPn/BQAFAPn/+f8FAAUA8v/5/wYAAADz//b/DwALAPr/+f/8/wIA/f8CAAIABQAMAAAA+f8AAAAAAAAFAAAA8//5/wUAAAD5/wAAAAAAAAAAAAD5/wUADAAAAPn/+f8AAAAAAAAFAAUAAAD5//n/BQAFAAAABQD8//n/AAAFAAAAAAD5/wAABQD5/wAAAAAGAAUAAAACAPP/8//2//z/CQACAPb//P8JAAkA/P/8/wIADgAAAAUABQAAAAAAAAASAAgA/P/9//3/9v/2/wAAAAAAAAAA+f8AAAAA+f/5//n/BQAAAAAABQAAAAUABQD5//n/AAAAAAAAAAAAAAAAAAAAAAAABgAAAAAABQAAAAAAAAAAAAAA+f8AAPn/AAAAAPn/AAAFAAUAAAAAAPP/+f8FAAAAAAAAAAwAAAD5/wUABQACAPz/8/8AAAUAAAAFAAkA/f/8//b/AAD5//n/AAD5/wAAAAD5/wAAAAAFAPn/+f8FAAUAAAAAAAUAAAAMAAkA/P/w//n/BQAAAPP/8//8/wIA/P8CAA8ABQAAAAAAAAAAAAAAAAAAAAAA+f8AAAAAAAD5//n/AgACAAAABQAMAAAAAAD5/wUABQAAAAAA+f/5/wUADAD5//n/+f/5/wAAAAAAAAwA+f/5/wUABQAAAAAABQAGAAkA9v8CAP3/9v/8/wgAAgDq//P/+f8AAPb/8P8CAA8AAgD8/wkADAAMAAUAAAAAAAIA/P/9//z/+f/5//n/AAAAAPP/AgACAAIAAAAAAAAAAAAFAAAA+f8FAAUAAAAAAPn/AAD5/wAADAAAAPn/AAAAAAAAAAAAAAUA+f8FAAAA8//5//z/AgACAAIABQAAAPn/AAAAAPn/AgAAAAAAAAAAAAYA+f/6/wAABQAAAAAAAAAAAAUAAAAFAPn/AAAFAAUAAgDw//n/BQD5//P/AAAAAAUABQAFAPn/AAAFAAkA/P/z//n/AAAFAAUAAAD5/wUACQD8//b/+f8AAAUA+f/5//P/AgAFAAAAAAAAAAAAAAAAAPn/AAAMAAAA+f8AAAAABQDs//z/CQAAAPz//P/8/wIADwD5/wIABgD6/wAABQALAAYA/f/8/wAAAAAAAPn/+f/5/wAAAADz/wIABQAFAAUA8/8AAAwABQAAAPn/+f8FAAAAAAAAAPn/+f/5//b/CQAFAAAABQAGAAAA+f8MAAUA/P8JAAIA9v/8/wIA9v/2/wAA+f/5//n/+f8CAAIA/P8JAAwAAAAFAAUAAgAJAPb/9v8CAPz/+f8AAPn/+f8AAPn/BQALAAAAAADz//r/BgAGAAAABQD6/wYABQAAAAAACQD8/+z/+f/5//z/AgD8/wkAAgD2/wkADAAMAAAAAAAAAPP/AAAMAAAA+f/z/wAAAAAAAPn/AAAFAAAABQAAAAUABQD5/wAABQD5/wwAAgD8/wIA8P8AAPn/8//5/wwABQAAAAUA+f8AAAUABQD5//n/AAAAAAAAAAAFAAAA+f8AAAUAAAD5//r/AAAFAAAAAAD6/wYACwD5/wAADAAJAPD/AAAPAAIA9v/w/wIA8//5//n/AAAAAAAA9v/8/wkAAgAJAAUAAAAAAAwAAAAFAAAAAAAAAPn/BQAFAPn/8//5/wAABgD5//n/AgD8/wIAAgACAAIA/P8CAAkA+f/8/wkAAAD8/wUABQAAAPn/+f8FAAUAAAAAAAwACQD2//z/AgD8//3//f/8//b/+v8AAAYAAAAAAAAABgD5//L/BQD5//n/BQAAAAAABQAFAAUAAgAJAAIA9v/2/wIAAgD2//z/AgD8//b/+f8FAAUA/P8AAPn/+f8FAAUA+f/5/wAA+f/5/wwAAAD5/wAABQAAAAAAAAAMAAAA8/8SAAIA8/8FAAkA9v/5/wAA+f8AAAUA+f8AAAAA+f8AAPn/AAAAAAAA+f/9/wIAAgADAAkABgAAAAAABgAFAPn/AAAAAAUABQACAPz/9v8CAPz/+f8AAPn/AAD5//n/AAD5/wIAAgD8//z/CQD2//b/AgAJAAIAAgAPAAAAAAAFAAUABQD5/wAAAAAAAAAAAAD5//P/BQAFAPP/+f8FAAAAAADz//z/CQD2/wIADwAAAAAAAAD5/wAAAAAFAAAAAAAFAAAAAAAAAAAACwAIAAIA9v/p/wAAAAD6/wsA+v/5//n/AAD5//z/CQAAAPn//P8CAAwAAAAAAPn/BQAMAAAA8/8AAAUAAAAFAPP/+f8FAAYAAAD5//n/8/8JAAAA/P8FAAAABQAFAAAABQAFAPz//P/5/wUA+f/5//n/AAD5//b/CQD8//b//P8CAAIAAgAJAAwADAAMAPz//P8CAAIA/P/8//b/9v/5//P/AAD2//z/AwD9/wcAAwD2/wkACAD9/wgABQAFAAUABQD8//z/AAAAAAAAAgD8//z//P/5/wAAAAAAAPn/AAAFAAUAAAD5//n/+f8AAAUAAAAAAAAA+f/5//z/AgD8/wIA/P8CAA8ADAAAAAAAAAAAAAwACQACAPz//P/8//b//P/8//n/+f8AAAAAAADz//b/AgAJAAIA/P8CAAwAAAAAAAAA+v/5/wUACwD5//r/AAALAAYA+f8FAAAAAAAFAPz//P8AAPn/+f8GAAUA+f/z//n/AAAAAAUABQD5//n/BQAAAPP//f8JAPb/AgAJAPz/AgACAAIAAgAAAAAAAAAAAAAADAAMAAIA/P/8//z/AgACAOn/8//5/wAA9v8CAAIAAgACAAIA/f/8/wIAAgACAPb/AgAPAPz/AgAFAAAABQAGAAUAAADy/wAABgAAAAAABQAAAAIA/P/5/wAAAAD5/wAAAAAFAAAA+f8AAPP/AAAAAAAAAAAAAAAAAAD5//b/AgAJAAUAAAAFAAwACQACAPz//P8CAPz/9v/8//3//P/5//n/8//5//z/9v8CAPz/9v8FAAkAAgACAAkACQAMAAUABgAAAAAAAgD8//z//P/8//P/AAAFAAUAAgDy/wAABgAAAPn/8v8GAAYAAAAAAAAAAAAAAPn/8//2/wIACQAJAAAAAAAFAAAAAAAFAAUA+f8AAAAAAAAFAPn/AAAMAAkA9v/8//z//P/8//P/AAD5/wAA+f/8/wIA/P/8/wkAAgD8//z/AgACAAIACQAGAAwADAD8//b/BQACAPz/AgD8//z//P/8//z//P/8//n/8/8AAAUA8//2/wIAAgAJAP3//P8DAP3/CAAHAAUAAADy/wYA+f8AAAAAAAASAAkA/P/8//z/AgACAPb//P/8//b/AAD5//P/AAD5//D//P/8/wIAAgD8/w8A/P/8/w8AAgACAAwABQAFAAkACQACAAIA+f/9/wIA/P/8//D//P8CAPD/8//5/wAAAAD5//z//P8CAAIA/P/8/wIA/P8JAAkADAAMAAAA+f8FAAAAAAD5/wsAAwDy/wYAAgD9//z/8v/5/wUAAAAFAAUA+f8AAAAA+f/z//b/AgAJAPz/9v/8/wIA/P8CAAkAAgACAAIAEgASAPz//P8JAAIA9v/8/wIA/P/8//b/9v/5/wAA+f/5/wAAAAD2//z/AgACAAIACQAFAAAABQAAAAAAAAD5/wAABQAAAAAAAAD5/wAABQD5//n/BQD5/wAADAAMAP3/8/8AAAYAAAAAAAAABQAAAPr/AAD5//L/AAAAAPz//P8CAAkAAAD8/wIABQAGAAUABQAAAAUAAgD8//3/CQD2//b/AAD5/wAA+f/5/wUAAAD5//P/AgAJAPb/CQAFAAAA8/8CAAwAAAAMAAUA8//5//n/AAAAAAAABQAAAAAAAAAAAAUA8/8AAAUAAAAAAPn/BQAFAAUA+f8AAAUAAgACAPD/8v/5/wAA+f8CAP3/9v8CAAIADwAAAPz//P/2/w8AEgAFAPn/+f8AAAUABQAFAPz/+f/5//n/+f/w//z/AgACAAIAAgAJAAYA8//8/w8AAAAAAAwAAAD5//n/BQAMAPn/8//5/wAAAAAGAAAAAAAGAAAA+f8AAAUAAAD5//n/BQAMAAAAAAAAAPP/+f8FAAAAAAAFAAAA+f/5/wAABQAGAPr/AAAAAAYA+f8AAAYABQAIAAIA/P/8//z//P/8//z/9v/s/wAAAAD5/wIABQAAAPn/9v8CAPz/AgAJAAIAAgACAAAAAAAFAAwA+f/5/wAAAAAAAAAAAAAAAPP/AAAFAPn/AAD5/wIABQD5//z/AgACAAUABQD5//P//P8PAAUA8/8AAAUAAAAFAAAA+f8AAAAABQAFAAAAAAD5//n/AAD6//n/AAD9//3/AwAIAAAAAAAAAAAAAAAAAAYABQAAAAAABQACAPb/+f/z/wAABQD5/wAAAAAAAPP//P8CAAIA/P8CAA8AAAD5/wUAAAAAAPn/AAAMAAAA+f8AAAwA+f/5/wAAAAAAAAAAAAD5/wAA+f/5/wIA/P8CAAkAAAD5/wIAAAAAAAUABQAAAAAADAD8//n/BQACAPz/9v8AAAAABQD8//L/+f8AAAAA+f8AAAAA9f/8/wIAAgASAAUA+f8AAAUAAAAAAAUA8/8AAAAA+f/5//z/CQAAAAAABQAAAPn/+f8AAAwABQD5/wAAEgD8//P/AAD5/wwA+f/s/wAABQD5//z//P/8/w8ABQD5/wAABQAAAPn/DAAFAAAABQACAPb/AAAAAPn/+f8AAAUA+f8AAAAAAAD5/wAAAAAGAAUAAAAAAPn/AAAFAPn/AAAAAPn/8v8CAAIA/P/8/wkADAAFAAAA+f8FAAwA/P8AAAIAAgACAAIA/P/2//z/9v8AAAAA+f/5//n/BQD5//b//P8JAAIAAgAFAPb//P8JAAkAAAAFAAAAAAAFAAAA+f8AAAUABQAFAPn/AAAFAPz/+f8AAAUAAAD5//n/+f8FAPn/+f8AAAAABQAFAAAA+f/6//n//f8CAAIAAwADAAIAAgAFAAUADAACAPz//P/8/wIA/P/2/wAAAAACAPz/+f8AAPn/+f8AAPn/AAD5//b/AgACAAIA/P8CAAIACQAFAAUAAAAAAAUABQACAPz/+f8AAAAAAAD5//n/BQAAAPn/BQAAAPn/AAAAAPP//P8CAAIAAgACAPz//P8JAAUADAD5/wAAAAAAAAAABQAAAAYAAAADAAMA/f/9//b/AwD8//n/AAAFAPn/+f8FAPn/+f/5/wAAAAAAAAAAAAAAAAwABQDz/wAABQAFAAAAAAAJAPz/9v8AAPn/BQAFAPn/+f8FAAAA7P/8/wkA+f8CAAIAAgAGAAUAAAAAAPn/AAAAAAAA8/8CABIA+f8FAAAA+f/5/wUABQD5/wUABQAAAPn/AAD5//n//P/c/8z/w//g//j/TgBAAEMAQAAiAEMARQAxAIoAYAAgAPD/sP+N/4D/af/u/9n/Uf99/3H/GP+O/8D/+P9ZAHQAVAEbAZQAYgAsAAQA/P/6/wQARACk/7T/mf9l/4H/gP9Y/4v/rP+q/9b/AQCM/xEAAQD4/0AAWABoAJUAlQB9AIEAmAB8AHIATgAxACcAHADm/9z/yf+p/6X/iP9r/1j/ov6Y/gr+3f0G/lX+Nv4f/9f/1gCSASICuwLoAtoCmAJpAjICxQE/AeIAUgDA/+3/bf8d//D+qf5w/kD+i/2A/d38xPwa/H78EPwH/PX8Kv64/4gBpwIHBD4FFgZSBigGSgVlBE0D8AHAAOf/Df9T/+r+Bf8C/7P/kP86/zX/vf6R/h/+pf1N/TD93fwA/Or7uPsY+zL7TfwK/bj+9f8dAoEDxASPBUoGeAayBcYEiANaAvMAAwDB/pn+1/7s/lr/CQDnAAABJwESAcQAUwAz/1v+B/48/Uz8r/uR+zb7uvpB+yf8Jf3W/pUAKQKDA7oEdgW5BXcFAwVOBFMDNgI6ATEAiP8H//3+Ff9w/wUAZwDHAPUAAAHLABMAPf+8/ur95fwF/KL7MPus+qb69vqN+9f8qP40AMYBpgPFBIsFAQb8BVsFdgSuA4MCSwFeAGj/vv5U/kL+hv7c/pb/GQCJANcAmQCAAOf/Af9g/tP9M/06/O37wPtk+4H7mPv2+w/9yv4oAG8BtAJgBEYFvAXBBZIF0ATkA/gCvgHGAMv/M//G/pL+1v4a/5D/HAAoAJgAhAAnAMj/GP++/hT+tP0o/Yz8fPwp/Br87Pv2+5D8tv0K/0QAQwGGAroDkgQIBQQFwwQoBJADogKkAcoAQAC6/0f/Kf91/6D/wf8HAA8AYgAAALf/Pv+0/mv+2v2t/RD9QPxs/CL8Bvz++0n8YP3h/oMAuAG4AusD8ASKBYAFNgWuBMsD6ALZAbQAuv83/8b+a/5T/r7+Wf/a//T/NwC/AJoAMQCW//D+a/6f/TD9n/zA+6P7bfui+wX8ZPyu/af/qAHmAp0DkwRRBeEFpAXNBMAD5QIcAsAAT/+D/kL+If7+/Tn++v4KAKUAygBGAV0B7QAeAAT/SP6W/Qb9zPwU/Kb7qfuw+/P7EPyr/Iv+0ACvAm4DMgQIBREGkAbXBaUEoAP2AvwBfwD//kD++f3R/cr9NP4i//T/lABLAX8BJQGJAGz/i/6w/Qb9wvwN/JT7lvuP+237Ovut+yn9uf/+AR4D9gP9BCAG/QagBmYFDAQmA2ECGAF9/0D+1f0W/nT+mP7f/sD/zwDoASwCfAGMAHj/jv7E/Yb8+fua+zj7QPtd+3D7PvtL+2X85v63AT8D5wOVBI8FwQYQB/IFVgT3AjYCXAHo/2z+j/2+/ZP+Pf9X/7v/5ABZAkwDvQJ9ASUABv9y/mj9O/yu+2j7nfvT+6j7PPve+nz7qP25AN0CnAP2A50EwQW7BjwGmwQIAxMCjwGIAOr+pv0Z/ar9lP4P/0f/IQCkATEDngNLArMAXv+K/tX9Xvx3+wH7I/uq+7z7Ufut+oD6nfuo/iwCNQTWBF4FZQbqByQIeQYwBIUCvQHbAEX/mP27/BP9PP4C/zv/zf8pAeIC9QMWA1wBvv+p/gP+qfyC++H6n/oZ+1/7Fft8+vz5BPsp/vUBvgQ2BUIFGwbXB5cI6gZOBNkBuQA8ACD/Yv0O/Bv8af32/pL/5f+uACUC0wMgBK4CxwBN/6j+uv1Q/EX7l/qt+jn7Z/v/+kD6avqQ/EYA0AMJBccEJgXDBowIDAg0BUgCwQC9ABgAFf70+3D7s/yJ/sb/+f9KAHgBRwOCBAAEAAJhAHD/AP/Y/f/71Ppw+tX6PvtP+6H6A/qA+tv8sAAKBBMFrgQfBb8GTQiCB8gEFALbAOoADADn/Qn89fti/f7+qv/P/5AAUgIdBJ4EeQN/AWsApf+i/tT8Pvvo+jj7k/ty+0/78/qC+sT6ifzc/yYDeAR4BEcFBQdwCJEHIwXmAssBZgHY/5T9IvxI/GT9W/7D/in/aAAwAqoDIgQ4A6cBqgC5/2n+kPxN+z37hPuc+3L7fvti+wP7Gvur/NL/8AIbBCsEGQXcBhwI+wa0BBoDWwK8Aez/lP13/P/86v0E/gf+5f7LAHgCRgN9A1wDjwJbAQ0AQ/6y/Iz7hvuv+3P7Nvt5+//7lvvE+kb7Hf6/AVYDDgPHA2wGZAi2ByAF3wMVBLgDPAF8/lD9uP0b/kr9mvzL/QQAdAGhAa8BwAJkAxwCDADf/if+lP1i/If7lPv9+yT85fuv+zv7x/qU+z/+QAGHAvMCgwQ9B14IcgevBWUFeAXpA5YAbP7n/cT9HP2A/PT8v/54AOoAEwETAmkDWQNWAaL/Jf8O/or8HPvO+kf73fsD/PL7Sfwn/Kj7yvuD/uoBQgMuA3gEOgeECGIHWgVNBTcFugJN/xj+7v0d/SL8Nvxc/fX+IQCOACgBhAKuAy0DuAEGAasAJP8//RD83/vs+9L7p/vW+0L8APw2+/b6bv1GAJ8B0AF3A04GsAf3BgAGuAW2Bc8DvADa/gP/Pv46/MT7J/1o/uT+uP9hAW8C9QIfAwcDawItAcr/av5l/Zb80fuH+7L7G/xT/FD8f/zx++/68fs2/gkA4ABuAv4ExQYxB1kHmAcPB/oEdwL8AP7/DP5M/Bb8rPwF/Y/9Ff/QAIkBeQIzA+wCAgIRAdz/Tf4W/Wn8tfuP++D7TPzn/ET9mv3E/KP7g/xk/pz/WABBAoME1wVBBtAGKgeNBhIFegPuAUUAv/6V/e/8xvwB/aP9ov6Q/60AoAGcAsACHAKNATABk//u/TT9Ovwh+/76XPvI+1L8/PwF/XD8cvz6/Y7/aQCwAcoDeAUQBncG8waaBmAF+QP4AiwBA/8k/qX97vyy/HH9c/5X/1YAgAGIAvoCiQL2AbEBFQBP/qL9uvxY+/P6W/uZ+5n7i/wu/cD82PwC/X39Qf+lAMQBfQMSBeUFmgbzBpEGuwWDBNkCggGJ/wz+dP3U/Hj8R/3g/Zf+5f8PAd0BowLRAkcCqQH+AL3/jf7A/aX8+/vo+/H7BPyJ/Ej9zfzX/NX8RPyy/X7/+P/GAdUDsQTwBSgHBwe8BiMGPwSIAuAAsv6c/fT8F/yx/IL9E/52/84AnQG4AjwDyAIvAoMBEwCQ/tT9l/yL+5j7j/uh+0v8RP1i/Xj95/37/Ez9JP+z/30AfgKWA3AEzwVCBg4G4gXZBGMDFAJcANz+QP5Z/fz8bP21/XL+gf+WAJkBcwLPAogCQwKUAeD/GP8I/gT9r/w4/Bn8mPy3/E79vv20/aH95vzW/PL91P6R/yYBfQKRA+UEwwX4Bf0FTAVuBFgDUwHC/+j+lv3Q/Pb86Pxq/XD+h//HAOgBngK7ApACBQKAAGX/aP6z/Jn8Dvxv+1z8dPyG/Nn9dP2S/X79qfxw/Vv++P5/AAcCJQOrBOQFXwawBm0GrAW/BFwDdgFSACf/3P2g/WD9qv0U/nT+yv9tAEYBQQJVAkwCEQKdAIf/jf6N/Fv86fsq+x789/ts/KD9P/2x/Vj9cfxU/af9YP50AF0BCgPYBJ4FqgYXB1AG5AW9BBYDmwFXAL3+8P2J/e38vf35/XH+2P+WAGMBJAJUAgUC1QG6AJr/4f5Z/ff8k/zS+1b8HvxN/ED95vxL/Y/9LPxF/cL9n/0fAJoAEQKMBB4FoAbhBx0HPQeOBrcEYwPuAfr/qf7q/er8zvxN/Xz9g/6a/3gAYAHlAf8BpgE1ARIAKf84/jr9x/xg/P/7HPzf+z38Ef37/Eb9dP04/JD9n/3C/TcAfQAxAnUE4ATmBosHJAdkB0wGwARAA4gBzf9P/sP9jvyX/CH9S/1t/oj/GQBhAccB3wEDAlABdQDA/6j+wv03/Zn8mPyC/In81/xC/YL9bf2A/cn8cf2i/fL9aP/5/24BJQP0A2EFLAZABqQGIAbwBLwDMgKOAPj+Fv4A/YD86/wF/ev9x/7Z/+4AmQFFAmoCIgKTAbgArP+o/s798Pzw/J/8cPzz/Bn9MP2d/Vf9w/yu/Pv8dvz1/RL/t/9pAoADUgRwBqAG6AapB3sGcQVhBFUClAAs/9j9mfxn/Gv8r/yN/WX+Yv9nAAUBggG4AWQBzAAbADH/a/6l/b789vyt/LL8cv1o/Sv+iP4X/kn++f0J/uT9rv6w/zYA7QEjA4MDNQWTBaYFhgayBboE+gNTAhMB3v9+/qb9Ev3c/Bb9dP0X/un+mv9VAMMABwEMAa4AEQCG/7X+JP6P/Tf9Qf1U/TP9pv2i/Rf+XP7G/Q3+fv27/RX+R/7k/30AAQKNA+gD1QVnBlUGSwc7BksFYQRtAlIB3f+R/rv9E/3B/Bf9T/3x/bf+R/8GAHIAsADAAIkAEACG/+L+LP7A/UT9Hv1U/SL9V/10/Xr9Lf69/d39yP1d/Uj+F/5U/4kARwFoA7ADHQWEBgwGqgaABl0F1AQ6A8oB0ABi/4X+8P1I/UP9mf3B/Wn+9/5Z/wAAVQBkAF4AFgCA/wD/aP7L/Xr95vzt/BX95PxU/W/9rv1Y/hP+df5z/kL+5f5u/g8ArACcAeED1wOVBdwGXwY3B9sGuAV9BWgDEQLsAAj/QP5G/YL8fvyT/Nz8n/3o/dL+Xv+F/1UA4v/y/5//7P66/uT9k/0Y/ej8HP0d/WH9sv3u/YT+vv7O/iP/w/4k/+7+Xf+sAJ8AeQJHA5YDqAWMBbgFdwZYBU8FOgSAAqgBEADM/gT+P/3E/AT9J/2l/TT+2f5d//X/HwBfAEEA9P+w/xf/vP5B/uD9hP1l/Yj9Zv2e/fX9sv13/nf+Z/7i/l7+9v7q/hT/jgBwAEsCUANyA38FowWmBW0GjQUxBV0E0ALYAXMAMf9J/n/99PwC/UX9eP0p/sH+0f7Z/7f/5v84AHj/lf8v/5r+if4d/tX98/3x/cr9G/4t/jz+sP6q/qH+3f6C/u3+8v4f/3oAvAAaAlsDeQMOBXwFSQUKBksFhAQMBHQCXgFXANz+KP6S/dj8F/0w/Tf9Gv5n/qL+sP+F/+n/RwC+////mP/o/i7/Xv4O/mz+2f0W/lL+Nf7B/u3+5f5o/z3/Cf9s//n+L/+h/yIAHQEDAhEDqgOPBEEFPAVtBeAEDAQrA+IBpABx/3n+mf0c/dT80fwF/W794P2O/vb+bP/g/xAAJQATAMz/j/9J/wT/uP5q/k3+R/4y/lf+c/6Q/rj+8/4f/zz/QP9Q/2H/of8LALoAfgFJAjUDwANdBPQE5wThBHoEvwP/AtABugC1/7f+Bf50/Sf9GP0t/Xn94/1n/tH+J/+T/7T/vv/Y/5D/ev92/x7/6f6B/kj+S/4X/jz+WP5Y/pn+2P7Y/vv+0f6j/uj+J//t//8A6wElAxoEtwRoBZ8FcwUmBTMEXwM2AgIB+v8B/1L+zf14/Ur9Wv2D/dT9Vf6I/tT+If9E/2X/iP90/47/mv+U/4b/R/8t/wn/3f7N/pH+kP56/qj+m/6l/sb+nv7I/ur+h/9lAFoBXAJCA/kDfwTYBNUEVwQjBOQCRAJWAVYA1P/q/qD+Yv7+/Rz+Bv45/lj+UP6o/qj+tP7z/t7+CP85/0T/XP9U/2r/V/8o/wn/rv6p/ov+jP6E/nD+oP6L/tj+2v4e/8T/RQBAARkCwgLCAyQE0ATpBKAEoQS6AyEDVgI7AaYAu/8j/8n+Lv4X/tv9zv0O/vX9YP5k/or+4P7D/hT/Pv9M/4D/X/+S/43/gP9W/x//8v64/pv+jv5x/mv+eP51/rT+xP4H/6D/UQBYAT8CIgPEA4EEfATcBFME5gNYA0ACxgHGAB4Apv/n/rb+R/4A/gX+2f35/fz9OP5s/pT+8P4J/1b/iv+B/6j/jv+R/4T/Lf8T/8X+mv6L/m/+Z/59/o7+vP4E/w//b//F/3IASAEYAvQCkgM7BFUEfQQvBL4DOgNRAs8BEwFmAPP/Zv8O/6b+RP46/hn+Fv4g/lX+dP6V/v7+//5g/3v/Wf+N/2r/av+v/sT+Uv4k/iv+1v02/uz9/f14/jz+Sf/S/p//BABkAKUB9wFuA4ADPQRcBHUEgQTmA6kDCQNNAs0B8QB5ALj/Jv+1/i7+Cf7D/bf9o/2y/bz95v0u/jX+s/7A/vD+MP9Y/0f/Jv87/wX/EP/0/u/+Fv+y/vf+CP8P/+L/c/82ABgA2ABtAacBBgOFApsDMgNlA4oDrQKyAvUBawEhAV0AFQCH/yD/yP5z/kn+Qv44/hn+Nv4m/m3+a/6I/rj+wv7x/gL/Pf8E/1T/Lf8D/1P/+f5t/xj/PP9k/zj/IQCo/0AAaACiAJYBswEQA7UCaAN4A1ADwQO9Aq8CJAJuATsBYgAhAKj/GP/M/m/+QP5E/jf+Lv5A/kD+YP5n/oD+oP6//rz+s/4f/7r+If8S/yb/Pf8q/3r/T/91/4v/x//N/yEAGABqAL8AIAHGAT8CjgIYA0UDdQOFAyMD5wKjAuQBiAHVAE0A4/8w/+P+if5I/i7+EP4C/gv+B/4J/hf+Iv48/lX+ZP6Q/rX+zf75/h7/Iv82/1f/Wv+Q/4j/v//Q/8r/CwDn/0sApAAQAcYBIQKqAvICNANeA1sDLQO6An4CAAJhAe4ATgC4/0j/u/51/iL+8f3//eH99/0a/hT+UP5o/nr+of63/ub+9f7z/v/++P4Y/wL/Kf8d/0D/cf9W/8L/r//4/w0AVQDLANIAdwGqAQwCWAJ0AtkC5QLtArkCoQJoAu8BpgEiAZIAKwCO/zn/zf5x/kj+Af7t/ev96f32/fD9E/4o/kL+Zv6a/tH+8P4y/0z/d/+G/6H/rv+1/+H/6v9LAI4AAAGLAesBRQKcAssC6wLxAtcCfQJEAuEBZAHfAFMA0f9a/9P+d/42/v/94/3c/er9Cv4f/k3+hv6g/tj++f4m/zT/Pf9Y/0b/R/9B/03/VP9X/2D/cf/A/8D/BAAxAFAAiAClAAABIAF5Ab0BGQJGAmcCqAK8AskCgQJKAjACswFuAQcBkQAfAJj/L/+7/mL+GP7l/cX9s/2z/b/94P34/S/+Xv57/rX+2f4A/yr/Uf94/5z/ov/I/+//+v8nAEgAZQClANYANwFgAasB9AFGAmQCXQJ3AmMCSwL5AbgBiAEUAcsALwDk/2r/AP+y/l7+Kv4A/uz90v3K/eX9+P0Y/i/+YP6O/rf+6P4S/0//Z/93/53/tv/a//n/HQBmAI0A4QBAAYcB2wH4AUICUAJLAlYCMgIoAtwBpwFnARMBzABWAAAApv9f/xv/zf6n/m/+Yf5F/j/+OP5G/l3+Y/5z/o7+qv7Q/vn+Mv9O/2r/nP+4/9n/7f8dAE0AhgDDAPAANwFiAZ4BtQHGAdQB4AHYAcYBsgF8AVgBFwHZAIIASAAGAKv/bf8z/wb/xv6g/nj+Xv5Z/k/+UP5R/mn+eP6A/qn+uv7i/gX/M/9e/3T/qP/O/xAALgBvAKIAzgAZATQBiQGQAY0BqAGnAbABiQF9AVQBMgEiAdcAwwB2ADgAIgDT/8X/hf9y/1D/I/8h/wn/A//p/tH+3P7W/sn+wv7C/s7+0P7f/hX/Jf9d/2v/tf/f/wkAYQB0AL0A2AAIATABPQFHAVEBXgFCAVQBNAEfAe4AywCnAGgAYwAYAAsA1f/P/7r/mv+1/3H/jf9x/2H/Zv9J/2//S/9b/0b/Pf9C/y//Pv8a/yH/Gf8f/yv/RP9r/43/2v/n/zsAVwB8ALAAqADmAOUA+gADAfEA5AD1AMkAtgCZAH0AYgAuACYA7//0/9//xf+//8P/1f+3/8//wf+z/8H/qv+o/5//l/+h/5r/m/+H/4z/lf+Y/6n/pf+l/7j/sv/N/93///8TACgASABVAGIAdgCAAHoAewBrAG4AYABFAEkANAArABsAEAABAPP/8v/Q/87/zv/K/8n/uP/F/8L/zf/B/8D/1f/Q/9z/3v/n//b/8P8AAAgAAAALAAwAAAD//w0ABgAGABEABwAdACYAKAAzADEAMAAgADAAHgAXABwAEwAJAPz/7v/s/+j/3P/Q/9D/0P/T/83/1//e/9j/5//o//D/+P/2/wAA+//5//z//P/1//7/AQADAPf/BQAEAPz/BwAGAAgAFAANAA8AGwALABIABgAEAPj/8P/6//P/+//n/+7/7f/s/+7/5f/4/+X/+P/9//H/7v/5//v/7v/w//b/9//t//f/+P8AAAEACAAMAAAAEAAMABYAFgAcABoAHwAOAA0AFwAIAAMA/f/7//f/8f/x//D/8f/5//X/3f/p/+n/5v/m/+f/3v/k//D/8P/1//X/+//8////BQD5/wAAAAD//wcA///6/wcA///8/wYA/f8DAAsADwANAAcAFgAQABAAFQASABMAAgAMAAAA+P/w/+7/6f/p/+b/6f/p/+j/4P/p/+T/8v/r//T/BgABAPr//f8HAAEAAAAEAPz/AQD//wYACAD3/wMA/P/5/woADQAIAAwACAAGAAkAAQD9/wsAAwANABIADAD//wQABwD+//f/8v/x/+v/7f/s//X/7v/p/+3/7f/o/+n/4//1/+v/9v8CAPb/7//7/wAA//8CAAQA+v/+/xEAAwAGAA0ACAAOAAoADwAHAPT/AAAGAPz/8f/8//f/8//n//H/+P/y//f/9//7/////f/2//H/+P/3//j/9//2//r/+P/3//j/+v/1//T/+f/4//T/AQADAAcA///4/wAAAgAJAP3/9//7//7/AQD5//z/AwACAP3/+v/+/wEA/v/3/wIABAACAAEA/f8GAAMAAwAAAAAAAgD5//7//P///wEA+/8AAP3//v8GAAAABAD9//n/DAABAPz/AQD7//z//f8BAAMAAQAAAPz/AAADAP7/9/8AAAIABAACAPz//////wMAAQD5//3/AAAAAAAA+v/+/wEAAAABAP3/+////wQACAD+//b/AQALAAQAAAD9/wEABQABAAEAAQD///7/BAD//wIAAwD5//3///8AAPv/AAAHAP///P8AAAEA/v/8/wAA/P8AAAYA/f/5//f//P8GAAcABAD+/wMAAwAAAAAAAAAAAAAACQACAPf/+////wEA/v/+/wAA/v/8/wAA///+/////v8EAAIAAQAAAAAA/v/0//3/BgABAP7/AAAEAAEA//8AAAMABgAEAPz/+f/+/wIAAQD///b/+v/8//3////6//r/BQAGAPz/AwACAPz//f8AAAMABgD//wAA/f/8/wgA+//6////AwD8/wEAAwD5/wEA/f8AAAEAAAABAAEAAAD9/wIAAwD+////AwADAAIAAAD5//v/AgAAAP3//f/+//7///8CAAAA//8BAAQA/v/+//r//f8KAP3/+P8AAAIAAAAAAP//BAAEAAEA/P/8/wIAAQABAP7//f8EAAgA/v/9//7/CQACAPv//v///wEA/v/5/wAA+/8FAP7//f8AAAQA///9/wIAAAAKAPn//P8DAPz//v8BAAQAAAD6//n/AAACAAAA/////wYABQD5//7/BAAAAAAAAgD7//z/AQD5/wAAAAD4/wIABwD+/wIABAD+/wEABwACAAAA/f8AAP//+//9//3/AAAGAP//+////wAA/v/+//7//f8AAPv//P8EAAYA+P/0////AQADAAMAAADz////DAD4/wMAAwD5/wYABAABAP3//v8JAAEABAANAP7/+P/+/////v8AAPr/AwAAAPv////1/wAAAAACAP3//P8CAAAA+f///wIAAQAFAAQA+//+/wkAAAAAAAQAAAD9/wQAAgD+/////P8DAPz/+P/8//r/AwAEAPv/+/8BAAUAAQAEAP7/9P8BAAAAAAAEAAAAAgAAAAAABwD7/wMABQD3//v/AAD5/wEAAQAAAAAAAAD8/wAA/f8AAP3//v8CAAAA+//5/wIABQAFAAQA+/8CAAIA/v///wcA/f/5/wAA/v8FAAAA/v8HAPn/BgACAPP/AAACAPv/+f8BAP////8CAAcAAAD6//7/BwAAAPT/AwAJAP///P8AAAIA+P/4/wIA/v///wAABQAAAAAAAwABAAIAAAACAAAA//////n///8GAP3//P/4/wAAAgADAPz/+/8GAPz/+v8CAP3/AAAGAAAA///9/wcA///2/wgAAgD8/wAAAgAHAPf///8JAAAA+P8BAP7/9v/+//z/AwD8/////f/9//r/+/8NAP////8HAP7/AwAEAAkA//8AAAYABQD5//7/BAD+////AgABAPb/8P8CAAEAAAD4//7/BAD7//3//v8FAAgAAAD8/wYAAwD8/wMAAwAAAP7/AQD0/wAA/P/9/wYA/v/9//7/+v8CAAMA9f/6/wMA/f8BAAMAAQADAAEA/v8AAAAABgAAAPv/+/8AAAMAAwAAAPz/+/////7///8AAAAABgAAAAAA/v/8/wIAAAD///r/+f8AAAAA+v/9/////P8BAAEA/v8KAP3/+v8QAAAA/v8JAP//AgADAPv/BwAFAAAAAAD+/wAA+v/9/wAA9P////v//P/8//P/AAAGAAAA/P8DAPv///8GAAYA/f/8/wIA//////////8FAAAAAAAHAPz/+/8EAP3//f8FAP3//f8AAAMA/f/4////BgABAPz/AAD+/wMABAD6//v/BgAAAAAAAAD+/wMA+//9/wgA//8BAAMA9P/7/wgAAwD8//r/AgABAP7/+f/7/wcA/P/8//v/AQD//wEA/v/6/wIAAgACAAAAAwD9//f/BAAMAAEAAgAAAPj/AgAEAPb//f8HAP7/AQACAPT/AgAJAP3/AAD2/wAAAQAAAP//AAAIAPj/+/8AAAMA7/8DAAgA9f8FAAQABAD//wMADAACAPL///8KAPD/+P8DAP7/9P8AAAUA+v8AAP//AQD1//z/AAAAAPz/BgAAAPn/DQAKAPz/BAACAPf///8GAPj/AAAKAAYA+v8LAA4A9v/4//7//f8CAP3/9//5///////t/wMAAQD+//b/DAADAP//BwACAAEABQAEAP7///8AAAAAAQD7/wAA/v8DAP//+v8HAAcA+v///wMA9/8AAAEA9//7/wEA/f/0/wIAAwAEAAMAAgD8/wEACAAAAAEABQAEAAQABQD9//7/AAACAAIA/P8CAPz//f/9//f//f/z////AAD0//3/AgAFAPX/DgAFAPP/BgAAAPr/AAAFAAAA+v8AAAAABQD6/wAAAAD//wMACgD6//v/AQAAAAQA////////AAD6//T//f/8//3//f/9/wIACAACAAMACQD//woAEgD3//v/CwABAAEA/P/9//3/+P/0/wAAAADz//n/AgAFAPn/AAAFAAAA+v/6/wMAAgD//wQABQD6/wAABgAGAPr/AAALAP//AAADAPf/+v8AAP//AAD5/wAA+v8AAAsA+f8AAAAAAAAAAP//BQAAAPT/+v8FAP//+f/9/wMA/f8CAAgABAD//wUABgD0//v/+v8CAAQABAAEAAUAAAAAAAMA/f/9//z/+P8EAAAA7v/7/wAA/P8BAAQA+v8CAAUAAAD6//3/AgACAAUAAAAAAAYA+v/6/wAAAAAAAPn/BQAFAAUA8/8GAAYA+f8FAAAAAAD5/wAAAADz//n/BQAAAPb/AgACAAIA/f/9/wgAAgACAAIAAAAAAAAACwAFAPn/BgAAAAAAAAAAAAUA/P8CAP3/+P/0////EQD5//P/BgAAAPn/AAD6//n//f8CAAMA9v8CAAcABwAAAPr/AgALAAAAAAAGAAAAAAAFAAIA9/8AAAAA//8EAAIA/f/3//r/AAAFAP//+f8AAPr/+v/2/wgAAAD9//3/AgAOAAUA9P/+/wMAAgALAAUA+f8GAAUAAAD6//r/AAD5/wUA+f/z/wwAAAD5/wAAAAAAAPn/AAAAAPr//f8CAAsABQD6/wAABQAFAAAA+v/5/wAABAAFAPP/+v8GAAAABAAFAPn/AAAAAPr/+f8FAAAAAAD5/wAAAAD6//b//f8IAPz/AgAJAAYAAAAAAAsACwD8//3//f/9//3//f/8/wAA//8CAP3/8//6//P/AgAFAPn/AAAAAAAADAAAAPn/AAAFAPn/+f8FAAAA+f8AAAAAAAAFAPn/AAD6/wUABQAFAAUA+v/6/wUAAAD5/wAA+f8AAAAAAAAFAPn/+f/6/wMABQAAAAAABQAAAAAA+v8AAAAAAAAFAAUABQD5//r/+v8AAAAAAAAFAAUAAAAFAAAA+f8AAPr/8/8FAAsA+f/5/wYAAADz/wAABQAAAAAAAAAAAPr/AAAAAAAABQAFAAAA8/8AAAwAAAD5/wUAAAAFAAAA+f8AAAAAAAD5/wUABQD5//r/+f8AAAAA+f/8/wIAAgD8//z/CQAHAAUA+v8AAAAADAAFAPn/AAAFAAkA9v8DAPb/8/8FAAwA/P/6//n/BQAFAPz/+f/6//r/+f8FAAAABQD5//n/AAAAAAAABQAFAAUABQD8/wIA8/8AAAAAAAAFAAUACQD8//3/AwD2//P/DAACAPD/AAAAAAAA+f/t/wIADAD5//3//f8CAAgABQD5//3/CQAFAAAAAAAAAAAABQAAAAAABQAFAP3/+f8AAPn/+f/5/wAA+f/8/wIACAAFAPn/9v/9/w8AAAAAAAUADAAJAPb/AAAAAPn/+f8AAAAA+f8AAAAAAAAMAAUAAAAAAAAAAAD5//n/DAAAAPn/+f/5//n/BQAAAPn/AAAGAAUAAAAFAAYA+f/5/wUABQAJAP3/8P8AAAAABQAAAPn/AAAGAPP/7f8JAAUAAAAGAAAAAAAAAPn/AAAFAPn/+v8AAAAAAAAFAAUAAAAGAAAAAAAAAAAABQACAOz/+f8MAAAAAAD5//n/+f8AAAAA9v8CAAkA/P8JAAAA+f8FAAUA+f8GAAAA8/8MABIA/P/z//n/AAAAAPn/BQAAAAAAAAAFAAUAAAACAPz//P/9//z/+f8AAAUAAAAAAPn/+f8AAPn/AAD5/wIABQAFAAAA+f8FAAUAAAAGAAAABQD8/wIA/f/s/wAABQD5/wAADAAGAPn/AAD5//n/BQDz//n/AgD8/wkA/P8JAAwAAADs/wIAAgACAAAAAAASAAAA8//5/wwABQDz/wAABQAAAAAABQAAAAAAAAAAAAUA+f/5//n/BQAAAAUA+f/5/wUA+f8AAAAAAAAFAAAA+f/5/wUAAAAAAAUAAAAAAAAABQD5/wAABQAGAAAAAAAAAPr/+f/6//n/AAAAAAAABQAAAPn/BQAAAPP/AgAAAAAAAAAFAAAABQAFAAYACQD8//b//P/8//z/8//z/wAADAAFAAAAAAD5//n/BQAAAAAAAAD5/wAADAAAAPn/AAAFAAAA+f/5/wAAAAAAAPn/BQAFAPn/AAAFAAAAAAAFAPn/BQAFAPn/AAAAAPP/8/8JABMA+f/z//z/AwADAAIAAAAFAPn/AAAMAPn/8v8CAAAA/P8FAAwAAAD5/wAABQAAAAAABQD5/wAADAD5//P/AAAMAAAA7P/5/wUA+f/2/wIAAgACAAIA/P8JAAwAAAAAAAwAAAD5/wAAAAAFAAAAAAAAAPn/AAAAAPn/AAAAAPn/AAAAAPn//P/8/wkABQD2/wkABQAAAAUAAAAFAAUA/P8AAAAAAAAAAAAA+v8GAAYA/f/5/wAAAAD5/wUA+f8FAAAAAADz/wAABQAAAAAA7P8JAAAAAAAAAAAADAAAAPn/BQAFAPn/AAAAAAAA+f8AAPn/AAAFAAAA+f8AAAAA+f8AAAAAAAAFAAUAAADz/wUABQD5//n/DAAAAPn/AAAAAAwAAgD5/wAACQD2//n/AAAAAAAA+f8AAAAA+f8AAAAAAAAFAAYAAAD5//r/AAAAAAAAAAAAAPn/BQAFAPP/AAAFAAwAAAD5/wAAAAAFAAUA+f/5/wAA+f/5/wAABQDz//b/AgAPAAUA+f8AAAAADAAMAPz/+f8AAAUAAAAAAAAA+f8FAPn/8/8AAAAAAAAFAAAA+f/z/wIADAD5//n/BQAAAAAABQAFAPn/AAAFAAAAAAD5//n/8/8CAAUAAAAAAAAABQAAAAAABgAAAPn/8/8AAAYAAAAGAAAAAAAAAPn/+f8FAAAA8/8AAAUABQAMAAIA/f/8//n/AAAFAAIAAgD2//n/+f8AAAAAAAD5//n/AAAAAPn/AgAFAAUADAAAAPn/AADz/wAABQAAAAAA+f/5/wAABQAFAAwAAgD2//n/+f8AAAUAAAD5/wUAAAD5/wAAAAD5/wAAAAD5//z/CQAAAPn/AgAAAAYAAAAAAAAAAAAGAAUAAAAAAAAAAADz/wAA+f/w/wIAAgACAAIA9v8CAA8AAgAAAAYAAAD5/wUABQD5/wAABQAAAPn/AAD5//n/DAAAAAAABQD5/wAA+f/5/wAAAAD5//z//P8CAPz//P8CAAkAAgD8/wIAAgAJAAAA+f8AAAAAAAAAAAAABQAAAAAABQAFAAIA/P/8/wIA9v/5/wAA+v8AAAAA+f/5//r/AwAAAAYAAAAAAAUAAAD5/wUAEgD8//b/AAAFAAIAAgACAPz//P/2//z/+f/z/wwACQD2//n/+f8FAAUA+f8AAPn/AAAFAAUABQAAAPn/AAAAAAAABQD5//n/AAAAAAUABQD5/wUABQDs//n/BQAFAAAA+f/5//b/AgAPAAAAAAAAAAUAAAAAAPP/AAAMAPn/+f/5/wIABgAFAAAABgAAAPP/AAAAAAAABQAFAAAA8/8GAPn/+f8GAAYAAAAFAAUA+f/5//n/AAAMAPP/8/8CAP3//f/8//3/AgAJAAkA/P/8/xYAAAAAAAYA+f/5/wwAAAAAAAYA+f8AAAAAAAAAAAAAAADz//n/BQAFAAAAAAD5/wAAAAAAAAUA+f/5/wAAAAD5//z/AgACAAwABQD5/wAAAAAFAAUAAAAAAPn/AAAAAAAABgAAAPn/AAAFAPn/+f8AAPn/AAAMAPP/BQAAAPP/BQAFAPn/+f8GAAUADAAAAAAAAgD8//n/AAAFAAAA+f8AAAAABgAAAPn/+f/5/wAAAAAMAAAA8//5/wUAAAAAAAAA8//8/wIAAgAJAAAA/P8CAAIAAgAFAAAAAAAFAAAAAAD5/wAADAAAAAAABgD5//n/BQAAAAAA+f/5/wAAAAAAAAAAAAD5//n/AgAFAAAA+f8FAAAAAAAFAPn/AAD5/wAABQAAAAAAAAAAAAAABQAFAPn/AAAFAPn/+f8AAAAA+f8AAAUA+f/5/wAABQAFAAAAAAAAAPP/+f8FAAAA+f8FAAUAAAD5//n/BQAFAAUABQACAAIA/P/8//b/+f8FAAIAAgD2//n/BQAAAPn/+f/5//r/BgAAAPP/BwALAAAAAAAAAAUAAAAFAAIA/P/8/wIA/P/z/wAABQAAAAAAAAD5//n/AAAFAPn/8//8/wIAAgACAPz/AgAJAAUAAAAAAAUABQAFAAAAAADz/wAABQAAAAUAAAD5//n/AAAAAPn/8/8CAAIAAgD8/wIADAAFAPn/AAAAAAAA+f8AAAAA+f8MAAAAAAAFAAAA+f/5/wUAAAAAAAAA+v8AAAAA+v8AAAUAAAAAAAAAAAD5/wAAAAD5/wAA+f8CAAUA+f8FAAUAAAAAAAUA+f/5/wUAAAAFAAAA+f8FAAAA+f8FAAAAAAAAAAAABQD5/wAAAAD5/wAAAAD5/wUAAAD5/wAA8/8JAAAA+f8CAAIA/P/8/wIADwAAAPn/BQAFAAAABQAAAPn/BQAFAPn/+f8AAAAA+f8AAAYA+v/z/wMAAgAAAAAABQAAAAAAAAD5//n/AAAFAAAAAAAFAAUA+f8AAAUAAAAFAAAA+f/5/wAABQD5/wAABQD5//n/AAD5/wAAAAD5/wIABQAAAPn/AAAFAAAA+f8FAAUA+f/5/wAABQAAAAAA+f8AAAAAAAAFAAAAAAAFAAAA+f8AAPn/+f8FAAAA+f8AAPn/9v8CAPz/AgACAAIAAgD9//z//P8JAAcAAgAAAAAAAAAAAAAAAAAAAAUAAAD5/wUA+f8AAAAA+f/5/wUAAAAAAPn/+f8FAPn//P8FAPb//P8CAAkAAgD8/wIABQAAAAAA+f8FAAUA+f8AAPn/BQAFAAUA+f/z/wAABQAFAAAAAADz/wAAAAAAAAAAAADz//z/AgAJAPn//P8CAAkABQAAAAUABQAAAPn/BQAFAAIA9v/6//n/8v8GAAAA+v8AAAAAAAAFAAUA+f8FAAAA8//z/wIADAD5//n/BQAAAPn/BQAMAPn/8/8AAAwABQAAAPn/BQAJAPz/9v8CAPb/BQD8//P/AAAMAAIA/P/5//n/+f8AAPn/9v8PAAUA+f/5/wUADAAAAAAABQD5/wAABQD5//n/BQAAAPn/AAAAAAUAAAAAAAAA+f8FAPn/AAAAAPn/AAAAAPr//f8CAAMABQAAAAYAAADs/wIAAgACAAIA/P8JAAAA+f8FAAAAAAAFAAUAAAAAAPn/+f8FAAUA+f/5/wwABQAAAAAA+f8AAAAA8//z/wIA/P8JAAIA9v/8/wIACQAJAAAA+f8FAAUAAAAAAAAABQAAAAAA+f/5/wYAAAAMAPn/+f/5//P/BQAFAPn/+f8AAPz/CQAFAPn/AAAGAAUAAAAAAAAABgADAPz/+v8AAAAABQACAPz//P/5//P/AAAAAAAAAAAAAPn/AAAAAPP//P8JAAUAAAD5//z/CQAMAAUA+f8AAAwAAAAAAAkA9v/5//P/AAAFAAAABQAAAPP/AAAMAAUAAgD8//b/AAAAAAAA+f8AAAAA+f8FAAUAAAAAAPn/AAD5//n/BQAFAAAAAAAAAAAABQAAAAUAAAD6/wUABQAHAAIA/f/2//L/8//z/wIA/P8CAPz/AgACAAIAAgAJAAAA/P8FAAwABQD5//n/BgAFAAAABQD8//n/AAAFAPn/BQAAAPn/+f/5/wUAAAAAAAUAAAAAAPP/AAAAAAAABQAFAAUAAAD5//n/BgAAAAAA+f8FAAUAAAAFAAAAAADz//n/AAAFAAAA+f/5/wAAAAD5/wUAAAAAAAwA+v8AAAUA8/8AAAUAAAAAAPn/AAAAAAAABQAAAAAABQAFAPn/AAAFAPn/+f8FAAAA+f8AAAAABQDz//P/AgACAAIAAgAMAAAA+f8AAAwABQD5//n/AAAFAAAAAAAAAAUAAAAAAAAA+f/5/wAAAAAAAAUABQD5/wUACQDz//n/BQAFAAAA8//5/wAA+f/8/wIACQAAAPn/BQAFAAUA+f8AAAUAAAAFAAAA+f8AAAUA+v/5/wAA+f8AAPn/9v8CAAkA/P8CAAkAAAAAAAUAAAD5/wAABQAFAAAA+f/5/wUABQD5/wAA+f8AAAAA+f/5//z/AgACAAIAAgAAAAUABQD5/wAABQAAAPP/BgAAAPn/BQD5/wAABQD5/wAADAAFAPn/+f8AAPn/AAAMAAAA8/8AAAwAAAAAAPP/8/8FAAUABgAAAAYA+v/5/wAABQAAAPr/AAD5//n//P8CAAkAAAAAAAAA+f8FAAUA8/8AAAUAAAAAAAUA+f/5/wUAAAD5/wAA+f/8/wUABQAAAAUA+f/z/wAABQAAAPn/AAAAAAAAAAAAAPn/+f/8//z/AgACAAkABQAAAAAAAAAFAAAA+f8AAAwABQD5/wAAAAAAAAAA+f/5//P//P/8/wIACAAFAAAAAAAFAAAAAAAAAAAAAAD6/wAABQAAAAAAAAAAAAYACQD2/wAAAADz//n/BQAFAAAA+f/5/wUA+f/5/wAAAAD2//b/AgD8/wIACQACAAIACQAFAAUAAAD5/wUABQDz//n/BQD5//n/BQD5//n//P/8/w8ABQD5/wAAAAAFAPn/+f/5/wUABQAAAPn/8/8JAAAABQAAAAAAAAD5/wUA+f8AAAAAAAALAAAA+f8AAAAABQAGAPn/AAAAAPn/DAAAAAAA+f8AAAwA/P8CAPP/8/8GAAYA8//z/wIA/P/8/wIAAgACAAIAAgACAAkABQAAAAAABQAFAAAA+f8FAAUA+f8FAPn/AAD5//n/AAD5/wAABQDz//z//P/8/wIAAgAJAPz/CQAFAAAABQAAAPn/AAAFAAUA+f8AAAAAAAAAAAUAAAAAAAAA+v/5/wAACwAAAPr/+f/z/wIAAgAAAAwA+f/5/wAAAAAAAAAAAAAAAAUAAAAAAAAAAAAFAAAABgAAAPn/AAAFAAAAAAAAAPn/AAAAAPn/+f/2/wIAAgACAPz//P8CAA8AAAD5/wIAAAAFAAAA+f8AAAUAAAD5/wUADAAAAAAAAAAAAAUA+f8AAAUA+f8AAAUA+f/z//n/AAAAAAAA9v8DAAMA9v8CAAkAAwD8/wIACQAMAAUAAAAFAAkAAgD2//z//P8CAPz//P8CAPz/9v/z/wAAAAD5//P//P8JAPb//P8JAAIAAgD8/wkABQAAAAYABQAAAAAABQAAAAAA+f8AAAAAAADz//n/AAAFAAwA+f8AAAUAAAAFAAIA+f8AAAAA+f/5//n/AAD5//z/CQD2/wIADwD5//z/AgAIAAsAAAAAAAYAAAAFAPz/AAAAAAIA9v/5/wUA+f/5/wAA+f/2/wIACQAAAAAAAAAAAAYABQAMAPn/8/8FAAwA/P8CAPz/8/8AAAUA+f8AAAUAAAAAAAAAAAAAAPn/+f8FAAUA+f8AAAwAAADz/wAABQAFAPP/+f8FAPP/AgACAPz/AgAMAAAA+f/5//z/AgAJAAAA+f8CAAUAAAAAAAUAAAAAAAAA8v8AAAAA9v8DAAkA9v8CAAgAAAAAAAAABQAGAPn/+f8FAAAABQAAAPn/+f/5/wAAAAAFAAUA+f/5/wAAAAAFAAAA+f/5//n//P8CAPz/AgASAPn/8//8/wIAAgACAAIAAgACAAAAAAAFAAAAAAAAAPn/BQAMAAAA+f8AAPP/AAAAAAAAAAD5//b//P8CAPz/CQACAAIAAgD9/wgAAAD5/wUAAAD5/wAAAAAFAAYAAAAAAAwA/P/5/wAA+f/5/wUA+f8AAAAA+f8AAPn/BQAFAPn/+f/5/wYAAAAFAAUAAAAFAAIAAgACAPz//P8CAAIA/P/2//b/+f8FAAAA8//5/wAABQAAAPn/AAD5//z//P8CAAIACQACAAAABQAAAPn/BQAFAAUACQD8/wIA/P/w//n/BQAFAPn/+f/5/wAAAAD6/wAA+f8FAAsAAAD5/wUADADz//n/BQAMAAIA9v8AAAAAAADs//n/AgD8/wIAAgD8//z/AgAJAAUAAAAFAAwAAAD5/wUABQD8//z/+f/5//n/+f8MAAAA+f8AAPP//P8CAAkAAAD2/wIACQAAAAUA+f8AAAAA+f/8/wkADAAAAAYAAAAFAAkAAgD2/+z/AAAFAPn/AAAAAAAA+f/y/wMAAwD2//3/CQAPAAAA+f8AAAAABQAFAAUAAAAJAAIA9v/8/wIA9v/5//n/+f8AAPn/AAAAAAAABQAAABIA/P/z/wAAAAAAAPn/+f/5/wIAAgD8/wIAAgACAPz/AgAJAAAAAAAAAAUABQAAAAUABQD8//n/AAAAAPn/AAAAAAAAAAAFAAUA+f/5/wwA+f/s/wAAAAD2//z/CAD9//3//P8PABMAAADz/wAACwALAAgA/f/8//b/AgD8//D/+f/5/wYABQD5/wUADAD8//n/+f/5/wAA+f8AAAUA+f8FAAAAAAAFAPn/AAAFAAAA+f/5/wAAAAAAAAwABQD5/wAADAD8//n/AAAMAPz//P/5/+z/AAAFAAAAAAAFAAAAAADz/wAABQD5/wAA+f8FAAAAAAAMAAYAAAD5/wUAAADz/wUACwD6//n/BQAAAAYAAAAAAPn/AAAAAPn/AAAAAPn/AAAAAAAADAAAAAAABQAAAPn/+f8AAAAAAAAFAAUA+f8FAAAA+f/5/wAAAAAAAAUA+f/5/wAABQAAAAAA+f/5/wUAAAD5/wAAAAAAAAAAAAAAAPn/BQAFAAAAAAAAAAUA+f/5/wAABQAMAPz/7P/5/wwA+f8AAAAA+f/5/wIAAAD8/wgAAAD5/wYAAAD5/wsAAAAFAAUA8//5/wAABQAAAAUABQAAAAAAAAACAAIA9v/8//P/AAAFAPn/8//2/wIAAgAPAAAA8//8/wIACQACAPz//P/8/wIACQAMAAAAAAAFAAUABQD5/wAAAAD5/wAABQAAAAAAAAD5/wUABgD5/wAABQDs/wAAAAAAAAAA+f/8/wIABQAAAPP//P8JAAYABQAAAAAABgAAAAUACAD8/wIAAgD2//b//f/8/wIA9v8AAAUA+f8AAPn/BgAAAAAAAAD5/wAA8/8CAAUAAAAGAPn/+f8FAAUA+f8AAAUAAAAAAAYADAD9//b/BQAJAPz/6f8FAAkA/P/z/+z/AAD9//z/AgD9/wIAAgACAAkAAgD9/wkABQD5/wAAAAAAAAUA+f8AAPn/+f8MAAAAAAD5//r/CwAFAPn/+f8AAAsACwD2//n/AAD5//n/+f8AAAAAAAAFAAAAAAAFAPn/AAAFAAAAAAAFAAAA8//5//n/AAAAAPz/AgAFAAUA8//8/wIABQAAAPn/BQAAAAAAAAAAAAAABQD5//n/AAAAAPn/9v8CAAIAAgACAAwAAAD5/wUA+f8AAAAABQAAAPn/AAAAAAAA+f8AAAUA+f8AAAAA8/8CAAMA/f/9/wIACQAAAAAABgAAAPn/BQAFAAwA/P/z/wUABgD5//n/+f8AAAAA+f8AAPn/AAAAAAwAAAAAAAUA+f8AAPP/+f8FAAAAAAAAAAAAAAAAAPn/AAAAAAUAAAAAAAUAAAD5//n/AAAAAAAA+f8AAAUABQAFAAAAAAAAAAAA+f8AAAAA+f8AAAAA+f/5/wIA/P/8//b//P8JAP3/AgADAP3/AgAPABMAAAD6/wYABQACAAIAAgDw//z/AgD2//P/AAAAAPP/9v/2/wkA/P/2/wIACQAJAAIAAgACAAUAAADz//z/CQAFAPn/AAD5/wIAAAAAAAwABQAAAPn/AAD5/wUAAAD5/wUA+f/z/wAAAAAAAAAA+f/8//b//P8JAPz/DwAFAPn/AAAFAAUAAAAFAPn/BQAJAAIA/f/9/wIA9v/9//b/+f8AAPn/+v/5/wUABQD5/wAAAAAAAPP/AgAFAAAA+f8FAAUA+f8GAAAADAD5/wAADAD8//z/AgD2//n/AAD5//n/AAAAAPn/BQAAAAUAAAD5//n/AAAAAAAABQD5//n/DAAAAAUAAADz//n/BQAFAAAA+f8FABIA8//z/wwAAAAFAAAA+f8AAAAABQD5//n/AAD5//n//f/8/wMA/f8HAAIA/f8DAAkABgD5/wAABQAAAPn/BQAFAPP/AAAMAAAA+f8FAAUA8/8FAAUAAAD5/wAAAAAAAPn/AAAFAPn/+f/5/wAAAAAMAPn/8//8/wkAAAAAAAUADAAGAPP/AAAAAAwACQD2//P/BQAFAPz/+f8AAAUA+f/5/wAABQD5/wAA8//8/wIAAgACAAIAAgAAAPb/9v8JAAIACQADAAUAAAAAAAUAAAAAAAYABQAAAAAAAAAAAAAAAgD8//P/7P/8/wIA/P8CAPz//P8CAAIA/P8CAAIACQACAAIABQAAAAUABQD5/wAABQAAAAYA/f/5//n/BQAAAPn/BQD5//n/+f8FAAUAAADz//b/AgACAAIA/P/8//z/CQAJAAAA/P8CAAIA/P8CAAUAAAAFAAUAAAAFAAAAAgD9//r/+f8AAAAAAAAFAAYA+v/5/wAA+f/5/wAAAAAAAPP//P8CAAIADwAFAAAA+f8AAAUAAAAAAAUA+f8AAAwAAgAJAPb/9v/5/wUAAADz//n/+f8AAPz/BgD5//z/AgD8//b/AgAJAPz/CQACAPz/CQAFAAUADAAJAPz/AgACAAIA/P/w//b/+f/z/wAABQD5//P//P8JAPz/9v/2/wkACAD8/wMAAwAHAAsA8v8AAAUABgALAPn/AAAFAPn/+f8FAAAA+f8GAAYAAAACAPb/+f8AAPn/+f8AAAAA8/8CAPz/9v8CAPz//P8JABYA+f8GAAUABgD5/wAAEgD2/wIA/f/2/wAAAAD5/wYAAADz//n/+f8CAAAAAAAAAPn/BgD5/wYA+f/8/wkAAAAAAAYABQD5//P/AAAFAPn/+f8FAAYAAAD5/wUABgAAAAUAAAACAP3/+f8AAAUA/P/5/wAA+f8AAAAAAAAAAPn/AAAAAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAAPn/AADz//n/BQAAAAUABQAAAPn/+f8AAAUAAAD5/wUADAAAAPn/AAAFAPn/+f/5/wAAAAAFAAAA+f8FAPn/+f8AAAUABQD5/wAABQAAAAAADAAPAAIA/f8CAAIA/P/9//3/8P/y//P/+v8AAP3/AgAJAAAABQAFAAUAAAAFAAIA/P/8//n/BQAAAAIAAgACAPz/8P/5/wUAAAD5/wAA8/8FAAwA+f8FAAAA+f8AAAUABQAAAAAA+f8AAAYA+f/5/wwAAADz/wAAAAAAAAAAAAAAAAAABQAFAAUAAgD2/wAAAAD5//n/+f8FAAAA+f8FAPn/9v8IAAUA+f8AAAAA+v8CAAYABQAFAAUA+f8AAAAAAAAFAAAAAAD5//P/BQAMAAUA+f/5//n/AAAAAPn/AAAMAAUA+f8AAAUAAAD5/wYABQAAAAAAAAAAAAAABQACAPb/AAAFAPn/AAAAAPn/AAAFAAUACQD8//D/AAAAAAAA8/8AAAAAAAAFAAAABQAFAPP/+f8AAPn//P/8/wIACQAFAAAABQAAAPn/CwAGAAAAAAAGAP3/+f/6//n/AAAAAPn/+f8CAPz//f8JAAUAAAAAAAUAAAAAAAYABgDz//n/BQAAAPn/AAD5/wAA+f/9/wIAAgAMAAUA8//5/wwABQD5//n/DAAAAAAABQD5//n/AAAAAAAA+f/5//b//P8CAAIA/P8CABYAAAAGAAAAAAAGAPH//f8AAPH/AAAAAAUAAAD5/wUABQD5/wUAAAD6/wYA+f/4/wUAAQAAAPX/7v8BAPT/7v/0/+v//f/4/+v/+P/p//3/AAD5/wAABQAFAAAABQAAAAAAAAAFAAkA/f/u//H/AAAIAAEA8//1/wEA+P/8/wIABQAGAAAA+f/x//3//f8GAAUA+P/4/wAAAAAFAPz/AAAAAAAA+//5/w0AAAD4//n/AAD9/wAAAAAAAPj/+P8AAPj/8P/w//j/8v/+/woA7v/x//L/+P/9//D/9f/1//T/+f8AAAUA8f/4/wUA+f8BAAUA+f/j//3/AAD5//z/AgAMAPH/BQAFAAAAAAAAAPj/+f8FAAUACQACAO7/7v/4/wAA+f8FAAAAAAAAAAAA+f/5//3/+f/5/wAA7v8CANEA1gDxACwAYQAoAPj+wP1l/v0ANQEI/939lP3E/zgBGQFRALD/Nf5Q/nr/Qf/7/Sv+CwJoBkwHcQIx/4b+GQAIAc0BIQHTAdwA2v5a/cX9GAA4A9gC7f95/S39nP5T/6n/3f9N/+n+Uf4I/uT+gP6u/mj/EP6d/kn9kfzY/Uj+CP9w/e39+AERB8MLBghC/jf3KfgOA5oLggraAC35avlvAXAGuARYAR3/9P+iANb+CP0g/QAAaALtAKT9jf15/9kBLAGS/vz8p/1RAG4AWv+k/ev86P69/8b9OfzR/Ej/7QRzB5EDB//7+vT8WgK5BQ8HgQJC/pX6IfzcADAFlwR7ANP8cPww/z8BPAGG/7P+NwAQAb3//P1+/isB4AK4AVD9efv+/Bv/iAAV/+X8aP0k/ykBxQOhA4ECqwFS/0n/HAAEAg4EjAKQAGL+Q/6mACQCkwGx/xT+gP7H/04A6f+S/4T/cgDBAD0Aw/8s/2P/pv/M/9P+l/2m/YX9tf3D/S/9v/0X/q7+9gA2AwgFHQWyAej+aP7GAHIEvASjAqb/9P1R/u7/6ACSAR0B+P+6/qj9Xv77/4gBSgETAOf+6/4sALsAuwAZADX/Jv6N/XX9Vf02/lH+BP5j/Xf8vP2SAB8ECgeJBbsB+P2Z/SgBrgQnBcsCm/8s/lz+Z//JAA0BigGnAA//0/3R/cr/2AEmAlMAbf7G/Rf/rAD9AFQA7f7f/ez8YP0I/nn+KP9K/nf9u/wW/N794wD0BIkHOAUQAUD9GP69AvcFlQXAAQL+Rf07/jIAYQE4AYMA6v4W/hj+av9+Af0B4ACj/kD+Wv+sAC8BHgAb/3D+xf12/Sb+sP4U/w7/y/2e/An8zvx4/6QCQwVkBsgDdwCw/eL+CgM7BvgFUAJl/rr9q/6gAKEBxwENAR//mf2D/en+NwEEAjYBBP+4/aP+/f8AAZEAXv8w/mv9AP2Y/Xv+v/6g/hj+KP23/OX8s/2U/wkCUgS4BRoEBAHh/lT/8gKIBfsEEALz/tP+7v/hAGUBVAETAcD/YP4s/p7/LwGUAZEA1v4b/tD+wP8XAMn/DP8j/v/8WfyF/Ln9Jf5z/gP+F/1q/ND8ov3E/1ACKAUoBycFEwHE/jj/tgM3BtIE5AEU/5j/0P///8MAegHfASYAD/79/dT/qQHBAWIA2P56/hX/i/+r/5f/PP8M/vr8KPyT/Hj9zP1A/kr+Rv5c/QH95Pye/hICoQT4BrcFtQFL/67+DQKTBYYFqAPy/8n+6/4w/88AygE+AqUAFf6P/RT/vwBMAXAAXv/O/j3+Wv7F/qD//f9j/vn8yfsj/Ef92/3u/hr/V/6F/Cj8xfzZ/p8CHAWgB70GdgKf/4T+rwEhBZUFpQRgAYP/2f5W/iUA4gHCAo4Bnf50/ab+CwD9AL0ADgBQ/2/+8v2O/pz/bAA4/9b9sfw2/ED8YPy4/Qz/cP9Y/U/7AvtX/DoBWwXQCFsJpARSAJL9Lv8GA+cEygWfA50AWP7G/Bf+yADkAhADfgAY/sj9Av4u/48AMQEjAcT/P/7o/BL9Q/9u/1n/Uv4E/U/8X/ul/M7+af8V/jj7+vqG/BsA/QMiB4sJ2AUeAcT+pP+GAxgFtwVwBJMBZP87/dr9gwC2AloDPwE8/2L+a/7p/tn/8gApAeUAtP85/hb9+v31/vH+5f7b/RT9Nvwj+1j8ufyu/fH9nv3h/fj9zwDYAz0Hqge/A3ABEQBDAEMCMAOnBJ0DdwGp/yv+AP9JAFsB3QABAMf/hv8d/wT/o//m/6//q/89/2z+V/6y/kD+MP7e/aj9df1C/Ir8JP1b/QP+Sf1I/Sv9qQCdA3sFWQdRBdYDSgGy/1gBowIdBNMDogJYAVL/vf5u/4gAfABFAHgAJABa/+T+Wv9z/zr/9f/x/yv/5f7a/i3+5f3T/c39rv2Z/F38m/yZ/P/85PzY/Lz8WP8nA8gEiwZrBssE0AItAJAAQQICA/MDNwMgAnkA2P4L/yAAiQBQAHAAbwDQ/4f/Nf+A/xn/Z/8jAIT/Bf8M/wX+Uv0j/Tb9iP0I/XL8FPxX+wj8kfwl/cT+fAAHA0UEMAV2BTYEDAN8AeYAyAHxAX8C1gIvAm8BGAA4/4b/hv+q/0MAeQBpAIEAEwB2/+X+CP/X/63/mv/I/8b+3v2R/an97v11/TX9fPz8+3D87Ptv/Kj+NgHyA3MFcQbXBWcD2wGpAMYAjwEAAjQDOANAAjUBCQB6/3//QP/I/2oA0//m/1MAu/8k/7b+Nf9u/2//FACp/+3+ZP6y/V79zvyH/Fj8VvyA/Gf8R/yJ/cb/MAJCBIUFmgUwBI4CeAHXAJIAygC3AVACGgK5AQoBLwCY/+z+Cf+2/+X/hwBlAQ8BRQCE/7L+q/5r/j///v+E//H+NP5f/bX8Bvz7+wn8V/zH/BH9S/3//poAUwMvBQ0GcQXbA1gCQwGNAGcA6ADzAVUCiAJTAn4BsADL/w7/4/4e/2n/EwETAdgAawAO/9L+KP77/Qj/1f7G/pP+0P1P/Vj8y/vE+7r7YPzL/EL9/P8sARgEIwYJBo8FHAPJAAwAJf/M/6wACAITAxQD8gISAuwAPwAV/xn/HP+T/yIBzQDaAG8AIP/9/gr+8/20/j7+dv6H/vn90P2D/O77rvtm+2r8Mv2L/uUBSAPIBdwGEAV1BFIC4f8CAAP/f/+IABABKwJMAgwCowGBAG3/9P48/gT/LgAiADQBEQFnAHsAOv/a/tb+FP41/kD+/f3f/cX8O/ya+xT7mfsX/EL+XwFZA18GVAcABrMF3AIwAMX/7v3v/SH/mP9JAYMCiAKtAvABugDW/w//UP/7/lv/zf+l/wcArf9s/5D/6/64/q7+TP7o/Wv92PxQ/Iz7mvvH+3D9mADGAlAFmQbjBX8FXwP3AFsAdv70/cL+pP7t/6EB4QGdAoQCmAHQABUAdP/O/r/+PP93/wsAGQAjACoAiv8D/7T+Iv6e/Sv9vvyL/Kb7nvvY+/X9HgHuAjsF7gZFBucF4QO7AdP/Qv6+/XT9KP5I/0sARwE6AokCcAIUAhABj//W/j3++/1G/or+Pv+4/77/wP+B/+D+OP5z/a38Cfxd+1n7HvzD/mEBLwOxBYkG3AZTBmEEiAKZAPD+gf31/Bn90v3r/kQAjwFYAsYClQKDAZIAgP/B/hX+p/3g/Uj+tP4n/4n/Zf8s/57+2P0I/UP88/tI/CX+PAAGAg0ENgUTBlYG/QTfA7oCDwGi/1n+pP13/V/92v2m/pz/1ACGAZsBqgF8AQYBRwA9/5b+Kf7B/aT9xf3M/f/9CP71/dD9j/1b/Z795v4CAF0B0AKbA1wE6ARHBLYDQQMmAhIB8v8e/47+CP7+/Tn+2P6e/0gAmwDrAA4B0gCBAPD/Yf/d/lD+CP7h/cb9yv3j/en9zP3C/cD9Cv4Q/w4AEQEMArMCTAPsA9IDhQMuA5gC3gH5ACgAhP8Q/87+0v7y/lP/vf8JACcATgBEADoA9P+G/yz/wP50/lz+Hv4K/uP9x/2w/Zj9k/3o/cz+n/+SAHkBIQLZAoMDsgOhA2QDDgN2AsYB+AA/AL7/aP8l/wb/HP9V/6H/x//n//T////m/5v/X/8F/9P+uv6F/kT+Cv7d/bX9of2F/dP9if5E/yQAAAGoAUgCEQNpA2oDWQP4AmACyQEEATUAt/9b/xD/+v7j/g//Rv91/5b/of+t/6z/lP98/zf/Ff///sX+rf5p/jr+D/7w/d39G/68/nT/MwAYAckBYALgAlcDfANHA9ACLgJ5AcMAKwCs/0z/IP8G/xD/Of9b/4L/mf/B/8z/vv+9/4//WP8y//T+zf6Q/j/+C/7U/a39x/1U/hb/8f/jAJgBVAL4AogDwQO2A1UDuAIGAl4BqADw/3H/BP/S/r3+x/7h/vz+PP9k/3v/i/+I/2v/Tv8h//P+pf5m/iP+y/2X/ZP9Cf6w/oP/YQAqAQACuAI7A30DdQMoA6YC/AFJAYoA4P9S//X+zP7I/tj+Df9H/33/t//T/9T/1f+o/3D/KP/d/ov+K/7c/ZD9Sf0X/Xb9KP4g/y0ANQFKAj4DEASXBKcETATaAyIDPAIOAfz/+f40/rb9cP1i/ZH96v2J/jr/0P9HAIgAkgBjABIAjv/R/g7+N/2E/Nb7ePvQ+7/8YP4RAOwBfQMCBTwG6QbpBksGVwURBJ0C7ABs/xb+GP19/Cz8Svyw/HD9af5X//X/egCnAJYAPgCV/+H++P0o/Vj8tftD+0r78vtk/Tv/VgEiA88EOwYzB3QH+wYbBrwEOwOSAc7/Y/6D/dD8dvx+/Nv8ZP0o/iL/5P9TAJYAlABWAOL/G/9s/rf96PxN/NT7svve+4v8Df7g/9oBhgP5BCIGwwbEBiEGGQXXA10CwwA9/wn+VP3W/LD8Gf3C/WP+TP9GALAA2gDpAJQA+f8U/zr+nv27/Pj7i/tg+2n7CPxl/TT/cgFoAwQFOwbKBvAGUAY4BfQDmwIFAYD/Qf5h/cj8YPzK/Fj9//3S/tD/cgC0AOcAvQBAAKP/2/5E/p791fwt/PX7+PsE/Mj8P/4IAOUBewPRBKEF+wVPBq0FugSbA28C6ABs/2/+oP3o/Mn8SP22/UP+/P7a/0gAkgCzAIEAJQCA//f+T/5W/Wv8BfzA+2v79/su/eP+6wDjAm8EbwVoBggHaQalBbcEUAOLAff/x/6k/bD8ePzQ/C39xP2F/jz/5v9YAJwAgwAdAHX/Hf+I/of9u/xb/B780vtm/I39D/8wAR0DbgRJBR8GigbZBeIE3gNoAsAAcP9x/nD9lPyA/OD8Of3D/Xb+Qv/d/0cAmgCaAEgAvv96/9/+//0m/dP8lPxg/Nv84v2G/3ABJANYBBkFuAUIBmkFaARpAxQCmABd/4j+oP3K/Ln8EP1H/af9Rv7r/nj/BgBSAFgAIgCx/3T/9/4m/nP9V/0X/c/8QP1U/tf/kQECA/cDrwREBYoFCAVaBGkDXwIdAeP/9v4N/jP91PwD/RT9UP3X/ZT+Uf/I/x0AUQAmAMf/oP8p/1b+o/19/UD98Pxg/WH+tv9UAcACrgN0BAcFOAW+BDMEMQP8AQgBAQAF/yn+bv1S/WD9bf2g/fL9h/4q/3//qv/g/8n/f/9o/zH/mv4G/hf+zf1o/dH9s/7I/z4BfAJtAz0E2wQKBawELgRKAzACUQE1ACv/YP7H/Wr9Xv1I/Vz9jP3o/XL+2P4Q/z//ev95/5X/R//A/lr+Z/5C/vj9bP4//2gA0QH1AtkDsAQ4BSkFwgQwBBgD+AH2AND/vv73/XT9Iv0S/R39Sv2Z/RT+i/74/jj/XP9o/1//TP/Z/lP+Fv4n/hT+GP7C/nv/rQAMAuICogNCBKYEYgTuA1QDXAKBAYQAhP+x/hn+u/2H/X/9l/3b/UD+pP4Q/2z/g/+i/7b/oP9f/xP/t/6d/qn+gP7D/kr/AQD4AOoBlwIuA7kD2wOmA0YDnALGAfcAQQBU/7D+QP78/dX96P0J/kb+nv7k/jz/ef+P/5b/mP+Q/3n/SP8L/xf/JP8k/1b/u/8bAJ0ANAGfAfUBUwJiAlwCQQLiAWEBBgGeABEAp/9n/yL/9/7b/uX+6f4H/zT/T/9r/3r/gP+G/4T/bv9V/0z/Tf9O/1r/gP+k/9v/HQBdAIQArADOAOAA5QDbAK8AigCFAGYAPQAoACMAKAAnACYALQApAC8AEAATAA0A6f+2/6T/d/9I/xP/6v7e/s3+y/7l/ib/T/+T/+7/KwBRAHcAkACbAKkAnAB2AGgAYwBAADIAKwAhACgAMgA7AEUAXwBpAGoAdQB2AFgAPgAqAPr/0v+m/4j/fP9u/3z/jf+j/9T//v8ZACgAPgBIADMANwAkAAAA+P/o/83/t/+7/8r/yf/e//j/HQAoAD0AWwBXAEgAPgAiAPr/y/+v/4//e/9f/2r/i/+d/8H/4P8JACIAPQBbAE0ASgBWADAAFAD6/+L/0//M/8v/0f/U/+z/DAAaADAASQBXAFoAUQA3AB8ABQDa/8j/n/+P/4n/jP+a/67/2////xUAMQBQAF0AYQBsAFUALgAbAAcA8f/o/9L/yv/I/87/4//1/wAAEwAzAEMAOAAlACAADwDu/9P/vP+p/53/mP+n/7X/yv/l/wIAHQA2AD4AVwBYAFgASAA6ABsA/P/y/9X/z//H/8v/1f/m//r/CAAgAC8AOwA3ADAAIwD5/+j/0P+4/6H/mP+W/5X/p/+y/9n/AQAQAC8AQABJAEsASgBKADAAGADy/93/0v/E/8T/v//O/+3/CAAWACEAPwBEAEMAQAAwABQA9f/V/8D/sP+c/6P/oP+4/9b/7/8OAC8ARQBUAGMAYQBSADwAIAAKANr/0P+4/6z/sP+1/87/6v/+/xUAMgA/AEUASgA5AC4ACgDr/9L/v/+2/6r/o/+o/7j/0//j//v/FgApADMAOgAsADkAJAAQAAoA7f/W/9T/3f/O/9//6P/6/wIAAwAdAC0ALgAmAB8AFgACAPz/6P/W/83/yP/Q/9r/1v/l//7/BAAMABgAIAAdAA8AHwAXAAcA9P/w//L/5//g/+D/4P/n/+r////6////BAAPABUAEgAOAAYACAD1//b/8f/r/+z/4P/p/+X/7//7/wAAAwAKAA0AHgAYAA8ACwAPAAkA9f/t//D/5//p//X/6//4//n//v8BAAcADQAIAAgAAQD4//L/8f/5//v/7f/x//P/9//4//T//v8EAAIAEAAHAAwAFwAIAAEA9v/3//3/6v/o/+X/8//w//j////4//D/+v////z/AgACAPv/+f/4/wQA+P/2//v/9//5//f/9//5/wgACwACAAMADwARAA8A+/8CAPz/9//1/+r/+P/5//P/7//2//n/9P/8//3//P8EAAMAAQD9/woA/v/2//P/8P/5//r/9f/5/woABwD/////BQACAAIA/f/4//n/9//y////7P/x//f//P/7//L/BAAGAPn/AwD4//7/AAD4/wIAAgD7/wQAAwAFAAkACAD9/wMAAQD6/////v/6/wAA+//0//n/7//0/+7/9v/2//j/8v/3////9/////7///8GAPz//f8KAAkA/f8HAAwA+//9//n/+P/3//j/9P/3//j/7v/w//j/9f8CAPL/8//4//7/+/8AAP7/+//v//T/8//6//j/+P8FAAAACAAAAAcA/v/3//3/AAAEAAUA+//9//T/+P/4//v//f/5//T/BAAAAPj///8AAO//EgABAAgAAAACAAMA9v/0//X/+P8FAPr/+f8JAP///f/8//r/AQD4//L/9v/2//b/9//2/wEA///4//P//v8CAPv/CAD7//v/9P/9/wIA7//7//f/9P/4/wIABAAJABQAAwABAAEAAwD4//T/AgD9/+z/6P8YAA4A3P/o/xgAAQDW/+D/IQD0//L/8//8/wgABgDw//r/EAAOAO7/yv8rACAAzv/Z/x4A9v/A//n/FAD1/wUABQDy/w8ACgD2//7/CgDy/x4ADADS/ysA5P/g/0UA3P/B/xUAPwDS/+H/KQD3/+b/7v8AAPj/UQDl/5b/VAA/AMX/rP9aAPL/i/8NABEA2v8fACcA0f8HAA4A6v/o//n/8P/o/6f/RgALAJD/GABAANj/ov8PADAA0v/s/xgACgDR/wkAQQDe//j/HQAHAAUA/P8HAA4ACgDu/77/HwAIAMr/+/9QAN//CQAcAOT/AgAzAOj/4P8gAPP/4f8MAP//9f/9/wQA8P8qAO//4f8TAPP/3P/Q/yEAAADO/wMAAwDy//f/MAAXAPj/MADF//H/HADb/+//GgDk/xoAGACz/xgAAwCq/xsABgCu/+b/FwDZ/+3/OAD0/+D/KwDh/7v/RgDv/8D/agDw/6T/dgAHAFP/ogARAGD/XwBMAIb/GgBQAJT/8v8XAOj/6P8TAAMAx/8iAAQA2/8XAAIA4P8tACMAyf8LAAQAxv/+/xIA3f/X/wIAAAAWAPj/BQAJAMD/CAAJANf/CAAWAAMA7v8SAPz/8f8JAOL/DQDw/+3/CADK/xIAEADe/1UABgDP/zMAt//k/zQAz/8KABgAEAD2/y4A8//a/xgA8P/Q/woABwDa/wMALAACAOD/NwDp/53/TwDA/7n/OgDe/zcASADp/zwA8v/V/w0A1f/2/yQAu/8MAOf/0//0//H/xf8qAAwA5/8wAAgA8//+/9T//P/f/7f/GwDg/8j/JwDl/zUARQDw/z4AAQDv/xsA5v8MABMA6P8RABAAu/8PAN//rv8RAPX/uf8PAN7/2P/6/8n/+P8AANj/UwAAAKz/MADu/wAALgAbACAAAAAHABIA6/9IAB4ADwAwAO//9//S/9n/3v/A/9T/rP+x/93/tf8TANX/qf9QAMj/UgBBAB8AcwAhAEgAbABSAI4AfgBrAGgALwAZAN7/4P+J/6L/Vv9G/yD/Mf8+/2H/M/9I/7r/i/8vAC4AUQDkALAAAgFIAR4BcAEvAQEBGwGgAF8ALwDA/3H/Iv+4/oH+gP4s/kb+YP7w/Yb+xP7Y/sr/z/9OAPYA+AC1AegBRAI/AmQCdALDAcsBKgGSACoAYf/3/lj+kf3n/Vv9Af21/fX8j/0g/hn+Sf+Z/0wAUgGgAdgC6AKiA6ADegOmA78CcAKiAcMAKAA2/5D+xv0j/Qb9lPxk/MD8nvwf/YD9/P3i/qL/lwA1ATgC/AJLA/UD8QPqA+ADJgOyAuEBswARAOj+OP5Z/eD8gfyX/FL8tvzo/Ar90P0p/ur+sf9nADABDgKgAj8D7gP4AxwEIgRJA+MCDAKvAOn/qv6o/Un9Sfzl+zf84Pso/Mb8rvyS/RT+gf6s/1UAMgEvAs4CjQNOBCcErwRfBMEDXwNhAmgBiAA4/1T+zf31/Hn8aPwy/Hr8mPzR/EX9vP1J/vr+of83AFkB1wGNAmEDmAMkBCEEqgNzA7UCygEDAdb/uP4n/lX9gvxO/Cj8OPyX/Nf8gP3T/Xj++P7D/14A1wALAnMC9wLJA/UDTAQ+BKEDIwNDAikBUAAP/wv+qv21/ET8J/z5+1b8k/z+/Mj9CP7U/k3/OAC8AEUBZAK5AkAD8gMQBGYEJgSXAxMDDAIAAQYAlf6y/TH9TvwR/BL88Pua/NX8Q/0Y/j/++/5q/0AAywBsAW0C8AJAA+cD/wMeBOYDPgOoArABngCg/0z+YP0R/Uf8EPxB/DD84vxL/aX9Z/6O/iH/nv8/AO8AeQFpAtACQAPuAyAEOAQaBGgD0QLgAagAov84/hn9wvwP/LT7Jfwk/MP8bf1v/Uj+pP60/p3/DACzAHQBBQK+Ah8DtwMUBPkDBwSIA8ACDQLxAPn//f60/ff8qvz9+0H8g/y4/KP98P1R/hX/HP+d/xEAZQAMAYcBBQK5AgEDhgPBA78DmAMoA10CmQF6AHf/R/44/ar87/v1+xj8gPwo/b39F/7E/gT/Mf+k/9P/VADUAFsBHQKiAlMD6AMfBDoE+ANWA6ACjAFvAC//1f0Y/WD8DvwW/ID8Hv3B/UP+zf4p/0f/aP98/6j/5/9MANcAgQEpArsCgAO2AwAE+gNkA+kCswHgAIL/D/40/Ub8+/va+0f84PyQ/TT+uf4w/zP/Wv9I/1j/k//Z/2YA2ACdATEC9QJmA64DywOkAycDdgKDAaEAh/9U/pz94Pyl/I783Pxz/d/9bv7s/iv/Pv9g/zb/QP9g/53/GgBvADAByAGUAjgDtgPJA8oDcQPeAjACFQEiACL/H/5s/ez8rPzQ/AD9qP0R/pr+Ef9A/1b/WP8y/0f/S/9y/yIA/f/9AEgB6AHpAjYDuwPIA78DXgOcAr0BsAC4/5b+tv0E/Yb8bvx+/MP8ff3//Zj+J/9S/2r/Y/8g/1P/Pf96/xcACQALAWIB+wEYA1AD5AP1A8gDewOnArsBqQCW/4X+lf30/IH8cPyW/P38wP1p/g7/nP/V/77/kP8Q/6f+qP58/g3/Of+w/70AEQFgAk4D1QOOBHwEdQQWBBgDMQL3AMX/qP6i/er8cvxp/Iv8A/2a/V7+6P5h/9j/if9K/+z+Pv4X/gr+GP7f/j7/+v8DAasB6QLjA6MEMAUSBfcEagRmA0AC7QCt/1X+Vf2Z/A787/sg/JD8D/3F/Vn+B/+U/5D/jf9w//r+r/53/m/+rP4z/8v/iACLAXACfgNlBA8FeQV/BRwFjwRMA/8BkgBF/9P9yfws/Lr7ovvV+1j85PyY/TT+6P5q/4D/x/+v/27/P//j/uD+7v48/5b/FAC8AHgBUgIYA8oDgwTCBOMEoQQRBEID1wG0AE7/G/7g/Bn8uvtl+6f7Ivyy/ID9Pf76/sr/QABeAMAAkgAcAM3/O//8/qf+oP7R/kL/qP+aAFcBDQISA50DLARyBGAEJgSaA70CzAGPAID/Rf5I/Zf8CfwK/Az8evwq/c39qP5f/wEApQDPAMIA0QCBAAAAe/+4/mj+Af73/Tv+pv5X/zQAbAFCAkQDGQS6BDgF3AS2BB0EBAMDArIAfP9i/i/9yPxE/A38e/yX/ED95f1f/iL/dP/o/0EAKAA5ACEAwv91/+z+fP4k/uv9//0e/qf+QP83ADEBCgIwA9ADvgRaBSgFSAW4BM4D2gJoAS4A5f6W/fb8IPy8++H7z/tc/On8dP1S/sr+gP8JACMAawB1AGQAMwANAI7/Kf/3/p/+eP5q/pj+F/+w/2gATAH+AQQDrwMRBKQEjwSWBAYERwOBAjMBNwA//wj+TP3A/Ej8S/xw/MD8X/32/b7+gf/w/2kAwgDfAPgA1gBrABMAqP8V/67+Mf4r/gL+6/0l/mf+VP/g/9kAswFUApgD+QOcBOAEuATlBO8DQgNVAu4A9/+y/pr9wPwC/JD7mPvU+0/8Af21/a3+j/8IAJ8ACQEnAUoBAAHEAFQA0/95/+H+hP4V/gr+IP4G/lv+rv5r/xUAzgDvAWMCgAMiBGME7ASoBK4EIAQQA3oCFgH//wT/u/0I/V781/vI+/b7Wfzy/J79Vv43/+T/OADNAOEA0ADPAFQAJACY/wn/wv5I/h3+5v0L/kr+Y/7c/kj/DADAAHoBmAIBA+EDkQShBPgEsASABPUDyQIbAtIAs/+Q/qz92/ws/Pz7w/vd+2382fyR/U3+4f6i/1IAhwDNAPkAuACnAFcA7/+6/yz/7v6+/oj+f/5//tL+5v5j/8//NwA5AWgBbQJDA1gDcwRdBGYElgQBBNAD0wLJAQEBsf+c/rT92/wx/N77tfvJ+1r8zPyA/Vf++P6q/1cAoQDtAAIB4ACqAFAA7f+E/xz/yv6L/oH+Qf6F/tv+2/60/+j/awCIAZABmAIrA2EDSAT7AzMEMwSYAzIDHwJeATIALP88/lr9rvwr/A/89/tU/KH8Sf3t/Zv+T//W/1oAowDtAPoAxgCbAD4A6P+K/yX/0P62/nX+ev7D/qj+9f55/6z/SgAVAZEBTAL2AlADDAQiBB4ENwTIAzkDYwKPAX8AV/9k/oj90vw0/P77DPw6/K/8W/3t/cf+f/8YALUAAgEwAToB9gCkAEAAwv9M/+/+lP5V/jv+Tf6B/of+A/+A/+r/sAB2AREC0gJgA8MDMgQeBAAE2wM/A5ECsQHIAMH/v/7x/Tz9sfxl/GX8n/wC/Yj9Of7U/nP/5P9RAI8ApQCkAGgAJQDW/3//L//a/qb+h/5V/n/+rv7c/j7/sf8xAOMAsgErAvICUgOGA/YDqQN/A08DogL7AToBXwB0/5z+8f1a/ez8rPzB/P/8Tf3d/Vz+8P5o/7v/JABvAIUAjAB9AE0AHADD/53/Wf8y/zD/8P4k/1j/bf/D//P/ZQDSACsBigH3ARoCZwJ9AlsCVwIkAtYBcQH3AHwA5P9u//r+jP5I/h/+Ef4Q/in+S/6g/tv+EP9R/4z/uv/w/woAFQAfACoALAANABAA+f/f/9r/zf/M/8j/0v/2/xAAJwBeAHgAqADkAOkABgEdARgBCgH4AOoAvgCQAGgARwAaAPj/w/+u/4r/bf9i/zL/P/8v/zD/Qv89/0r/W/9s/4D/mP+p/8P/0P/h//H/CAAOABkAIAApADAAMAArADYATQA+AEAAPQBAAEQANwBIAD8AMwBFAEUALwApABYAEQAIAPr/7f/i/9j/y//F/6//qv+p/63/q/+s/63/tv/L/83/6P/y//b//P/4/x4AGAAQAB8AKQAlAB8AHQAlACYAHwAmACYAKQAjABYADwAQAA8ADwAcAAcABwAPAAsAAwD7/wAA/P/w/+b/4P/d/9n/0v/G/8v/vv/E/8b/yf/H/9D/2f/o/+3/AAAUAAYAFwAbABAAFQAYAA4A/v/+//r/8//6//L/7P/o/+n/7//y//z/8P///xAAEQAdABUAEgAZAB8AFwAaAAgA+//3/+//6P/k/+H/3//j/+L/6f/t/+3/BwAQABkAHgAlACMAMQAsABwAEQAIAPr/9P/s/+z/5v/c/+D/6f/o//P/7v/w//n/BwASAAoAEQAYACIAEwAOAA4A9/8DAPj/9P/r/9r/4v/i/9j/1f/U/9//3//p//T/8f/2/wsACAAWABQAFQATABYACgAJAAIA9//w/+//5P/g/+T/6f/r/+X/6f/5/wEABQACAAwAHAAcABMAFQAfAA4AAgAKAAIA/P/2/wAA8//s//D/7//v/+//9//w//v//f8FAAYA+v///wYACAAAAPz//v/1//D/+P/v/+L/5//4//n/7f/2//T/8//+//b/AgAKAAgABAALAA8AEQAIAAMACAD8//z//v/6//L/7//w//X/+P/3//b/7//9/wAA/P8XABAACwAIAPf/AgAJAPb/+f/2//b/9P/t/wAA/f/5//j/7/8FAPf//f8CAAcACQAIAAgACAACAAAA/P/2/wAA9//o/+f/8P/5//D/8//z//b/9v/5//7//P/+/wUAAQD4/wMAAAAAAP//+P////v//P8CAPX/AAD4//3/+P/u//X/+f/4/wEA9v/z/wIA+f8AAAEAAAD6/wAAAQD8//7//P8CAPj/9//9//D/AgD///f//f8CAPv/8v/6//n/+P/8//z/AgAFAAUABAAHAA8A+P/7//f//f8BAPv/BwABAAgA/v8EAAMA9v/9//3//f/6//T/9P8JAPj/AAAHAPb/9P/5//7////z//X/AAD0/+b/AAD5//D/BQD3//D/AAD4//v/AAADAAcAAAD2//r/+P/1//r/+f9QAE0Ak//w/0QAuP/B/+X/2P+S/wEA8v/h/wcAGgAgAC4AOQAzABEAKQAjAP//6//c/+P/6//l/+T/6f/o/wAA3P/0//T/AwAIAAkAEgAEAAgADQAQAAoAFwABAPr/8v/t/+n/5//d/+L/4P/r/wEA6P/f//j/AAAQABwAIQAXAEUAJQAdAO3/x//K/8X/+P/e/8v/6f8JAPz/DwAfAAwAIAAyABIAHQAVAOX/0f/B/8f/zv/W/9j/+f8MAA8AFQArABoAHAALAAIAAQD4/wIAAAD4//7/9P/3//j/AAABAPr/+v/+//7/BQADAAIA8/8CAAMAAQAGAP3////1/+z/+f/x/wEADAAAAPf/4v/4//L/4//7/wkA6v/2//X/9v/4/wAA/v8FAPf/AQABAP7//f8CAAAA+/8HAO7//f8GAAAA///9/wYA/v/t/wgA/f/y/wEACwDq//7/9v8EAO7//v/7//X/AgAAAAAA+f/6/wQA/f///woA5/8AAPP/8/8FAO7/AwD4//3/AQD9////+P/2//f/9/8BAPz/BQD6/wEA///v//j/+P/9/wIA8/8BAPD/9v/5//L/DgD3/wUA+P/m//3/7v8QAP/////t//r//P/4/woA7f/6//7//P/+//r//P/8/wkA/P8AAA0A+P/9//f////z/wAA+//9/////v/7//r/+v8JAAAA6/8GAAIA5f8WAPj/AwD9//b//P/z//r//P8FAPf///8EAPT/BQD4/+3/FAD2/wgAAgD+/wAA7f8AAAMAAQDd//z/FADW/woA/f/6/wAAAAAAABMA//8QAPL/BQDt/wYA7P/y//z/9v8UAPD/EgDt////7P/8////+P8LAPD//v/2/+b/CQDq/xEAAwAHAPr//v8AAAQAAgAKAOD/FwDy//j/7v/6/wgA6P8BAOX/BADg/+3/KgDb/xAA9f/v/xwA0v/+/xkA+P8HAAkABgD3//X/EwDp/wYABADS/ygA8P8cAP7/5f8PAOj/+f/5//n/3P/6/x8A6f/8/xAA9/8ZAMj/BwAPAOj/BQAAAAgA1P8EABsA6v/z/wQA+v8MAMb/NAAPAMD/EAD//woA7////xoAyf8QAAEAEADv/+z/GgDt//L/6P8YABMA2/8PACAA3v/9/w8ABADt/9f/FgDn//T/9v8OAAcA4P8AAAIAGQDp//7/DgDw//L/BgAEAPP/7/8IAAAA8v8AAP7//v/w/wIAEwDh/wIA8v8JAP3/AQAIAOb/CAD9//f/AwD9/+r/8/8EAPj//P/7//P/DwAMAPj/9v8LAPf/9/8AAAYA8P/6////9/8FAAMA8f/4//3/BQD7/wEAFQAKAAYA4f8AAAQA9v8OAPP//f/i//7//f/+//r/AAASAAAA8v/8/woA+v/y/wgABgD0//z/AwAIAO7//f8AAPT/8v/8/w8A///z//z/9v/k/wcA6P8BAAQA9v/9//f//f8BAAMABgD9/wgABQD8//D/+v/3//b///8CAPz/BwD///j//v8BAAsA9P/9/+//9P/w/wEA+v8FAAAA9P/w/wMAAwAAAAEA/P/z/wAA8f/w/wMA8P/0/wMA///9/wQA/f8DAP3/+/////n/7f8BAAAA///7/+7/+/8BAP//AgAEAAEABAD6/+//8v/6/wAA///6//n/BQD9//b/BAAIAPD/+v8EAPT/DwAJAP//CADx/+///v/y//v/+/////3/+f8FAPn/AwD6//X/8v8EAAIA+P/x/wsA+//9/wEABgD4//P/+//6//v/+//v//b////x//b/+v////f//f8BAAQACAD0//f/AQD4/wUA9v8CAP//+P8CAAUABwABAPz/+P/7//j/AAAHAPb/8/8HAPf/9P8FAAAA8P/6/wIA9v/6//7/9v8AAAQABgD1//3//P8DAP3/CgD5//v////7//X/AgD+/wQAAAD5/wAA///+/wUA/P/t/wAA+P8NAPr/9P8MAP//+P/4//3////+/wMA/P/7/+X/8/8LAPv/AQD9//j/+v/u//X//f8AAPr/AAAAAAUAAAD6//r/BQAEAP7/BAD+//z//v/2/+7/AAD3//v//P/6//T/5f/5////////////BQAAAPv/AADp/wQABAAAAPv/+/8AAAUABQD5////CwD5//L/AAAAAP////8DAAMAAAAAAAAA8//7//r/AAAFAAAA+v8AAAUAAAAAAAAACwDw/wQADwDx//T/BgAAAPr/+v/y/wYA+v/6/wYA9//9/wgA/P/9//z/CAD8//z/CAABAAcABQAAAPn/CwD///n/BQD6//r/AAAAAPn/BQAFAPr/+//6/wAAAAAAAPr//f8CAAsA+f8AAAAAAAD6//z/CwD//wAAAAAFAPn/AAAAAAAA//8EAAUA+v8AAAAAAAAFAAIA/f/0//r/AAD5//n/AAAAAAAAAAAAAAoABAAFAPr/+v/5/wQABAD5/wAAAAAAAAAABQD//wUAAgD3/wAA+v/6//r/AAAGAPT/AAD9/wIACQD2//3/CAABAAEAAgACAAAA/f8CAAsA//8AAAAABQAAAAAA+v8AAAQACwD8//b/AQD7//r///8KAAAA9P/7/wAAAAAAAAAAAAD6//3/BQAAAPb/DwAFAPn/BgAAAAAA//8FAAAA+f8AAAUABQAAAAAAAAAFAPr/+v/6/wAA+v/6/wIAAgAAAAAABgD5/wAAAAD5/wAAAAAAAAAAAAAFAPn/BQAFAAAA+f8LAAIA+f8AAAgAAgD3//f/AwD9//z/AgACAPf/9P8AAAAA+v/5/wUABQD5/wAA+v/6//3/AQALAPn/9f8QAAAAAAAFAAUAAAD//wsA/P/9//r/AAAAAPn/BQAFAPr/9P8AAAAAAAAAAAAA+f8GAAAA7f/9/wgACAAAAPn/BgAFAAAAAAAFAAUA+f8AAAAAAAAFAPn/AAAAAAAAAAAAAAUAAAD5/wUAAAD0//r/BQAAAAAA+v/6//3/AgACAAIA/P8IAAsA+P8AAAUAAAD6/wAABQAAAAQABQD5//n/BQAFAAAA+f8AAAAA+f8AAPr/AAD6//3//f/2/wgAAgAIAAIA/P8MAAAAAAAAAAAABQAFAAAA+f8AAAwAAgDw/wAADwACAPf/8f8AAAAAAAD0//r//f/8/wgABQDz//z/CAAFAAAAAAALAAUAAAAGAPn/AAAFAPr/+v/6/wAAAAD5/wUAAAAAAPT/AgAFAAQAAAAAAAUA+v8AAPr/+f8FAAAA8/8CAAUAAAAAAPr//f8CAAUAAAAAAPn/AAAFAAUABQAAAAUA/f/5/wAAAAAAAPn/AAAAAPn/AAAAAPn/AAAAAPn/CwAFAPr/8/8GAAUA+f8AAAAAAADz//3/AgACAAgABQD5/wAABQAAAAUABQACAAkA/f/3//f/+v8AAPr/8//9/wIAAgACAAIABQALAPL/AAAFAAUABQD6/wYAAgD8//3/8//6//n/BQAFAAUABQAAAAAA+f8AAAAAAAAFAAUAAgD9//P/+v8GAAAAAAAFAAUA+f/6/wAABQAFAAAAAAAAAPn/+v/5/wAAAAAFAAAABQAGAO3/AAAMAAAABQAAAAAABgD6//P/AAAFAPn/BQAAAPP/AAAAAAAA+f8CAAAAAAAFAAAAAAAAAAUAAAAFAAcA/f/9/wMA9v/5/wAA+f/5/wAA+f/2/wIAAgD2//b/AgD8/wkADwD8/wIACQAFAAwAAAAAAAwAAgD2//3/CQACAPz//f/9//3/9v/z/wYAAADz//P/AgACAAIA/P/9/wIACQACAAIABQD5//3/AgACAAIAAAAFAAAA+f8FAAwABQD9//3/+f8AAPn/+f8AAPn/AAAFAAsA+f/y/wUABQAAAPn/AAAGAAAA8/8AAAUAAAAAAAwAAAAAAAkA8P/5/wAA+f/5//n/AgACAAAAAAAAAAUA+f/5/wUA+f8AAAAAAAAFAAAAAADz/wUABQAFAAAAAAD5//P//f8CAAIABgAAAPn/AAD5//z/9v8JAA8ADAAAAPn/BQAFAAIA/P/8//3//P8CAAIA/f/8//b/8//5/wAAAAAFAPn/+v/5//3//f8CAAMAAwACAAIACQAAAAwABQDz/wUADAACAPb/+f8AAPn/DAACAPP/8/8AAAAA+f/2/wIACQD9//b//P8JAAkAAgACAAUAAAAFAAUAAAAFAAkAAgD8//z/9v/8//3/AgD2//n/BgD5//n/+f/z//z/AgACAPz/AgAJAAIAAgAFAAUABQDz//n/AAAAAAAABQAFAAUABQACAPz/9v8AAAAAAgAJAPz/9v/9//3/+f8AAAAA7P/2/wIA/P/2//P/DAAFAAAACQAJAAkAAgAJAAAAAAAMAAAABQACAAkAAgD2//b/AgD8//D/AADz//n/BQD5//D//P8CAPz/AgACAAIACQAJAAAAAAAMAAUAAAAFAAkA/P/2//z//P/5/wAA+f8AAAUAAAAAAPn/+f/5/wAAAAD5/wIAAgAFAAYAAAAAAAYA+v8AAAUA8/8AAAYAAAD5//n/+f8CAAUA+f8AAAUABQAAAAAABQAFAAIAAgD8//z//P8CAPb/8/8AAAAA+f/5//n/AgACAPz/AgD2//z/DwD8/wIAEgAAAPn/BQAGAAUACQACAPb/9v8AAPn/+f8MAAAA+f/5/wAAAAD5/wAAAAAGAPn/+f8AAAwAAAD5/wUA+f8AAAAA+v8AAAUA+f/5/wUABgAAAAAAAAD5//n/AAAMAAwA+f8AAAUA8/8AAAAA8/8AAAAA+f8CAAAA9v/2/wIADwAMAPn/BQAAAPn/BQAFAAUA+f/5//n/8/8CAAUAAAD5//z/CQAAAAUABQAAAPn/BQAMAPz/+f/5/wUAAAD5/wUAAADz/wAA+f/2/wIAAgACAAIA/P8PAAUAAAAFAAUAAgACAAIAAwD9//3//f/9//z/9v/5/wUA+f/z//P//f8JAPz//P/8/wkAAgD8/wIACQAMAAUAAAAAAAUAAAAAAAAABgACAPz//P/8//n/AAAAAPP/AAAAAPn/BQAAAPn/+f8CAAUAAAAAAAUABQD5/wAABQAFAAIA/P/5/wAA+f8AAAAA+f8FAAUAAAD5//n/AAAFAAUAAAAAAAAAAAAFAAUAAgDt//n/AAD5//n//f8DAAIAAgACAAYAAAD5/wAAAAAFAAwAAAD5/wAABQAAAAUA+f8AAPn/+f8AAAAAAAD5/wAAAAAGAPn/AAAAAAAAAAAAAAAAAAAFAPP/+f8FAAYABQAFAAAA+f8AAAUA+f8AAAAAAAAAAAAA+f/z/wIAAAAFAAAABQAFAAAAAAAAAAUA+f/5/wUA8//5/wUAAAAFAPn/+v/5/wUACwD5//r/AAAAAAAAAAD5/wUADAAFAPn/+f/z/wAADAAAAAAA8//5/wUAAAD5//z/AgAFAAAA+f8FAAwABgD5//n/BQAMAAkA9v/2/wAAAAACAPz/8/8AAAUAAAD5/wAAAAD5//n/BQAMAPn/8/8AAAAA+f8CAPz/AgACAAIAAgACAAAAAAAAAAUAAAAAAAwA+f/5/wUABQAGAPz/AwD2//P/+f/6/wAA+v/9/wkAAAD8/wkABQD5/wAABQAAAAUAAADz//n/AAAMAAAA+f8FAAUA+f8AAAwAAAD5/wUAAAAAAAAAAAAAAAAAAAD5/wAA+f8AAAAAAAAAAPn/AAAFAAAAAAAFAPn/AAAAAAUAAAD5/wUAAADz//n/BQAAAAAAAAAAAAAAAAAMAPn/AAAFAPn/DAAAAAAA+f/y/wYABQD5//n/AAALAPr/+f8FAAAAAAAFAAAAAAD5/wUAEgD2//z//P/5/wAABQAAAPn/BQAAAPn/+f8FAAAAAAAFAPn/8/8FAAUA8//8/wIAAgD8/wkAAAD2/wIA/P8CAAIAAgAJAAUA+f8FAAUABQAAAAAAAAAAAAkA9v8AAAIA9v/5/wUA+f/5/wAA8/8CAAAAAAAAAPz//P8JAAYA+v8AAAAAAAAFAAAAAAAFAAYAAAD5/wUABQD8//P/BQAAAPn/DAD5//P/BQAFAPn/+f8FAPn/AAAAAPP//P8PAAUA8/8FAAUA+f8AAAwABQD5//n/+f8FAAwA+f8FAAIAAgD8//D/+f/5//P//P8JAPb/AgACAAIACQD8/wIA/P8CAAIA/P8CAAkABgD5/wwABQAFAAIA/P8CAPz/9f/5/wUA+f/y/wYAAADy/wAA+v8CAAUAAAAAAPn/AAAAAAYAAAD5//n/AAAFAPn/AAD5/wUAEwAAAPn/AAD5/wAAAAAAAAUABgD5//P/AAAFAAUABgD5//n/AAAAAOz//P8DAAIA/P/9/wkA/P8JAAkA+f8FAAYA+f///wAAAAD5//n/DQAAAPn/BgAMAP//+f8AAPn/AAAGAPn/8v8GAAAA8v8CAAMAAAAFAAYAAADy/wAABgD//wAA+v8AAAUAAADz////BgANAP//7P8NAAwA+/8JAP3/9f/8//v/+P8EAPv/+v/4/wAABwDy//z/BAACAPX/AwAQAP//BQAAAAAABQAGAAYA/P8CAAMA9v/4/wAABgD8//n/AAAAAPn/+v8AAP//AAAAAPj/AAAGAPn/AAAAAPb//P8DAAkA+/8DAAMACAAFAAYAAAD//xMACAD8//3/9f8CAPz//P/2//n/AAAAAAAA8//5/wUA+f8FAPn/+f/8//z/CQD8//z/AgAJAAkABQAAAAAADAAFAPz/AgACAPz/9v/8/wkAAgDw//P/AAAAAAUA+f/5/wAAAAAAAPn/+f8CAAIAAAAAAPz/AgAMAAwAAAAAAAAA+f/5/wAABQAAAAAAAAAAAAAABQAMAPz/9v8FAAIA8P/6//n/+v/5/wIA/P/2/wIACQACAAIACQAMAAUAAAAAAAwACQD8//b/9v/5/wAAAAD5/wAAAAAFAAAA7P/2/wkACQAAAPn/BQAAAPP/AgD8/wIAAgACAAkAAAD5//z//P8CAA8ABQD5/wAAAAAAAAUA+f8AAAwAAAAAAAAAAAD5/wAAAAAFAAAA+f/5//n/BQAAAAUABgD6/wAA+f8AAPn/AAAGAPr/BgAFAAUAAgD8//z//P/5//n/BgAFAAAAAAD5/wAADAD8//P/+f8AAPn/AAD5//z/CQAFAPP/AgAMAAAA+f/5/wwAAAAAABIACQD2//b/AgD8//z//f/8//z/+f8AAPn/+f8AAAAAAAD5/wAADAAAAAAA8/8AAAUAAAAMAPn/AAAAAAAABQAFAAAA8v8AAPn/+v8GAAAA+f8AAAAAAAAAAAAABQD5//n/BgAAAAAAAAAMAAAA+f/5/wAABQAAAPn/AAAAAPn/BQAFAAAA+f8AAAUAAAAFAAUA+f8AAA8A/P/8/wIA/P/2//b/AAAAAAAAAAAFAPP/+f8AAPD/AgAJAPz//P8CAAIAAgD8//z/CQAPAAUA+f/5/wwAEgACAPb/+f8AAAUAAgD8//z//f/2//r/8/8AAAAA+f8AAAAA/P/9/wIACAD8/wIABgAAAAAABgAMAAUA/P8CAPz/AgD8//D/AAAFAPz/+f/5/wAABQAAAAAAAAAAAAAA+f8FAAAA+f8AAAUA+f8AAAYAAAAAAPn/+f8AAAAAAAAMAAAAAAAFAPn/AAAFAAAA+f8AAAUABQAAAPn/8/8FAAAA+f8AAAAAAAD5/wAAAAAFAPn/AAAAAPn/AAAAAAYA+v8AAAAABgAFAAUAAAD5/wAABQD5/wAABQAAAAAAAAAAAPP/BQAFAPn/+f8AAAAAAAAAAAUABQD5//n/BgAFAAAA+f/5//n/+f8MAAUA+f8AAAUAAAAFAAAABQAAAAAAAgD8/wIA9v/5/wwA/P/5/wAA+f/5/wUABQDz//P/CQAFAPP/AgACAPz/CQAFAAAA+f8AAAYABQD5/wAABgDz/wUACwAFAP3/AgD8//z//P/5/wAAAAAAAPn/8//2//z/AgD8//z/CQACAPb/AgACAAkACQAAAAAAAAAFAAUADAD8//n/AAD5/wAAAAAAAPn/+f8AAAAA+f8AAAUA+f8AAAUA+f8AAAAA+f8AAAUA+f8AAAUA8/8FAAAA+f8FAAUAAAD5//n/BQAGAAUAAAAGAPn/AAAGAPr/8//6/wYABgAFAAAAAAAAAAAAAAD5//n/AAAFAAUA8//5/wwAAAAAAAUA+f8AABIA/P/5/wAABQACAPz/AgAJAPb//P/8//b/+f/5/wAAAAD5/wAABQAAAAAAAAD5/wAA+f8AAAUAAADz//b/DwAFAPn/BQAMAAUA+f/5/wUAAAAFAAUA/P/5//n/AAAFAPn/+f8AAPP/9v/2/wkADwD8//z/DwAGAAAAAAAAAAUABgAAAAAAAAAAAAAABQD5/wwAAgD2/wIAAgD8//b/+f8AAAAAAAAAAPn/BQDz//P/CQAFAPn/AAAAAPn//P8JAAAA/P8CAAwAAAAFAAAA+f8AAAAABQAAAAAAAAAAAPn/AAD5//n/AAD8/wIAAgD8/wkAAAD8/wUABQD5/wUADAACAPz//P8CAPz//P/9//b/BQD8//r/AAAAAPr/AAAAAPn/BQAAAPP//P8CAAIA/P/8/wIACQAFAAUAAAAFAAUAAAAAAAAAAAD5/wAADAD8//P/AAD5/wAADAD5//P/AAAAAAUAAAAAAAAA+f8AAAAAAAD5/wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAD5/wYAAAD5/wAA+f/5/wUABQD5//n/+f8AAAUA+f8AAAAAAAD2//b/BwAJAAMABQAGAPn/BQAMAAIA9v8AAAIA/P/8//n/AAAFAAIA9v8AAAAAAAAFAPn/AAAFAAIAAgD8//z/9v8AAAUA/P/5/wUAAAD5/wUA8//5/wAABQAMAPn/AAD5//n/AAAFAAAA+f8AAAUAAAAAAAAAAAAFAPn/BQAMAPz/AAD5//n/AAD5//n//P8CAAIAAgD8//3/CAACAAUABQD5/wYABQAGAAAAAAAFAAIAAgD8//b/AgD8//D/BQACAPb/+f/5//n/AAD5/wIA/P8JAAUA+f8AAAAAAAAAAAAAAAAAAAAAAADz/wIADAD5/wAABQAAAAAAAAD5/wAABQD5/wAAAADz/wIA/P8JAPz//P8PAAwABQAAAAIA+f8AAAUA/f/8/wAA+f/5/wUAAAAFAAAA8v8LAAAA+v8AAAAACwAAAPL/AAAFAPn/BQAFAPP/AAAAAAYABQD5/wAA+f/5/wAABQD5/wAAAAAAAAAAAAAFAPn/AAAFAAAA+f8FAAYAAAAAAAAAAAAAAAAAAAAFAPn/AADz/wAABQD5//n/9v/8/wIAAgAPAAUAAAAFAAAAAAAAAAUABQD8/wIA9v8CAPz/8//5/wUABQAFAPz/+f8AAAAAAAAAAPr/+f8AAPn/AAAFAAAAAAAAAPn/+f8FAAUAAAAFAAAADAACAAIAAgACAPb/9v/8//z//P/z//n/AAD5//n/AgD8/wIACQD8/wkAAAAAAAAA+f8CAAAAAAD8/wIABQAFAPn/+f8FAAUAAADz/wAABQAAAAAAAAAFAPn/+f8MAAUAAAD5//n/AAAAAPn/+f/8//z/AgD8//z/AgAIAAIAAgACAAMACwAAAPn/AAAGAAUAAAAAAAUA/P/z//n/BQAAAAAA+f8AAAAA+f8AAAAA+f8AAAAAAAD5/wUAAAD5/wAAAAAAAAUADAAAAPn/AAAAAAUA+f8AAAUA+f8FAAAAAAAFAPn/8/8GAAAAAAAMAAAA+f8AAAAAAAAAAPn/+f8AAPn//P8CAAwABQAAAAAADAAAAPn/BQAAAPn/AAAAAAYAAADz//L/BgAGAAAA+f8AAPn/BQAFAPP/BgAMAAUA+f8AAAUA+f8AAAAABQD5//n/DAAFAPz/AAAAAPn/DAD5//n/DAACAPP/+f8FAPn/BQAAAPn/AAAAAPn/AAAAAPb//P8JAAUAAAAFAAAA8/8FAPn/9v8PAAUABQD5//n/AAAFAAAAAAAFAAYAAAD5/wAABQAAAAAAAAD5/wAA8//5//z/7//9/wAABgAJAAgAAgAIAAAADAAMAAAAAAACAAIA9v/5/wUAAgD8//P/BQACAPb/+f/5//n/9v8CAAkA9v/8/wkAAgD8//z/DwAFAAAABQAAAAAA+f8FAAwA/P8CAAIA/P/8//z/AgACAPb/9v/5//P/AAAFAPn/8//8/wkAAgACAAUABQAFAPn/+f8AAAAAAAAAAAUABQAAAAUAAAACAPb/8v/5/wAAAAAAAAAAAAAAAAAABQAFAPn/AAAFAPn/+f8FAAAA+f8FAAAAAAAFAPn/AAAFAAAA+f8FAAUA8//5/wAAAAAAAAAAAAAAAPn/+f/8/wIAAgD8/wIADwAFAAAAAAAFAAAA8//5/wUAAAD5/wUAAADz//z/DAAFAAAAAAD5/wUA+f8AAAUAAADz//n/BQAFAAUAAAAAAAAA+v8GAAAA+f8GAAAABgAAAPn/+f/y/wAAAAD2//z/9v8JAAkAAgACAPz/CQACAAAABQAFAAAAAAAFAAUA/P/5/wUA8//5//n/AAAFAPn/AAAAAAAABQAAAPn/BQAAAAAAAADz/wUABQAAAAAA+f/5/wAAAAAFAAAA8/8FAAUABQAAAAUA+f8AAAwA9v8AAPn/AAAMAPn/8/8AAAUAAAD5//L//P8JAP3//f8DAAMACQAGAAUAAAAAAAUABQAAAAAAAAACAPn/AAAFAPn/+f/5/wUABQAAAPP/8/8FAAUA+f/5//z/AgACAPz/CQACAPz/AgAFAAUADAAGAPz/CQACAPz//P/8//z//P/2//z/+f/5/wAA+f/5//z/CQAAAPn/AgACAAUA+f8AAAAABQAAAAAADAAFAPz/CQD8//X//f8CAPz/8v/5/wAABQD5//r/AAAAAPn/AAD8//z/AgD8/wkAAgAFAAAA+f8AAAAAAAAAAPn/AgAFAAUABQD5/wYA+f/5/wAA+f8AAAUAAAAFAAUA+f/5/wAABQAAAPn/AAAAAPn/+f8FAAUA+f/z/wUA9v/8/wkA/P/8/wIAAgACAA8AAAAAAAUABQAFAAkAAgACAAkA8P/2/wIAAgD9//b//P/2//r/AADz//b//P8CAAIAAgACAAkABQD5/wAABQAFAAAABQAAAPn/BQAFAAAAAAAAAAAABQD8//P/BQAAAAAADADz/wUA+f8AAAUA+f8FAAAABQACAAIA/P/8//z//P/8//n/+f8AAPn/8//8//D/AAAFAAIACQACAAkAAgAJAAwADAAJAPz/9v/8/wIAAgD2//P/BQACAPz/+f/z//L/AwD2//3/BwADAPz/AgAPAAUABQD5//n/BQD5/wAABQAAAAwAAgD8//z//f8CAAIAAgD2//b/AgD2/wAA8//5//n//P8JAAUAAAD5//n/BQAFAPn/BQAAAAAABQD5/wUADAD8//z//P/z/wUA+f/s//z/AgACAAIAAgACAAUAAAD5//z/CQAFAAAA+f/5/wwABQAFAAAAAAAAAAAA+f8LAAMA9v8CAPb/+v8AAAUAAAD5//n/AAD5//n//P8CAPz/CQAMAPn/+f8FAAUA+f8AAAUABQAFAAAAAAACAAIA/P/2//n/AAD5/wAAAADz//b//P8CAAkAAgACAAUA+f8FAAAAAAAAAPn/BQAFAAAA+f8AAPn/AAAAAPn/BQAAAAUAAAAAAAAAAAAAAOz/AgASAAUA+f8AAPn/AAAFAPP/AAAAAAAAAAAAAAAAAAD6/wAABQAAAAAABQAFAAAA+f8FAAAAAAAAAPn/AADz/wAABQD5/wAAAAAAAAUAAAD5//n/AAAMAAAA+f8FAAAABQAFAAAA+f8AAAUA+f8AAAAA+f/5//n//P/8/wIAAgAJAAwA8//2/wkABQAMAAUABQACAPb//P8CAAIA/P/2//z/AAD5//n/BQAAAPL/AAAAAPL//P8DAAIAAgD9/wMAAgACAAsABQAFAAAAAAAMAAIA/P8CAAIA9v/2//n/AAAAAPP/AAD5//b//P/8/wIACQACAAwA+f8AAAUA+f8AAAAABQAAAPn/+f8FABIAAAD5//n/AAAMAAAAAgD8//z//P/5//n/BQAFAPP/8/8AAAAA9v/8/wIA/P8CAAkAAgACAAYAAAAAAAYA+f8AAAAAAAAFAAsAAwD9//3/9v8AAPr/+f8FAAAAAAD5//n/AAAAAPn/AAAFAAAAAAD5/wAA+f8FAAUABQAAAAAABQAAAAAABQD8/wIAAgD2//b/AAD5/wAAAADz//b//P8CAPz//P8CAAIACQD8/wIACQACAPb/AgAJAAIABQAAAPn/AAAAAAAA+f8AAAUAAAAFAAAA+f8MAAAA7P/w//z/CAACAAIA9v/v/wUAAgACAAMACAACAAIAAgAFAAUABQAFAAAAAgD8//P/AAAAAPn/+f/5/wAAAAAAAPn/AAAAAAUA+f/5/wAA/P/8/wIADwAAAPn/AAAMAAwA+f/5/wAAAAAFAAAA+f8AAAAA+f8MAAUA8/8AAAAAAAAFAAUAAAAJAAIA/P8CAP3/9v/8//b/AADz//n/AAAAAAAA+f/8/wIACQAAAAAAAAAAAAAAAAAAAAAABQAGAAAAAAAFAAIA/P8CAPD/8//5/wAAAAAAAAAA+f/8/wkAAAD2/wkABQAGAAAAAAAAAAUA+f8AAAUA+f8AAAAAAAAAAAAA+f/5/wAABQAAAAAABQAFAPn/+f8FAAUA+f/5/wAAAAD5/wUABgAAAPn/8//8/wkAAAAAAAAA+f8FAAUABQAAAAUAAAAAAAAAAAAJAO3/+v8LAAsA/f/8/wkA9v/1//n/AAD5/wAAAAD5/wUA+f8FAAAAAAAAAAAABQAAAAUAAAAFAAkA9v/8//z/+f/5//n/+f8AAPn//P8PAAAA+f8AAAAA/P8CAAUAAAD2/wkAAAAAAAUAAAD5/wUA+f/5/wUAAAAAAAAAAAAFAAUAAAD5/wAABQAAAPn/AAAFAAYAAADz/wAABQD5//n/BQD5//r/AAD5/wMAAwAAAAYABQAAAPn/AAAFAAUAAAD5/wAAAAAFAAAA+f8FAPn/AAAAAPn/BQAFAPn/AAAAAAAA+f/5/wAADAAFAAAAAAAAAAAAAAD5//n/+f8MAAAA+f8AAPP//P8JAAYAAAAAAAAAAAAFAAUABQAAAAIA9v8AAAUA/P/5//n/BQDz//D/CQACAAIA/P8JAP3//f8IAAUAAAAAAAYABgD6//n/CwAGAAkA/P/2//z/+f/5/wAA+f/5/xIAAAD5/wUA+f/z/wAABQAAAAAAAAAAAPn/9v8CAAkABQAFAAAA8/8AAAUABQAFAPn/BQAFAPn/+f8FAAAABgACAPb/+f8AAAUA8//5/wAA+f8FAAAA+f8FAAUAAAAAAAAAAAAAAAAADAACAPb/AAAAAAUAAgACAP3/7P8AAAYA+v8AAAAA+v/5/wAA+f8CAPz/AgAMAAUAAAD5//n/AAD5//z/CQAAAPz/AgACAAIAAAAFAAUAAAAFAAkA/P/8//z/AgACAPb//P/8//n/8/8AAAwAAADz/wAAAAD5/wAAAAD5/wIAAAD8//z/AgAJAAUAAAAAAPn/AAD5/wIADAD5/wUABQD5/wYADAD8//z/AgD2//P/BQAAAPn/+v/z//3//f8CAAkAAwACAAIA/f8CAAIAAgAFAPn/BQAMAPn/AAAFAAAAAAD5/wAAAAAAAAUA8//5/wUAAADz/wIAAAAAAAAA+f8CAAIAAAAAAAAAAAAFAPn/AAD5/wUAAAD5/wwABQAAAAUA8//z/wAABQD5//n/BQAAAPn/+f/8/wIAAgACAAIA/P8JAAwA+f/5/wUAAAAAAAAACwAAAAIACAD2/wIA9v/y//n/AAAGAPn/+f8AAAUA+f/5//z/CQAFAOz/CQAFAPn/BQAFAAUA+f8AABIA/P/z/wUAAADz//n/BQAFAAUAAAAAAAAA+f/5/wAAEgD8//n/AAAAAAUABQD5//n/AAAAAPn/8//2//z/AgACAPz/CQAPAAYAAAAFAAUA+f/5/wAABQAAAPn/+f8MAAUAAAD5//n/BgD6//P//f8LAAYABQAAAAAABgD5/wAADAAJAPb/9v/5/wUAAADz//n/8/8CAAIACQD5/wYABQAFAAUAAAAJAA8AAgD2//z//P8CAPb/9v/8//P/8//8/wIA/P/8/wIAAgAJAAIAAgAMAAwA+f8AAAwA/P/5/wwA/P/8//n/+f8AAAAABQAAAAAA+f8AAAUA+f8FAAAA+f/5/wUABQD5//n/AAAGAAUA+f/5/wAA+f8AAAAAAAAAAAUABQAFAPn/AAAAAAAA+f8AAAwAAAAAAOz/9v8JAAIA/P8CAAkAAAD5/wIAAAAAAPz/BQAAAPn/AAAFAAwAAAD5/wUABQAAAPP/+f/5/wAAAAD5/wIA/P8CAP3//P8CAAIADwAAAPn/BQAFAPP/AAD5/wUAAAAFAAwA+f/5/wAABQAAAOz/9f8CAAIA/P8DAAgABgD6//z/CwAMAAUAAgAJAAIA/P8CAPb/9v8CAPb/9v/5/wAAAADz//n/BgAAAAAABgAMAAkA9v/5//n/+f8AAAAA+f/8/wIAAgACAPb/9v8PAAkAAAAGAAAABgAMAAAAAAACAAIA/P/2/wIA9v/z/wAAAAD5//n//P/8//z/CQACAAIAAgAMAAYA+f8GAAwAAgD2/wIACAD2//z//f/9//3/9v8IAPb/+f8AAPL/BgAGAPn/AAAGAAYABgD9/wAAAAAAAPn/AAD5//P//P8CAPz/AgAJAAIAAgAGAAAABgAAAAAABgAGAAAAAAAGAPn/+f8MAPz/+f8AAPn/AAD5/wAAAAD5//z/AgD9//3//f8CAAkAAgAJAAwABgAGAPn/AAAMAAIA/P/2//P/+f8AAAUAAADz/wYABQAGAPL/AAAGAAAABgAAAAYAAAD5//n/AAAGAAUA+f/5//P/AgAAAPz/AgD2/wIACQACAPz/CQAFAAUADAACAPz//P8CAAkA/P/8//z//P/8//z/9v/z//n/AAAFAAAA8//8/wIAAgACAAIABQAAAAwAAAD5/wAABQAAAPn/AAD5//n/AAAAAAUADAAFAAAACQACAPz/AgD2/+z/+f8GAAAA+f/6/wAA+f8DAAMABQAGAAAA+f8FAAUADAAJAPz//P/2//b/+f8AAPn/BQAAAAAAAAAFAAAA8/8FAAUA+f/5//n/AAAFAPn//P8CAAIAAgAAAAAABQAAAPP/BQAAAAAABQDz//b/AgAPAAAABQAFAAAAAAD5/wAAAAAFAAUA+f8AAAAA8/8AAPn/AAAFAAUAAAAAAAUABQD5/wAABgDy//n/BQAAAAAAAAD5//r/AAAAAAAAAAAAAAUAAAAMAAkA9v/5/wAABQACAPb/+f8AAPn/8//2//z/AgD8/wIA/P8CAAkACQD8/wIADAD5//n/BQAMAAAAAAAAAPn/BQAAAPn/+f8FAAUA+f/5/wAAAAD5/wAABQAAAAUAAAAFAAAA+f8AAAAA+f/5/wUAAADz/wAAAAAAAAUA+f/5/wYAAAAFAAsAAADz/wAABgAPAAIA7//8//n/BQAAAPP/AADz//b//P8JAPz/9v8JAAkACQAMAAUAAAAFAAAAAAAAAPn/BQAAAPn/AAD5/wAABQAAAAAA+f/5/wAAAAAAAAUAAAAAAAUABQAAAAUA/P/8//z/AAD5//P/AAAAAPn/9v/2/wIAAgAJAAIAAgAMAAAAAAAFAAUAAAAJAAgA9f/9/wIAAwD9//b//f/2//n/AADs/+//AgD8//3/AgD2/wkADwAJAAwABQAFAAAA+f8FAAUAAgD2/wIA/P8CAPz/9v/5//P/AAAAAAUA+f8AAAUA+f/s/wkABQD5/wAA/P8CAPz/AgACAPz//P/8/wkA/P8CAAkAAgAFAAwAAAAAAAUAAAAAAAAAAAAAAAAA+f/5//n/+f/8/wIAAgD8/wIAAgAJAPb//f8HAAIA/f/2/w8ABgAAAAwADwACAAIACQDw//z//P/2//z/9v/5//n/+f/5//z/AgACAAkAAAAAAAAAAAAAAPn/AAAFAAAABQDz/wAABQDz//z/AgAJAAAAAAAMAAUAAAD5/wAAAAAFAAUA/P8CAAIA/P/w/wAA+f/5//n/+f/8//b//P8CAAIA/P/8/wIADwACAAIACAAFAAYAAAALAP3/BwACAAMA/P/2//b/9f8IAPz/8P/s//b/AgACAAIAAgACAAIABQAAAPn//P8CAAIAAgAMAAAA+f8FAPn/AAAFAAAABQAAAAUAAgD8/wIA/P/2//z/+f8AAAUAAAAAAAAAAADz/wAA8//2/wIAAgD8//z/AgD8//z/CQAJAPz/CQAJAAAABQAAAAUAAAAMAAIAAgD8/+//AAD5/wAACwADAPb//f/6//n/AAD5//n/AAD5//b/AgAJAAkAAAD2/wIACQAAAPz/9v8JAAwAAAAAAAwABQD5//n/AAAAAPn/AAASAAIA9v/5/wAAAAAAAAAA+f8AAPn/8//2//z/CQACAPz/CQD9//b/CQAPAPz/AgAMAAAA+f8AAAUABQAAAAUAAAAAAAIA/P/2//n/BQD5/wAAAAD5//n/+f8AAPz/AwAGAAYA+v/2//b/CAACAPb/AgAJAAIAAgACAAIAAAAMAAAAAAAFAAUAAAAAAAIAAgD8//b/+f8AAPn/+f/5/wAAAAD2//z/CQD8//b//P8CAAIAAgD8/wIACQACAAkAEgAFAPP/AAAFAAUAAgACAPz/8P/5/wAAAAD5/wUAAAD5//n/+f8AAPz/9v8CAAkAAgD8/wIACAAFAAAAAAAGAAsAAgD9/wMAAwACAPb/9f8CAPz/9v8AAAIA/P/5/wAAAAD5/wAADAAAAPn/BQAFAAIA/P/z/wAABQD5//n/AAAAAPn/AAAAAAYABQAAAAAA+f8AAAwABQAAAAIAAgD2/wIAAgD2//n/AAAFAPn/AAAFAPP/+f8AAPn/BQAFAPn/BQAFAAAA+f8AAAAAAAAAAPn/AAD5//z/CQAAAAUABQAFAAAAAAAAAAYAAgD2/wUA/P/5//n/AAAAAPn/AADz//z/CQD8//b/AgACAAkAAgD8/wIACQAMAAUABQACAPz//P8CAAIA8P8AAAIAAgD2//n/BQAAAAAA+f8AAPn/8//8/wkAAAAAAAAAAAAFAAAA+f8MAAAAAAAAAAAAAAD5//n/AAAFAAUABQAAAAUA+f/z/wAAAAAAAAUAAAAAAAAABQD5//n/AAAAAAsAAAD5//n/AAAAAAUAAADz/wAABQAFAPn/BQAFAAAABQAAAAAAAAAAAAUA+f/5/wAA+f8AAAAABQDz/wAABQD5/wAABQAFAPn/+f8FAAwABQD8//n/+f/5/wAAAAAFAAAAAAAFAPn/AAAFAAAA8//5/wwAAAD5/wAAAAAFAAAA+f/5/wAABQAAAPn/AAAFAAYAAAD5/wAAAAAGAAAAAAAAAAAAAAD5//n/AAAFAPn/8/8CAAIABQAAAAAAAAAFAAUADAACAPD/+f8FAPn/+f8AAAAAAAD5//n/BQAFAAAA+f8AAAUAAAAAAAAA+f8AAAAA8/8CAAUAAAAFAAUA+f8AAAUAAAD5/wAABQDz//n/BQAGAAAAAAAAAPn/AAAAAAAAAADz/wYA+f/8/wIABQAAAPb/CAAAAAAACwAFAPn/BQD5/wAAAAAAAAwA/P/5//n/AAAAAPn/BQAMAAAA+f8AAPn/AAAFAAAAAAD5//n/BQD5//P/AgACAAIA/P8CAAwA+f/8/xIABQAFAPz/+f/5/wAAAAD5/wAADAD5//P/AAD5/wIAAAD8/wIABQAAAAUADAAAAPn/AAAAAAAA8//5//b/AgAJAPz//P/8/wkAAgACAAUA+v8CAAYAAAD5/wAA+f8AAAUAAAD5/wAABQAFAAUA+f8FAAUA8/8AAAwA+f/5/wAA+f8AAAAA8//8/wIA/P8CAAIAAgAJAAwABQAAAAAABQAAAAIA/P/8/wkA9v/w/wAABQDz/wAA+f/5//z/CQAMAAAA+f8AAAAAAAAFAAUABQAAAAIA8//5/wUABQAAAAAABQAAAAAAAAAAAOz/+v8GAAAAAAAAAPr/AAD8/wYABQDy/wIAAAAFAAUA8/8AAAAAAAAFAAAABQAFAPn/+f/5/wUA+f8AAAwA+f8FAAAABQD5//P/BQAAAPn/AAD5/wAAAAAAAAwAAAD5/wAAAAD5/wAABgD5/wAAAAAAAAAAAAAFAAUAAAD5/wwAAADz/wUAAADz//n/AAAAAAUA+f8AAAUAAAAAAAAABQAAAAAA+f8AAPn/+f8AAAAAAAD5/wUADAAAAAAAAAD5//n/AAAFAAAABQAAAAUAAgD8//z/8//5/wAA+f8FAPn/+f8FAAUABQAAAAAA+f/z//z/AgD8//z//P8JAAkABQAAAAAABgD5/wAAAAD5/wAABQAAAPn/AAAFAAUA+f8AAAUAAAD5/wAAAAAAAAAAAAAAAPn/+f8AAAUA+f/5/wAA/f8CAPz/AwAHAAAAAAAAAAsABgAAAAgA/P/2/wIA/P8CAPb//P/8/wAA+f/z//n/AAAFAPD//P8CAAIACQD8//z/CQAJAAAAAAAFAAUA+f8SAAkA9v/8//z//P/z/wAADAD8//n/AAD5/wAA+f/z/wIABgAAAPn/AgAAAAUABQD5/wUAAADz//n/BQAFAAAAAAAFAAAAAAD5/wAABQAAAPn/BQASAP3/9v8AAAMAAwD8//D/AAAFAPP/+f8AAPP/AgAMAAAA7P8JAAwA+f8AAAUA+f8AAAwAAAAAAAAABgD5//n/BQAAAAAAAAAAAAUABQD8//P/AAAFAAUA+f/z/wUABQD5//P//P8CAAkAAAD5/wUAAAAFAAUABQAJAAIA/f8CAAIA8P/8//z//P/8//n/+f/5/wUA8//8/wgAAAAGAPr/+f8DAAYABgAAAAYABQAAAAAAAADz//n/AAAFAAAA+f8AAAYA+f8AAAYABQAFAAAA+f/5/wAABQAAAAAAAAD5//n/+f/9/wIACQD2//b/CQD2//z/CQACAAIACQAJAAAAAAD5/wAAAAASAAkA9v/z/wAADAD8//P/BgAFAAIA/P/2/wkAAgD8//D/+f/5//n/+f/2//z/AgAIAP3/AgACAAMACQAGAAYAAAAAABIAAgD9//z/AgAJAPz//P/8//b//P/8//z/9v/s//n/BQD5/wAABQDw/wkADAD5//n/BQAFAPn/9v8CAPz//P8PAAAA/P8JAPn/BQAAAPP/DAAFAAUADAD8//b/AAAAAAAAAAD5//P/+f8FAAAA8//8//z/AgAJAAIAAgAFAPn/AAAFAPn/AAAFAAUABQD5/wAAAAAGAAkAAgD9//b/9v8AAAgA9f/8/wAA+f8AAPP/AAAAAPn/AAD8/wIA/P/8/wIACQACAAYABQAAAAUAAAAAAAUABQD8//z/CQACAPz//P8CAAIA8P/w/wAA+f/5//P/AgACAPz/9v8JAAkAAgD8//z/AgAJAAwABQAFAAAAAAAAAAAAAAD5/wAAAAD5/wUAAAD5/wAAAAAAAPL/BQAGAPL//P8JAAYA+f/2/wgABQDz//3/EAD5//z/AgAFAAAA9v8JAAAAAAAFAAUABQAAAAAAAAD5//n/AAD5/wUA8//8/wkAAAAAAPn/AAAFAAAA+f/5/wIA/P/8/wkABQAFAAAAAAAAAAAA+f8FAAYA+f/5/wwACQD2/wkAAgD2//3//P/2//n/8//z/wkAAAD8/wIA/P/9/wIA9v8IAAkA/f8JAAUAAAAAAAAACwAAAPr/BgAAAAUAAgD2/wAAAgD5/wAABQD8//n/AAAAAPn/8/8AAAwAAAAAAAAAAAAAAPP/BQAAAAAAAAD5/wAAAAAFAAAAAAAFAAUAAAAAAAUAAgD2/wIA9v8AAAAA+f/5/wAA+f/5/wUA+f/2/wIACQAFAAUABQAFAAAA+f8AAAwA/P8AAAIAAgD8//z//P/9//3/AgD8/+3/+f8LAAAA+f8AAPn/+f8AAPb/AgAJAAUAAAAAAAUAAAAAAAUABgAAAAUA+f/z/wUAAAD5//n/BQAAAPP/AgAFAAwAAAAAAAAA+f/5//n//P/8//z//P8JAAkAAgACAAAA/P8FAAwABQD5/wYABgACAAkA/P/2//z/9v/z/wAAAAD5/wAAAAD5/wAABQD5//b//P8JAAwA+f8AAAAABQASAP3//f/9/wAAAgD9//X/AAAAAAUACQD2//z/AgD2//n/AAAAAAAA8//5/wUA+f8AAAUA+f8AAAAAAAD5//z/AgACAAIABQAFAPn/AAAMAAAA+f8AAAUAAADz/wAAAAD5/wAAAAAFAAAAAAAFAPn/AAAFAAAAAAAAAPn/AAD5/wAA+f/2//z/AgACAAIAAgACAAIABQAMAAUA+f8AAAYAAAAAAAAAAAAAAAAABgAAAPn/8/8AAAAADAAAAPP/AAAFAPn/+f8AAAAAAAAAAAAAAAAAAAAAAAAAAAUABQD5//n/AAAFAAAA+f8AAAAA+f8AAAAAAAAAAAAAAAD5/wUAAAD5/wAAAAD5//z/CQAAAPn/AgAAAAAAAAAFAAUAAAAAAAwAAgACAPz/9v/8/wkAAgD8/wIA9v/1//3/8v8GAAAA8//5/wAAAAAAAPn/AgAFAAAAAAAAAPn/AAAAAPz/9v8JAAkABQAFAPP/AAAMAAUA+f8FAAAAAAAJAAIA9v/2/wUA/P/5//P/AAAAAPn/AAD5//b/AgAJAPb//P8PAAIA9v8JAPz/AgASABIA/f/5/wAA+f8AAPn/BQAFAPn/+f/5/wAAAAD5//z/AgACAAIA9v8CAAIAAgACAAgACwD6/wAA+f8AAAsAAAAAAAUAAAD5/wUAAAAFAPn/AAAFAPz/CQD8//b//P/8//n/AAAFAAAA+f/5/wAA+f8AAAUA+f8AAAAA+f8AAAUAAAAAAPn/AAAFAAAAAAAFAAAA8/8AAAUABQD5/wAAAAAAAAUABQAAAPn/AAD5/wAAAAAAAPP/AAAAAPz/AgD8//z//P8CAA8AAAAAAAUADAAFAAMAAwD2//3/AwADAPz/AgACAPz/8P/2/wAAAAD5//n/AADz//z/DwAAAPn/BQAAAPP/CQAMAPn/8//8/wkABgAFAAUADAD8//z/AgD2/wAAAgACAPz//P8CAPz/9v/5//n/+f/z//z//P/9//z/AgAJAAkAAgACAAUAAAAFAAUAAAAAAAUAAgD8//z//P/5/wAA+f8AAAUABQAAAPP/+v8GAAAA+f8AAPr/AAAAAAAAAAD5//z/CQD8//b/AgAJAAkABQAAAAAAAAAAAAAA+f/z/wkABQAAAAUABQAAAPn/AAAAAAAAAAAAAAAAAAAAAPn/+f8AAAUA+f/z/wkABQAAAAAAAAAFAAAABQAAAPn/+f8AAAUAAAD5/wUABQAAAAAAAAAAAAAAAAD5/wAAAAD5/wAAAAD5/wAAAAAAAPb//P8DAAIABwADAAYACwDz//n/BgAMAPn/+f8MAAAA+f8AAAAA+f8AAAAAAAD5/wAAAAD5//z/AgACAAIAAAAAAAUAAAAFAAAAAAAFAAUA/P/8/wIAAgDw//P/AAD5//n/AAAAAAAAAAAAAAUA+f8FAAUAAAAFAAAAAAAAAAUA+f/5/wUAAAD5/wAAAAAAAAAA+f8AAAAAAAAAAPn/BgALAAYA+f/5/wYAAAAAAPr/AAAAAPn/AAD5/wAABQAAAAUABQAAAPn/+f8AAAUAAAAAAAUAAAAAAAAABQAAAPn/+f8MAAUA+f8AAAAA8/8AAAAAAAAAAAAAAAAAAAAA+f/5/wIAAAD8/wkAAAAAAPn/9v8JAAkAAAAAAAwABQD5/wUAAAAAAAAAAAAFAPz/+f/5/wUAAAAAAPn/BQD5/wAABQD5/wAABQD5//L/AAAAAAAAAAD5//z/AgACAAIABQAAAAUAAAAAAAwAAgD8//z//P/z/wUA+f8AAAAA+f8AAPn/AAAFAPn/+f8MAAUAAAD5//n/BQAFAPn/+f/z/wIABQAAAAAA+f8AAAUABQAFAAAAAAAAAPn/AAAAAPn/AAD5/wUABQAAAAAAAAAAAPn/+f8FAPn/8/8JAAAAAAAAAAAABgD6/wAABgAAAAAA+v8AAAUA+f/5/wAABQAMAAAAAAAAAAUAAgD2/wAAAAD5/wAA+f8AAPn/8/8CAAIAAgD8/wIAAgACAAUAAAAFAPn/+f8FAAwAAAD5/wUAAAD5/wAABQD5//n/AADz//z/AgACAPb//P8JAAkABQAAAPn/BQAFAPn/+f8AAAAABQAFAPn/+f8FAAUAAAD5//n/BgAAAPP/CwAAAPn/BQD5/wAADAD5//n/BQAAAAAA+f8AAAUA+f8AAAUAAAAAAAUABQD8//z/AAACAPz/8//5/wAAAAD5/wAABQAAAAAAAAD5/wAAAAAMAAAA+f8FAPn/+f8AAPn//P/8/wIAAgACAAwABQAAAAUAAAD5/wUABQD5/wAAAAD5/wAAAAD5/wAAAAD5/wAAAAAAAPn//P8CAAgAAAAFAAUABgAAAPr/BgD6//n/+f8AAAUABQAAAPn/BQAAAPn/AAAAAAAAAAD5/wwAAAD5/wAA+f8MAPn/AAAAAPn/BQAFAAAAAAAAAPn/AAAAAAAA+f/5/wAA8P/8/wkACQD8/wIADAAAAAAAAAAMAAAAAAAAAAAADAD8//P/+f8MAAAA+f8AAPP/AAAFAPn/AAAMAAAA8/8AAAAACwAAAPr/BQAAAPn/AAAFAAYAAAAGAP3//P8AAPn/AAAGAAAA+f8AAAAABQD5//n/AAD5//b//P/8/wIAAgACAAIAAgAJABIAAAD5/wAA+f8FAAUA+f8AAAAAAAAFAPn/8/8AAAUA+f8AAAAADAAAAPn/AADz//b/9v8CAAkAAgACAAIAAgAFAAUAAAD5/wAABQAFAAUAAgACAPz/AgD8/+//AAAAAPn/+v8AAPP/AAAFAPr//f/9//z/CQAJAAUAAAD5/wUAAAAAAAwABQD8//z/+f8AAPn/AAAFAAAAAAAFAPn/AAAFAAAA+f8AAAYA+f8AAAUAAAAAAPn/+f8FAAAA+f8AAAAAAAAAAPn/BQAAAAAA+f8AAAUABQAFAAAABQACAPb/AAAJAAIA9v/8//z/7P8AAAAABQAAAPP/AAAAAPn//P/8/wMABwAFAPr/AwAFAAYABQAAAAUAAgD2/wAAAAAAAAUA+f8AAAUA+f8FAAAAAAAFAPn/AAAFAAAAAAD5//n/AAAAAPn/AAAAAPn/9v/9/wIAAgACAPz/AgACAAkADAAFAPn/AAAMAAUAAgAJAAIA9v/8//z/8P/s/wAABQAFAAAA+f8AAAAA+f8FAPn/+f8FAPP//P8JAAwAAAAAAAAABgD6//n/AAAFAAUA+v8AAAAAAAAAAAAAAAD5//n/AAAAAPn/BQD5/wAAAAD5/wIABQAAAAAAAADz/wIABQAAAAAABQAAAAAABQAFAPn/AAAAAAUA+f/5//n/AAAAAAAABQD5/wAAAADz//z/CQAAAPz//P8CAAkA/P/2/wIAAgACAAkAAAAAAAUAAAD5/wUA+f8AAPn/AAAMAAAAAAAFAAYA/f/9//n/AAAAAPr/+f/z/wUABQDz//z/CQAAAPn//P8CAAIACQAFAPn/+f8FAAUABQD5/wAAEgD8/wIAAgD8//b/9v8AAAAABQD5//n/AAAAAAAA8/8AAPn//P8PAAUAAADz/wAABQAFAAUABQACAPb/AAAAAAAACQD8//b/AAAAAPn/8/8FAAAAAAD5//b/AgACAAIA/P/9/wIAAgD8//3/AgACAP3/CAAPAAYABQD5/wAABQAFAAAAAAD5//n/AAAAAPn/+f8AAAYAAAAAAPn/AAAFAAAAAAAAAAUAAAAAAAAA+f8FAAAA+f/5//n//P8MAAUAAAAFAPn/+f8AAPn/+f8FAAwADAD8//z//f8AAAIA/f/5//n/AADz//b/AgACAAIAAgD8/wIAAgAJAAwAAAAAAAwAAgD2//r/AAAAAPn/+f8AAAYAAAD5/wAAAAAAAAAABQD5//P/AgAFAAUAAAAFAAAABQAAAPn/DAAJAPb/AgDw/wAABQDz/wAAAAAFAPn/AAAFAAAADAD8//z/8//5//n/AAAAAAUABQAAAPn/+f8AAAUAAAD5/wUADAAFAPz/8/8AAAwAAADz/wAABQAAAPP/BQAAAAAAAAD5/wAA+f8MAPn/8P8IAAYA+v8GAAAABQAAAO3/AgAFAAAAAAAAAAUAAAD5/wAA+f8MAAAAAAAMAP3/AgD2/wAAAgDz//P/+f8FAAwAAAAAAAAA8//z/wkADAAFAAAA+f8AAAUABQD5/wAAAAAAAAUA8/8AABIACQDw//P/+f8AAAAA+f8AAPn/BgAAAAUADAAAAAAAAAD5/wAAAAAFAAAAAAAFAPn/8v8AAAYAAAD5/wAA+f8GAAsABgAAAPn/AAAAAAAA+f8AAAAAAAAAAAwABQD8/wIAAgD8/wIA/P/2//b/+f/5/wAAAAAAAAAA+f8AAAAA+f8CAAAAAAD8/wIABQAFAAAA+f/5/wAABgD5/wAADAAMAPz/AAACAPz/9v8AAAAA+f/5/wAA+f/w//z/AgACAAkA9v8CAA8ADAAFAAAAAAAAAAAACwACAPz//P/9//3/8//6//n/BQDz//3/AgACAAwABQAGAAUA/P8AAAAA+f8FAAIA8//5/wUA+f/5/wAA+f8AAAAABQAAAAAABQAAAAAAAAAAAPn/AAAFAAAA8//5/wUAAAAAAAAA+f8AAAwABQDz//n/BQD5/wUADAD5/wAABQAAAAUAAgD8//z//P/8//z//P/5//n/BgAAAPn/BQAFAPn/+f8AAAAA7f/2/w8AEwAGAPr/AAAFAPn/AAAMAAAA+f8FAAAAAAD5/wAAAAD5//n/9v8CAAkAAAD8/wkABQAFAAAAAAAAAAAA+f8AAAAAAAAMAAAA8//5/wUAAAD5//P//f8CAAIA/P/8/wIACQAJAAUABQAAAAwA/P/8/wAAAAACAPz//P8CAAIA8P/5//n/AAAGAPP/+f/8/wIABQALAAAA+v8AAAAAAAAAAAAABQAAAPn/BQAAAAAA+f/5/wAABQD5/wAABgAFAAUA+f/5//n/AAAAAPn/AAAAAPn/AgACAAUAAADz/wUAAAD5/wUAAAAAAAAAAAAFAAAAAAAAAPn/AAAFAAAA+f8FAAUABQD5//n/+f/5/wAABQAFAPn/AAAAAAAAAAD5/wAABQAAAAAABQAFAAAA+f8AAAAA+f8AAAAAAAAAAAAABgAFAAAA+v8AAAUACAD8//b/+f8FAAUACQD8//b/+f/5/wAA7P/2/wIAAgAPAAUAAAAMAAUA+f8AAAAAAAAFAAkA/P/2//n/BgACAPn/AAAAAPn/AAAAAPP/AAAFAPn/AAD5/wIADAAMAPP/8/8FAAUABQAAAAAABQAAAAAA8//5/wwAAAD5/wUABQD5/wAAAAAAAAUAAAD6//n/+v8FAAAAAAAAAPr/AAD5/wIAAAD2//z/CQAJAAAA/P8FAAUAAAAFAAAADAACAPz/AgD8//z/AgD8//b//P/5/wAAAAD5//n/BgAAAPn/DAAAAAAABgD5//n/AAAFAAAAAAD5//n/AAAAAAAABQAFAPn/BQAMAPz/AgACAPz//P/2//n/DAD2//P/+f/5/wIABQAAAPn/AAAAAAYACwD5//n/AAAAAPr/BgALAAAA+f8FAAUA+f8FAAIA/P8CAPz/9v/5//P/AAAFAAAAAAAAAPn/8/8JAAAAAAAFAAAA+f/5/wwAAAD5/wAABQAAAPn/BgAFAPn/AAD5/wAAAAAFAAwA+f/5/wAAAAAAAPn/7P8JAAYAAAAAAAAA+f/8//z/9v8CAAIAAgACAAIAAgAMAAAAAAAAAAAABQD5/wAABgD6/wAA+f8AAAAABQAAAPn/AAAAAAUADAD5//P/AAAAAAAAAAAAAAAAAAD5//n/BQAFAAAAAAD5/wAABgAFAAUAAAACAAIA/P8CAPz//P/8//z//P/2/+z/AAAFAAAA+f/w//z/CQAJAAIABQAAAAAABQAFAAUAAAAAAAkA9v/8/wIA9v/5/wUAAAD5/wAAAAD5//n/AAAFAPn/9v/2/wMACQACAP3//f8DAPz/CAAJAAIAAAAFAAUA+f8FAAUAAAAAAPn/AAAAAAAABQD5/wAA8/8AABIA+f/5/wwAAAD5/wAA+f8AAAAABgD5//P//P/8//z/AgD8/wIAAgACAAIAAgAPAAUABQAFAAIA/P/2/wAAAAAAAPn/BQDz/wAABQAAAPn/BQAFAPP/8/8FAAwA+f8AAAAA+f8FAAAAAAD5/wAAAAAAAPr/AAAAAAAAAAAAAAAAAAAAAPn/AAAFAAAAAAAFAAAA+f8FAAUA8//z/wAABQDz/wIA/f8CAAwABgAAAAUAAADz/wAADAAJAPz/9v/5//n/+f8AAAAABgAAAPn/BQAMAPP/8/8MAAwA+f8FAAIA9v8AAPP/AAAAAPn/AAD5//z/AgACAAIAAgACAPb/CQAMAAAABQAGAAUA/P8DAPP/AAAFAPn/BQAAAAAA+f/5/wAA8//8/wwAAADz//z/AgACAAIAAgAJAPn/BQAMAAAAAAAAAAUAAAAFAAIAAgD8//b/AgD2//n/+f/5/wAA7P8CAAIACQD8//b/9v8CAAkACQAPAAAAAAAFAAwACQD2//3/AgACAPb/9v8CAPz//P/8//z/AAAAAPP/+f8AAPn/BQAMAPP/8/8IAAAA9v8CAA8ABQAAAAAAAAAFAAAABQAAAPn/BQAFAPn/AAAFAPn/+f8FAA8A9v/5//n/AAAMAPn/+f8AAAAA+f8AAPn/9v8CAAEABQAAAPn/AAAAAP3/BQD4/wAAAAAAAAAABQAFAAIA/P/u/wUA8f/z//n/AAAFAOv/9v8JAAkAAAD5/wIABQAFAAUAAAAAAAUA+P8AAP3/+f/z/wAAAAAAAAAAAAAGAAAAAAAAAAYABQACAO7/AAAAAAAAAAD5//n/AAD9//P/+f8CAAUA+f/8//z/BwAFAPP//P8JAAwAAADx//3//f/5//P/BQAAAAAA+P/4/wAA+f8AAAAAAAAAAAAABQD4/wgABQAFAAAA+f/r//j/8f/x//r/+v8FAOv/BAACAA8ABQAGAPH/+P8FAP3/+v/6//T/5//4//3/8//2/wAAAADy//H//f/p/+v//P8CAAoAAQD0//T/+v/6/wEABQD7//r/BADj//D//f8BAAAAAAD9/wQA/f8BAAUAAgD8//z/9P/1//T/BAD5/wAAAADx//H/+P8AAPn/7P/6/wUACAD5/wAAAAAMAPj/AAAFAAAADAD0/+z/9P8CAPz//P/0//n/6f8AAAUA+f/4//H/AADi//r/BgDy/wQA/f8HAPr/BQADAPn/9f8FAAUA+P/5/wUADADr//H/BQAFAPj/+P8NAPn/8f/8/wAAAAAAAA0AAwDs//L/+v/4/wAAAAAAAAUAFAD9//H/CAAQAAUA8P/x/wkAAADt//H/AQAAANn/7P8MABEA8v/y/wgACAAFAPj/+/8CAPj/7P/0/xEA/f/p//X/AAD4//3/BQD9//H/8f8AAOn//f/5//j/3v/4/wgAAAD9/x4A+f/4/wAABQACAAYA6//g//3/+f8FANn/8f8eAAAA6f/5/ygACAD4/wAAFQAEAPX/8f/Q//n/4P/4/wUAGADw/wgA+f8AABAAHQD4/+n/GAD1//j/8P8FAPj/6f8JAOX/EADo/w0A8/8AAA4A8f/9/+j/EADt/wAAAAANAPL//P8CAAQA/P/m/wgABQD1/+L/GwDi/xYA/v/y//j/+P/4//D/+f/w/wgA8P8YAPj/AQDk/wIABQAWANH/9v8KAOD/8//4/+j/DQD1/wAAAQAAAOX/GAANAPD/AQD4/wAACADr/wAACAD5//T/AgD8//r/CQAEABIAAgAEAOj/AAAUAPL/+P8FAPz/9P8cAOn/AAD6/+7/8f/w//H/7P/8/+z/GQDs/+7/AgAMAAAA6P8RABgA+P/4//n/DQADAAEA/v8FAPL/+v/r/9b/DQABAOv/GAAPAO3/6f/2//j/AAD4//r//P8BAMP/EAD4/+z/IQD6/wQA+f/4//j/7P/1//n/FQD4/0AA6v8KAMr/IQDk//n/3f8dAAUA/P8BAAAAEAAYAOv/+f8gANX/JADp/+D/CwDt/+H/9v/+//j//f/+//n/AgD9/7z/UQDV/xYA0v8uAPX/JQDt//X/EwA6AND/6f8lANH/CAD4/9n/AADI/wUA+P8QAOP/AAANAPn/DQAgAJz/OAD0/9j/KADg/yAA1P9qAIn/OQDp/wwA4P8EAAAA4P8eANH/GACw/0EA2P85AK3/GAD7//T/yv80APz/NgCS/10AzP8MAOz/OQDS//r/DQDg/xUA6P8YAKL/WgDV/yEA2f8iAJz/HQC+/4AAbv/7/+H/cwDI/zsA0v82AP3/3v8LAOX/JADq/xoA6P8sAB8A9P8EAPb/+v9IAL7/UgDH/wIA4f/7//T/4f/5/+j/CAAiAPT/tv81APz/rP8wAOb/WACS/0EApP8yAPn/8v/7/9z/CgDT/xgA+f/0/wwA8v8DAA0A3P8YAPz/4P/t//z/FgAYALj/DgDY/xIACgAQAPL/+P/8//r/CADs//b/+P8AACAA+f8DAAIAAAANABAA6P/0//T/7v8CABwAsf88AND/EQAUAMD/IQDq/9z/AgD4//T//f/4/+7/AQDK/xUA8P8AAPH/9P8YAPL/0v8ZAOH/EgApANj/DgC4/xIA+P8KAPT/AAAtAOj/DQDq/+P/+f8AAAAAJAACAPD/HAACACAA/P8JAOn/5P/s/wUA1P8UAPz/+v/+//P/JAAYAPj/HQD4/+7/xv8jAN3/NQC5/wgA7P/k//z/+v8EALb/IAAgAPj/9v/s/wEA/f/8//r/GgD5/wIABAD2/+X/5P8BAOn/+P/9//n/8f8XAAoAIQD1/wAA6P8JAPr/EQACAOz/6f8gAMj/FgDk/wkA9v/0/9r/4P86ANr/HAA5APL/IwDt/yUA4v/5/+T/AgDy/+z/6P/s/wgA9f/Z//L/zP8TAPb/HgDK/yMA+P/i/xsAAAD8//j/EgDy/woA+v8MACgA6P8RAOz/SADA/xAA6f/0//r/8//8/wMAGQDq/wAA7f/J/wkA9P/2//T/CQCo/1QAuP8dAAEACAD4/wYAMgDi/xwA4v8BAOz/+P/6//T/BADg/wgA5f/4//j/AgACAAAAAAAgAAUAIQDy/wYA6f8TAND/FQDt/wEA7v/w/wYA+P/4//v/BQD5//L/8P/o/wkA7f8RAPz//P/6//z/FQDZ/+7/AQAIAPj/AgAAAPz/+f/4/wkA+P8JAPD//P/h/xgAFQDy/+T/JADe/wkADAACABUA4P/o/+n/6P/6/w4AAQAFANv/5v85APD/+f8AACAA3v/6/y0A4P/h/+T/DAD6/wUA/P8lAPr/AQD8/wYACQACAOv/LQDl/+D/6v8BAAEA/f/1/+X/GwDa/xAA8f8IAPr/8P8GAMT/KgDo/yEA4f8RAMr/zP8YADwAGQAdALj/+f/A/yEA+f8gAN3/FQDl/+3/LAAFABQA6P8iAK7/IQC+/ykA7v/8/9z/AgAEAOb/IgDw/xUACgDh/wgA+P8VAPX/EgDy/wQAAAD9//z/zf86ALn/8//p/yAA9P/8/wgA+P8IAPf/CAD8/wIA+P8FAPX//f8JAPv/CQDg/wgA+P/5//3/AAACAPr/5f/+//b/CQDl/woA3P8IABoAIgD9//H/5P/R/w0AEAAAAMv/BAD6/wkADwAgAPH/0f8FAAAAAQDx/+j/CgD4/wAA4P8nABQA8f/x/wUAAADR//L/CgAKAAIAAAAZAPD/4v8CAAoABQD0//z/+f/6//T/4f8IABgA8f8OAA0A8v/y/+7/9f//////+/8UAPL/+P/4//z/AQAZAPj/9P/4//3/7v/0/+L/5P8dAPH/6v8CAPP/AAD9/wgA9v/5//T/AAAJAOL/CgAAABEA+v/5/wwABQDg/wEA+f8AACEA8f8RAOj/AgDs/wkA/f/x/wwA7P/5//H/IADw/xkA4f/5/wQA2P8EAAQAAADx/yQA8P/u/+f/CgDx/+X/DQD4/woA+v/+//L/+f/g/wsAAwAAABEA6f/h//n/8//8/wkAAgACABQA/P/t/wAABQAdAPD/AQASAAEA8f/4//z/8v/g//n/HQDx/wAAAgD8/+X/CADu//n/+P8YAPj/GAD2//3/8f/4//r/+P8AAPX/AAD4/wUAFADp/wAA8f/Z/wAA+P8aAOz/JQDh//n/2P8gAPL/5f8OAPD/AQD1/wwA+//x/xQA+/8LAOP/+f/w/xsA7P/4/9j/AgD6//b/AADd//D/+f8ZAPz/FADr//z/5f/k/wQA9P8RAPH//v8BAAAAEQDx/wIABAAAAPH//P8FAAwA9v/0/wAAGADd/wgA+P8ZAPX/+v/e//b/GgD1/wgA2P8oAN7/CQD9//z/FAD1/w0A4f8KAOr/AAAJAPL/BQDw/wIA6f8FAAkA8f/5//3/+ACCAFYACwF9ABAAmv+x/5D/fgBQAAgA0P+Q/5H/Zf+m/7b/0P/S/jX/dP4O/vz+uP9g/93+yf6V/wgAjgAVAs0BWQJZAmQB+gAVALj/mP94/77/5P/+/0QAnAAQAYkBswG9AWAB4AAxAJz/6f41/hH+hP06/Vz9gP1c/bD8Mvx//MD84f2Y/3kBOQOeBJAFoAXKBL0DIALoAAwAcP+1/83/EwCZAOkAUwFgARIBqgDX/w3/ef4Y/nz90P0t/i/+eP7C/rH+0P1s/Jv7HPtN+wj9l/8rAk0ECAbYBi8GYARsAqYAc/+d/qz+yf+DADAB1wEoAlACvQEPAWgAT/9w/hX+yv1v/fL9Yv4i/zD/EP+9/mj9pPs8+sb5K/nY+xcAHwMPBd4G/AdiBlADJgHN/8f+/v3k/kEA/QHFAsUC5AI6AmwBBAAn/9H+5/7+/mX/2P+f/5b/YP9w/6j+q/1w/Xj93/ww/AD8WPuO/OkA1AMfBdwFYgYPBUgC+v/o/mb+C/6+/ooAoQFzAlgC3wE5ASMAg/+//qL+AP+o/xEA/v+z/w//sP6I/qD+hv5E/uD90P1B/aD85fsh+zH9ugFnBDAFqgVfBTEDMACe/lr+nv4o/7kAfgIpA88CgAKIAcH/iP59/r/+vP5P/3AArQD7/67/Rv/K/oD+1/5v/1r/oP4B/pf9qvzC++v6GPsW/qACXQWLBn8GIgVKAlj/Uf5u/qz/KwG9AoYDJwMYAqcAPv8a/sn9af44/0sA8gCjADwAKP8I/v/9e/5M/73/tf8z/9P9afxJ+/L6xPra+yYAZATIBkUHPgbTAzQAvv0s/T/+RwAvArsDCQTHAgcBvv/O/kn+XP4U/wkAiQDhAGcASf+J/ur9Bf7n/p3/oP+F/wP/Lv4A/Uj8JfyY/PP8sPxa/58D1gXkBeUEzwM7Ac/+VP5Q/9oAmQI8A8oDCAMDAX3/a/74/QH+4/42AAkBsQDQ/y3/jv5m/jX/vv8NAPT/ff/x/VP8pPuQ+0T88PwM/fj/mAOeBqsGiQTjAiIAB/7N/Xn/IQKAA2gDcAMKAsoAM/8//oz+Nv/t/68AMAFSAZwAJ/8v/m3+oP6D/1YAoQCZACf/aP05/Lf7xPtT/Aj93vwQ/TYAyAPxBSwFywNDAqf/Ef4P/9sAXgIMA48DQAN9AVL/Gv6a/lf/6v/9ALcBgwEtAIr+U/6A/s3+0/92AGoAv/8g/uz8TPyt+/T7j/zQ/F786P1sAa8ECAYaBe8D5QE8/0P+i/8vAScCsAL7AogCAgHB/+D+rP6Y/1AA+ABTAaIAwP9K/tL9pP6C/5EA8ABXAHv/HP6B/HD8k/zb/Ev9Z/2s/FH8zv7FAuQFMwbdBLADfAGJ/hf+rP+tAdkC+QI3A4cC2AB+/8z+Yf/5/zkABgFIAbsA5v6h/Qj+4v7R/0kA/v9+/1X+sPwI/N778/vQ/HP9Jf0K/fn+fgJsBeAFUAQbA6wBWv/L/bL+IQF5AoQDgwOnAq4A7v7D/k3/BgCoAAsBYgH4AAsAqv7J/Vj+K/+Z/9L/eP8A/0b+Lf3U/On87fx0/Qn+0v0I/Qj+AgH1A1gFpgTVA8wCawCs/mn/QgHuAuADoQN3AjMA0P6g/gT/AgC+AD8BcAHYALH/zv4C/sv9eP4y/5T/IP+9/jj+l/ya+237WPsh/HD98P04/vL/eANHBr0FCASoAkwBj/+n/l0AfQJ9A8EDhgOIAokAvf54/hD/0P85AKEAJAHYAL3/D/+J/jf+iv4D/4r/UP/Z/nX+Ev0Z/Mr74vvm/OD9i/1A/er+5wIiBksGSwUbBDQC1f89/lD/SQFCAtkCBwPPAlkBbv/Y/jb/Xf+S/2kAOAH3AM3/E/+z/j3+Vf7r/pf/3f9U/0L+xvzg+777EPxI/XD+l/5l/vb+kgG4BLwFJgU+BMMCzgDx/sn+iADTAXsC0AK5AuUBNAAG/1v/sf9m/8H/dwCuAJP/af6P/p/+iP7Z/nn/BgBd/yj+RP2a/CD8BPxs/K/9Bf52/b393/+cA/AFyQVdBUsE+QGd/3X+kf84AfkB2gKSAz0DcwFi/8n+MP/j/iv/SwA5AbcAK/+o/s/+XP57/ij/9//4/6H+tv0a/VX8yvuw+678x/2k/aj93f4HAkQFJwabBesETANCAW3/xf4KAEIBEgKhAs0CbQLvAJ7/Yv9P/zT/nP9MANYAFwAc/zD/EP+L/mb+s/5H/+b+EP6w/Wr94PxX/H/8Z/3w/YH9P/0h/qIApgM4BXIFLQX8A0kChgCV/zIA4ABsAe4BbwJcAn0BuwBEALX/IP8Q/4j/DADY/1D/f/99/+7+hv6I/uT+wP5C/g/+8f1K/Zf8m/wJ/VL9T/2a/XD+bwDaAiAEpQSlBPUD1AJ5AWcAbACoAPsAaAHcAewBdwFZARUBewDP/4r/Yv9W/wf/GP9p/1j/9f7l/hL/N/8A/8j+rv6q/oj+V/7n/eD9+/0I/hL+Lf6S/qb/OQGQAh8DQgM4A/0CaQKHAf8A8gDiAOAA8gAYAe0AygDKAKQARQDx/6D/Zv8j/wD/Af/8/uL+7/7x/s3+r/6e/rH+ov7D/vL+0/6U/qn+tP6t/nf+gf4+/0QADwF2AewBYwKOAm0CGgLaAboBdgE3AQ0BAAHeAL0AmABwAFMAFQDj/7r/iP9j/zj/K/8Q//f+//7w/sv+2P7s/uD+2v7e/vD+yP60/rH+tP6y/pH+jf7p/qP/QwC+ADkBqwEAAigCIAIaAiwCCwLWAZMBSAH4AMMAqgB5AGkAUQAqAA8Aw/9z/1L/M/8N/+b+6/7s/tP+5/7k/u3+2v7K/sr+vP7B/sL+tf63/sD+r/7v/on/KQCbAO4APAGsAfwBDAITAiICNgIWAsABZwEhAe8AwwCDAGIAOQAAANv/lv9U/yr/Av/4/ub+8/78/ub+7f4C/wj/7v7m/ub+4/7Z/tv+z/7Q/tH+uv6//jD/w/85AIIA0QBZAdgB/wEJAi8CSwIxAuEBmQFWAR0BAAHCAJMAXwA2ABgA3P+U/17/Sf8z/wb/6P7n/uX+2/7g/uf+6v7k/uL+3v7T/tf+0/7W/s3+uP69/hT/mf8PAG8AyQBIAdgBEwI8Al0CagJiAh8CyAFwAScB+wC1AHcALQAGANv/lP9V/y7/Hv8A/+L+yv7L/tL+xv7Y/vD+9/4C//7++P77/vD+0/7V/tb+yP6j/sL+K//b/2kArAAWAakBLAJTAmACXwJgAkYCBgKpAUwBFwHpAKwAcAA5AA8A5P+g/2v/OP8f//P+wf6o/pP+iP6W/q3+tf7S/vP+8/7v/gf/9f74/v/+8P7U/uD+Rv/u/4AAxAATAZ4BNAJOAjsCPAI9AicC4AGQAU4BEAHJAIsAVAANAOL/qv90/0z/Iv/9/tH+p/6n/qz+m/63/sD+yv7g/uH+3f7Y/t7+2f7s/vj+8/7j/u7+Vv8nAPIAZAHBAUgCvwLYAqMCggJxAj0C0wF3AT8B5gCCADgAFQDj/7H/c/85/xn/+P7S/p7+of7F/sj+zf7o/tX+6P7a/sL+wv6x/qD+hv6C/qn+sf6z/sb+c/9pAFEB2wFGAtECGQPsAp0CZwI7Au4BdwEbAdcAlABDAP//6v/R/5f/VP8w/yP/4/63/qP+tv6r/qr+m/5//oj+ef5l/lz+T/5E/hn+DP4O/h/+NP7E/vD/NwE1AtcCSwO8A60DJgO1AlsCKwLdAVwBIAEQAeEAjQA5ABgAu/89//7+9/72/sD+nf68/tb+xf6e/l/+aP5o/jr+Ef4I/g3+6P23/YL9Rv0y/W791/7jAJsCrQNXBPMECQVEBDMDngJNAtIBgQFiAYsBewEeAcQAOgCA/wj/2/67/on+X/6m/tL+u/68/oH+Vf5B/g7+3v24/bH9cf09/SH96vyq/KD8Mf6vAL4CBgSyBE0FFAX7A9ECZgJXAkICUAJBAgwCewG7ADYAnf/X/mz+eP6Q/m3+Rv6X/vD+M/98/3T/Nv/K/kv+zP1a/Rz9yvyD/HD8OPwH/Mn7Cv2x/3wCawRuBcMFbQVvBIEDbAOxA44DLwOtAi0CMAE5AJP/4f55/h/+2/36/VH+tf5Q/+H/cwCaAEAAsv/w/jH+Yf3A/F/86PtE+y/7Lvv9+kD7Q/1qAJsDSwUTBmcG6QW/BO0DAAQMBFUDegLGAdMAf/+n/nr+SP5N/jj+Lf6f/gv/mf9LANsAEwHSACMAZv+U/sP9C/2C/C/8ofsg+wD76Prk+qX77/2AAcEETgbrBgUHQwb/BB4E+QO/A+gCGgJOATwAOf+m/ob+X/57/mj+Vv66/hf/lv9lAAQBPAH4AGIAi/+d/vX9KP2c/BD8Z/vs+qj6Avtw++/7kP1EAPICBwXaBTkGGgZRBY8E6wOdA90C+QE+AUgAZv/G/o3+Yf5g/qn+pf4J/3D/0f94AMkAAQG8ADkAk/+8/jz+lv0F/aD8JPzC+2T7b/vH+2D81/xl/iEBqgOmBTsGWwbfBQMFNgRdAwIDMAJbAbAA+v9G/7f+lf5//qr+zf7s/mn/4/9YAPwAWAFdAbYA7v/+/vP9m/0P/ZT8WPzZ+277H/s4+7T7P/wB/c7+pgFYBHUFGgZ4Bs0FFQUoBKIDCAMKAkUBkQDp/yD/xf6c/oD+m/6j/vH+cP/j/3IAAgFTASwBdQAJADr/mv4h/nP9+fyK/BP8gPtk+5H7EfzQ/HT9J/+bATgEGwW0BSkGcgWxBM4DdAPLAtgBNgGMAOL/+f7t/tj+rP7W/uD+G/9J/7z/PwDHAA0BywBHANX/9v5C/uL9Yf3S/Hr8+/ti+1T7ZfvT+4D8GP31/q4BUwRABeYFZwaQBaIE3gNfA5gCogELAZsA+P88/yf/EP/k/vb+//41/2j///+wADEBjQFQAbAA6f/g/jD+q/0R/Zr8TPy/+2P7bfuD+xv8Yfxu/XD/lQHYA6QEgAWkBQ4FhATxA6gDxwLPARsBgwC8/yX//P7G/q/+uv4K/1T/x/+NAOQAOAF5ATMBawCo/7n+4f1Q/b/8W/wS/Jv7OftB+137APx3/Bv9Dv9IAdIDIAX2BZIGCgZOBXIE3wMkA/8BLQGhAPD/PP8E/9X+s/64/tf+L/96/x0AggDgAC8BJwG4ADMAc/+o/gL+MP2b/B38ofs8+z37aPvn+0b88PyZ/pIA8wJ8BLAFaQZABrEF6AQ+BGwDVQJvAecAIgBc/xb/qf5k/mn+W/63/hX/tf89AKcAGwFAAf0AYQC1/+P+Gv5A/Zz8Hfye+0/7WvuK++v7V/zg/Pv9nP+4AUADlQSuBRMG1AVcBacECAQIAxgCjAHQAAgAY/8H/57+d/5Y/nz+xv4t/7z/IQCxAPkA9wCOAAEAR/+b/vr9OP26/GH8BPzW++T7KPyL/Nv8Z/15/iYA4AEcA08ERwWGBWcF+wSTBOED/QJLAnsBvwAmAIX/Kf/U/qD+v/63/ur+Pf+Q/87/+/9hAJAAZgAQAJj//v5q/u79aP0Q/cX8gvx1/In80PwA/VX99/29/hQAewGHAosDaAToBP8E9QS4BE4E3wNBA6UCyAHnACoAlP/4/pz+PP4c/hf+QP5i/p3+1f7x/vz+AP/f/q3+fv5I/vn9vv2Q/VL9A/3j/K/8ufwF/Yf9Yv6Y/wMBNwKSA7AEWAUABi0GNAb4BW4FwwTeA8ACjAF6AFD/gv6R/QH9qfx8/If8mfzZ/Cf9b/3o/VH+q/73/gb//v7l/rH+YP4G/r/9Q/0h/WL9x/11/q3/CwFGAokDgAQrBaUFwgXVBYgFGwVwBIUDZgJdAT8AVP+X/sj9UP0L/eT83/z8/C79cv3W/VH+rf74/ir/Ef/W/pb+WP7k/ZX9Jf2w/Lr8MP3f/bb+9f9oAaYC0gO6BEkFlgWgBZYFUgXXBEUEawNqAlMBRQBA/2r+p/33/JP8cPx2/Jn83/w4/bH9NP6p/gj/T/9X/zz/FP/l/nr+Fv6o/TP9AP1E/c/9jP6k/xEBUQJ/A4wEJAWQBa0FpgWHBRwFegSLA18CSAEsABD/QP6U/ej8hPxu/Hb8i/zJ/Db9oP0n/qX+9P4k/z3/I//q/p/+Tf79/Yr9Ef3f/Fj9+f3Q/gEAVAGlAsUD1gRsBbwFxgXMBaAFLgV+BH8DUQI0ARgAA/8r/n/91fx//G/8fPyn/AX9d/3t/Xz+6v41/2//ev9I/xD/u/5J/tz9Xv3S/Iv8w/wz/Q7+NP+XAP8BQANnBD0FwAX2BSUGAAajBfIE9gPGApQBbQBA/2H+ov3t/IP8avx5/Jz89Pxo/d39c/7S/hX/UP9W/yP/7v6q/kT+3P19/SD91fwI/Y/9Vf5u/6YA+AEoAzYEAAWOBccF5gW6BU8FvgTMA5sCbwFIAB//UP6u/Rv9w/yu/Lf86vw7/Z79Gv6U/g3/cv+h/6//mP9Z/wT/r/48/tH9ef0o/d/8+/yo/YT+m//UAD4CggN/BEMFtAXYBdIFqAUnBVoEYwMdAtYArf92/qT9IP25/H78ePym/N78Mf2Z/Qz+f/4A/03/cP+B/1T/GP+s/mj+D/6o/Vv9QP08/af9d/6B/7QA+AEiAygE+QSFBaIFfwVIBe4EXAR7A3gCRwEVAD3/aP61/Qf9sfyZ/Jz8y/wM/Xr9A/6S/hr/Yv+I/5X/a/88/97+h/4m/rr9Q/0E/Tj9zP2k/rz/+gA0AjMDCwS8BCAFQAVHBR4F0AQUBCYDGAIAAQsAIv9o/q39E/3m/M/8zvzz/Fj91v1Q/s/+SP+e/67/nf+b/1j/+P6T/hv+Rv2L/OT8gP1e/mX/3AAfAtwCqwOCBPUECgUvBfcEiwSdA54CgwFQAD7/Rf61/R796vzg/FD9vf0t/tr+ef/+/1YAnwCbADAAlf8B/0P+ff3O/Av8SPuA+1r8Ov2H/igAVwGvAk0DTQS2BOcECQWdBD4EAgMFAqIAkf+A/p79Gv0B/Tr9hf1J/iX/CACvAGgB7gEOAvoBugFmAa8AzP8G/z3+af2y/Cj80Pvn+5j8bv3I/hEASQF9AjID7gP4A/ADmAMjA2ICbQHBAP7/Nv+k/kv+Iv7w/Tj+uv47/6D/KADrAEwBcwF7AVMBHQFaAHz/nv71/T79ifwI/OP7Zfzg/LD+HAAbATkCIAPwA8ADuQN+Ax8DVQJYAcgA8P8e/2j+HP61/Wn9f/0N/oD+6/7t/8cAYgF3AbsB+QGHAQ0BjAA1AIz/sf5r/hP++P3H/fz9O/54/sb++/7Q/08A4QBYAcYBDQIAAv0BwAF3AfYAwgBdAPP/if9V/2//gf+L/5r/mf+3/5H/dP9c/3D/ZP85/wj/Bv/s/lb/XQD7APAANQGPAZABIQE3AWsBRAHWAMIAwQBTAND/iP9a/8T+Nf49/nf+k/7M/iv/nf/w/+j/AAArADUA+//o/xYAFQC4/6P/0f/g/7n/5f8hACoA+P8bAFwAZwBaAFoAkwB8AFEASgBRACcA7P/s//f/3f/A/8//+v8AAAQACwAhAC8AJQAhABYAHAAPAOn/4P/d/8P/qP+9/9z/3f/p/xAALgApADAASQBNAC0AFwAoABkA7f/c/+D/uf/D/8r/0//C/8b/5f/3//3/AwAOAPb/5P/b/9//3P/N/9r/7f/R/83/yf/P/+L/AgAKAB4AOwBJAE8APABMAFIAOwAvAC4AGwABAPH/3//a/8//xv++/8b/2P/a/+P/2v/i/+j/5P/e/+7/7f/0//D/4v/h/+n/9/8JAPn/BgAaACAAIgAjAC4AKQAgAC4ALAAoAA0AGgAVAPf/9P/p//D/5//j/+D/4P/m/+3/8P/0//b/+v/r//P/+P/8//v/+//o/9v/5//e/+j/7f/l//j//P/9/wgAGAAeABgAJQAuACsAIwArACIAJgAgAA8AAAD8//b/8P/f/+j/5f/p/+z/3v/e/97/5f/t/+r/5f/f/9z/5P/l//L/+P/5/wAA+f8FABAAEAAPABwAGAAKABMAEAAQABYAFQAFAAUAFQAHAAEABAAFAAYAAAAAAPj/4//+//X/9//n//L/8f/s/+D/4v/m/+7/2v/n/+//6//w//z/9P/v//r/8/8BAAQACQATAAcADgAOABkAHgAYABUAHgAcAAsADgAQAAMAAAD+//j/8f/j/97/5f/k/9L/4P/d/9j/2f/o/+D/3f/y//P/6P/s//7/BAAAAA8ABgAAAAcAEAAIABIAFgARABwAGAAKABcAGgATAAgACAALAAoAAAD9//j/8f/z/+X/8v/l/+v/8v/k/97/4v/j/+D/3v/e/+n/7//l/+7/+P/w////AgASAA0AEAAdABkAFAAaACEAJwAdACEAHQAQAAkA//8FAAMA9P/o/+H/8f/r/+D/2v/W/+L/3v/Y/+P/3//g/+P/3//o/+///v/7//r/BgAIAAgACQAMAAsAGAAdABAAEAAaABsAGwAVAAwAGQAKAAgADQAEAAcA/v/+/wQA+P/4//L/7//u/+7/5v/m/+j/8f/v/+H/7P/2//P/+P/z//n/8f/3//r/AAD1//L//v/e////AgAGAPL/+/8ZAPz/FQDX/wMA6//r//v/AgAQAPD/AgD+/wgA9f8fAP3/AwAAAN7//v8VAAQA/P/8////AAAZAOL/AQDs/woA8P8EAOr/AAAAAPj/BAATAB0A+f/2//f/CADU/wAADgAjAO3/+P8BABkA8f/t/wQAAADT/+X/AwAMAPL/8v///wgA9/8RAAEA///2//v/GgD9/xwA9//7/+b/9v/y//b/9v/3/+T/+f/+//v/9/8hAOL/9f/S/w8ACAAEAP3/AAAZAPD/CADo/wcAGgD3//b/DwDc/+v/+v8LANb/AAAEAAMAFgDd/wIA+f/w//v/BQAGAPb/HgD5//r/7v/9/wIA8/8AAPL/+f/9/9//AAALACUA9P8ZAPf/AQAIAPr/AwDy/xgA8//0/+b/6v8NAPX/BwDs////8P8BAPb//v8aAO3/AQDt//H/7v8WAOn/+P/X/wMAAAAVAPj/9/8QAPb///8SAP7/8P/4//n/9/8YAOz/9/8WAO7/9//4/xQA5//f//r/9f/0//v////3/wUAHgD4//7/EADv/9X/AwALAO///v/1//f/DwDr/wAAAAAVAOf////3//f/2P8AAPv/GgD6//j/+v/l//D//v8DAPT/BgD///7/GQD6//n/2f/q//////8CAPv/HQDy/wgAEgD3/wAA+f8DAA0A+f/8//X/5P/9//j/BwD6//r/9P/k/wIA9P8GAPn/AwD1/9T/KwDw/w0A9P8jAO3/AgACAP7/EwDo/wIA6P8KAOj/BQD3/9b/8v/6//H/CADe/ycA8/8PAPH/AgACAPX/BwD///7/9f/+/xIA1f8JAPj/AQD6/x4ACgABANf/AwAFAPz/+/8GABoA7P8YAOr/BADu/wUAAgD8/+L/9P8CAPb/AADz//z/9f8CAAMA///4/yAA9/8XAPv/DgDP/xwABQD///X/8P/g/+f/AADY/wcA8P8AAPH/+v/e/wUA/f8PAP3/BAAAAAsA9v/y/wAA9f/3//H/AAADAOD/9v///wYA9//+/xoA9P8BABAAAAD4/9P/5v/2/wkAAAD9////+P/6//z/+/8DAAEA+//+/+D//v/0/xgA4P8IAO//BwDe//n/AQAGACQA+v8OAAkAAwDy/wEAJQD4/+f/+P/5/wAA+f/p/+n/AwD0/wAAFAD+/wMA9P8YAPP//P/6//3/3//5/xcAAAAlAO3/BADr/+P/+v///xEA9v/6//P////1/xQA+P8XAPD//P/y/9b/BAD5/+b/BAAqAAgABQD//yoACgAtAP//9v/7/+f/6//m/+//8//u/+z/8f/z/+///P/z//j/+P/t//X/9f/N/8D/v//o/8f/8P/Y//3/3/8AAOv/AABKADgAQwAxADMAPwA4ADQANwAmACAADAALAP7/DAAAAPv/9v/5//n/9P/r/+L/6P/u/+7/0P/I/8X/xP/U/83/0v/b/+P/6P/l/+f/+//5//z/FAAxACYAJgAdACIAEwAVAB8ABgAIAAcABgD+//z/BAD//wAA8v8DAO//8v/z//P/8f/i/+//3P/Z/9j/0P/S/9X/1P/S/+L/4P/W/+T/7f/5//r/CQAQABEAGQANABgAGAAeABwAFgAJABEADQAJAAgACAAAAAYA+f8FAAgA8v/+///////y//f/+P/x//T/7P/1/wgA/f/3//H/AAD6/wgAAwDs//b//v8IAAEAEQAIAPf/BwACAPP///8SAAAA+/8AAP7/BgD4/wAAAgD8/wAACgD3//D/9//4//n/+//f/+X/9f/s//P/8P/0//n/+P8HAP7/BwAIAAAA+v8FAP7/BgAIAAgAAgAXAAIAAgAMAAsA+P8AAAkA9v8CAAAAAAD4//r/+v/v//H/7P/w//T/7v/u/+7/9P/w/+z/8P/w//j/7f/y//r/+v/0//v/+v/9/wcABwAHAAgA+v8FAAUA///5////CgAAAAEA/P8AAP7//v/6//T/+f/4//f/+//u//j/+f/5//j/9//v//b/+P/0//r////3//X/+v/v//7/9//w//3/AgAAAAAAAwD//wYA/P/9//v//P8GAAMA//8AAAAABAACAPD/BQD6//D/+f/z//H/CQD+//r//f/9//T/9f/4//7/8P/8/wcA//8AAAAAAAAAAAAA//8EAAsAAAD6/wAABQD///r/+v8AAAAAAAAAAAAAAAAEAAoA/P/1//z/AAAAAAQA///5/wAABwD7/wAABAD9/wIABAD7/wEAAAAKAAAA9v/+//z/+/8AAAUA+f/z/wAABwD8//7/BAD9/wMA+f/7/wcAAAD+/wgAAgD//wAAAAAGAPz//P/5//r/AQD7//r/CgD5//r/AAAAAAUA//8AAPn/AAAAAPr/AAD//wMABAAAAPv/+/8AAP//BAAEAPn/+P/9//L/+f/s//X//f/3//D//P8JAOv/+P////H//P/7//f/8v/z//P/+P/y//f//f/9/+z/+P/9//H/+P8AAPr//f8EAAQABQD5/wAABQAEAAAAAAAAAAAABQABAPz//f/+//v/+v/5/wAAAAD5/wUAAAAAAAAAAAAFAPr/+f8GAAUA+P8FAAAA+v/7//r/AAD8//z/CAACAPz/CAAAAAUABQAAAPn/BQAEAPn/BgD1//v/AAAEAAQA+v/0//3/AwD9//3//P8IAAcAAgAGAAAA+v8FAAQA+f8AAPv/+/8AAPn/CwD//wAAAAD6/wwABAD/////AgACAP3/9//7//P/+P8LAPn/9f/5/wIABwAKAPn/AAAMAPr/+//5/wUABQD5/wYAAAAAAAUABQACAP3//f/6/wAA//8AAPr/+v8AAAAAAAD//wAAAAD6//r//f/8/wEACAAFAAAA+v8AAAsAAADz/wYAAAAAAAUAAAAFAAUA/f/6//r/AAAAAAAA+f8FAAUAAAAAAPr/AAAFAAAA+f/6/wYAAAD5/wUAAAD6//r/AAAAAAAA+f/8/wMACwDz/wIACwAAAAAA+v/5/wUABAAFAAAAAAD6//r/AAD/////AAD6//r//P8IAAsAAAD0//r/AwAAAPz/AgAFAAAA+v8AAAYAAAAAAP//BAALAPz/+v/6//r/BQD//wAA+f/5/wYAAADz//3/AgACAPz//f8CAP3//P8IAAIACAAAAAYABQAFAAUAAgD9//f/AwD2/wAA+v/4/wsABQD8//r/AAAAAPr/AAAEAAAA+f/6//T//f8CAAgAAgD9/wIADAAMAPr/8/8FAAsAAAD5/wAAAAAAAAUAAAD5/wAABgD5/wAABQD5//n/AAD6//n/AgAFAAUABQD5/wAADAAAAPn/+f8AAAAAAAD6//r//f8CAAsACwD5/wYA+f8FAAwA/P/9//b/AAAFAP3/8//6/wAAAAD5/wsAAADz/wAAAAAFAAQAAAAAAPn/+v8MAAAAAAAAAPn/BQAFAAUA/f/5/wAABQACAPz/AgD9//b/AgD5//n/AAD5//r/9v/9/wkAAgACAAgABQAAAAAAAAAFAAAABQAAAAAABQD5/wUAAgD9//r/+v8GAAAAAAAFAPn/+f8AAAAA8//9/wIAAgACAAUAAAAAAAAABgD5//n/AAAFAAUAAAAAAAAAAAD6/wAA+v/5/wUABQAAAAAAAAD5/wYA+f/5/wUAAAAFAAAA+f8AAAYA+f/5/wwABQD5/wAAAAAFAPn/+f8AAAAABQD5/wwACAD8/wIA/f/2//n/AAD5//P//f8CAPb//P8JAAIAAgACAP3/AgAJAAUACwAMAP3//f/6/wYAAgD2/wAAAAAJAPb/6v/6/wAA/P8FAAUA8/8CABIABQDs/wAAEgD5//L/AAAGAPr/+f8FAAYA+f8AAAAABQAFAAAA+f/5/wAAAAD5/wAAAAD5/wAA/P8CAAIA/P8CAAwABQAAAAAABQAFAAAA+f/5//n/+f8GAPn/9v8JAAUAAAD5//n//f8JAAAABQAFAPn/+f8AAAUAAAAAAAAA+f8AAAAABQAFAAAAAAAAAAUA+f/z//n/BQAAAPn/BQAFAAAAAAD5//r/CwAAAPP/AAAAAAAABQAAAAAAAAAAAAAABgAAAAAABQAAAAAACQD2//P/+f8FAAAA+f8FAAUA+f/z/wAABQAFAAAAAAAFAAUAAAD5/wAABQD5//n/BQD5//P/AgAFAAAAAAAFAAAAAAAAAPn/+f8AAAAA+f8FAAUAAAAAAAAAAAAAAAAA+f/5/wAAAAD5/wIAAgAAAAUABQD5/wAAAAAAAAAABQAAAAAABQAIAPb/+f8FAPn/+f8AAAAABQAAAAUA+f/z//n//P8JAPz/AgAFAPn//P8JAAUAAAAAAAAAAAAFAAAADAD8//z/AAAAAPn/8/8FAAUAAAAAAPn/+f8GAPP//P8CAAIAAgD8/wIACQAAAPn/BQAFAPn/AAAFAAAAAAAFAAAAAAAAAAAAAAD5/wAAAAAAAAAAAAAAAPn/AAAAAAAA+f/5/wUACwD6//n/BQAFAPn/8//8/wkA+f/8/wkA/P8CAAIA/P8JAAUAAAAAAAUABQAAAPn/BQD5//n/AAD5//n/AAD8//3/CQAFAAAA+f8MAAAA+f8AAAAA+f8AAAAA8/8JAAYAAAAAAAAA8/8FAAUABQAFAAAAAAACAPz/+f8AAAAA+f/5//n/+f8CAPz//P8CAPz//f8CAAIACAAJAAAAAAAFAAYABQAAAAAAAAD5/wAABQAFAOz/+f8AAAUAAAAAAAAAAAAAAAAAAAAAAAAA+f/5/wAABQD5/wAA+f/2/wkAAgD8/wkABgD5/wAADAD5//n/BQAAAAAAAAAFAPn/+f/5/wUABgAAAAAA+f/5//n/AAD8//b//P8PAAIAAgAMAAAA+f8AAAAABQAAAPn/AAAAAAAABgD6//n/BQAAAPn/BQAFAAAAAAAFAPn/AAAFAPn/AAAFAAAAAAAAAAAAAAD5//n/AAAAAAAAAADz/wIABQAAAAUAAAAAAAUABQACAAIA/P/8//z//P8CAPz/9v8AAPn/+f8AAOz/AgAJAPz/AgACAAUAAAAAAAUAAAAAAAAA+f8AAAwABQD5/wUAAAD5/wAABQAAAPn/+f8AAAAA+f/5/wIAAAAAAAAA8P/9/wMAAwAJAAIAAgAFAAwABQAAAAAABQD5/wUAAgD8//z/9v8AAAUA/P/5/wAAAAD5//P/BQAFAPn/+f8AAAAA+f8CAAIAAAD8//z/CQAMAAAAAAAMAPP/BQAFAAUA/P/5/wAABQACAAIAAgD8//D/AAD5//n/AAD5/wAA+f/8/wwAAADw/wkABQAAAAAAAAAAAAAABQAGAPr/8/8LAAsA+f/6/wAAAAAAAAsACAACAPb/9v8AAAIA9v/5/wAA+f/5//n//P8PAPP//P8JAAIAAgACAAwABQAFAPn/AAAMAPn/+f8AAAAAAAD5/wUAAAAAAAAAAAD5//n/BQAFAAUA+f8FAAUA+f8AAPn/+f/5//z/AgACAPz/CQD8/wIABQAFAAAABQAAAPP/BQAFAAAABQD5/wAAAAAFAAUA+v/5/wAAAAD5/wUA+f8AAAUA+f/5/wAAAAD2/wIACQAAAAAADAAFAPP/AAAFAAAAAAAAAAUABQD9/wIA/P/8//z//P/8/wAAAgD8//z//P/z//n/AAAAAAAAAAAAAAAABQAAAPn/BQAFAAAAAAAAAAUABQD9//z/AAAAAPn/+f8GAAAAAAD5/wUAAAD5//n/AAAAAPn/BQAFAAAABQAAAPr/AAAAAAsA+f/6/wYAAAD5//n/+f8AAAAAAAAFAAAA+f8AAAAADAAFAAAABQD5//n/AAAFAAAAAAAAAPP/8/8JAAUA+f/5//z/AgAJAPz//P8JAAAAAAAAAAwAAAD5/wAABQAAAAAAAAD5/wUAAAD5/wAABQAAAPn/BQAMAPz/+f8AAPn/AAAAAPn/AADz//z/CQAGAAAA+f8AAAAABgAFAAAABgD6/wUABQACAPX/AAACAPn/8//5/wAABQAAAPn/AAAAAAwABQDz/wAADAAAAPn/DAD8//P/AAAMAAAAAAAAAAAABQD8/wAA8/8AAAwAAAAAAAAABQAAAPn/AAAAAAAAAAAAAPn/AAAAAAUAAAAAAAUA+f8AAAUAAAD5/wAAAAAAAAAAAAAFAPn/AAD5//P/AgACAAIAAgAFAAYABQAAAPn/BQAAAAAABgAAAPn/8//5/wAAAAD8/wIAAgACAAIAAAD9/wUABQAAAAUAAAAAAPn/AAAFAAUA+f/z/wAABQAFAPn/AAAAAPn/BQAAAAAABQAAAPn/AAAAAPn/8/8CAPz//P8JAAIADAAAAPn/AAAFAAAAAAAMAAIA9v/5/wUAAAD5/wAAAADz/wAABQDz/wAAAAAFAAAAAAAGAAAAAAD5/wAAAAAFAAAABQAAAAAAAAAAAAAA8/8AAAAABQAAAAUAAAD5/wwACQD8//b//P/5//n/BgD5//n/AAAAAPn/AAD9/wIABQD2//z/FgAFAAAAAAAGAAYA8/8AAAAAAAAAAAAABQAAAPn/AAAAAPn/+f8AAAAABQD5//n/BQAAAAYA+f8FAAUA+f/5/wAAAAAGAAAAAAAAAPr/+f8AAAAACwAFAPn/CwD9//P/AAAFAAUAAAAAAPn/AAAAAAUAAAAFAPn/+f8FAAAAAAD5/wAABQDz//n/BQD5//z//P8CAAIA/P8PAAwABQAAAPn/AAAFAAAAAAAFAAAAAAD5//n/+f8AAAAA+f8FAPP//P8CAAkAAAD8//z/AgAJAPb//P8JAAkABQAFAAUAAAAAAAAA+f8MAAIA/f/8//z//f8CAAIA9v/2/wAA+f/5//n/+f/8//z/AgACAAIACQAAAP3/AgAMAAUAAAAAAAAAAAAAAAAAAAAFAAAAAAD5/wYA+f/5/wAAAAAFAAAA8/8AAAAA+f8AAAAAAAD9/wUAAAD5/wAAAAAAAAAABQAFAPn/+f8AAAAABQAAAAUADAD8/wIA/f/9//b/+f8FAAAA8//5/wUAAAD5//n//P8DAAMAAgD2//3/CAD2/wIADwAFAAwAAAAAAAUAAAAAAAUAAgD8/wIA/P/2//z//P/8/wAA+f/z/wAAAAD5//D//P8PAAIA/P8CAAIAAgAMAAAAAAAAAAUABQAFAPn/+f8FAAAAAAAAAAUA+f/5/wAA+f/z/wIABQAAAAUAAAAAAAUAAADz/wAAAAAAAAAAAAAAAPn/AAAFAAUABQAAAPr/CwD9/wAA+f/6/wYABQD5//P/BQAMAAAAAADz//n/AAD5/wAABQAAAPn/9v/8/wkACQAMAAUADAACAPb/+f8AAAUA/P8AAPn/+f8AAAAA+f/5/wAAAAAFAAUAAAAFAAUA+f/5/wAAAAD5/wAA+f/5/wwAAAAAAPn/+f8FAAUAAAAAAAAAAAAFAPn/AAAAAAAAAAAAAPn/8/8FAAUA+f/6/wAABQAGAAAAAAAGAAAA+f8FAAUAAAD5//n/8//8/wIA/P8PAAUA+f8AAAAABQAMAAIA/P/8//z//P8CAPz/8//z/wAA+f/2/wkAAgACAAIAAAD8//z/CQAFAAAA+f8FAAUA+f/5/wUA+f8SAAUA+f8AAAAA+f8AAAUAAAD5/wUA+f8AAAAA8/8AAAAA+f/8/wIACQDu//b/AgD6//r/+v8AAAsA+v8GAAMA/v/y/wAAGADd/wgA6f8gAPD/7f8AAPr/5P/8/wMAAAAFAPH/6P8IAAAA+/8AAAAA+f/i/w0AAAD7/wEABQAFAOD/IQD2/xwA6f8IAP3/4v/y/wIADADu/wQAAgD2/9H/CAD5/wEA+f8FAAAA0f8MAAwAEADY/xUAAADo/wEAAAAQAAEAGAD1//n/9f/5//n//f8GABUA/f/y/+D/DgD4/wYAAgACAO//+v/k/wEA+f/g/yAA0f8JAOn/CgD1/wkAIADk/woA7f8IAAgAEAABAOT/+v/q/wIA9f/o//n/+P8FAP3/IADw//3/+f/8/+7/BwD8/8j/BADs/wEA9P/k/xwA5v8EABEABQAMAOT/5f/9//n/8f8AAOz/CgD9//z/+f8FAOL//P/5/xAABAABAAgAEAD6//z//f8FAAIA+P/5//r/BQDx//j/+P/4//j/+P/4//j/9P/4//j/+P/9//j/+v8BAPr/+P/4//T/8P/u//z/7P/4//H/+v/9/+v/+v8EAPj/9P/8/wUAAADs/wIABQAAAPn/AgAFAAAAAAAAAA8ABQD2//b/CQAFAAAA9v/8//z//P8JAPb/9v8AAAAA8f/2//n/AgD4//j/AAABAPr//f/4//3//v/1//j/AAD0/+7/+v8AAPH/5P/u/wcA+v/r/+7/9P/0//j//f/x//3/+P/x//3/8f/9/wAA8//8/wIAAgACAAUA+f8FAAUABQAFAAAAAgACAPz/AgACAPz/9v/8//z/8/8AAAAABQD5//P/AAAAAPn/BQAMAPn/AAAFAAAA+f8AAPn/AAAFAAAABQAAAAUA+f8AAAAAAAAGAPL/8f8DAAMA+v/7//v/9P/1/+3/7v/6/+7/8f/x//H/7v/0//r/+v/0//T/+v/6//r/+v8BAAEA/f/+/wwA/P/5//n/AAAFAAAABgD5//n/AAD5/wAABQAAAPn/AAD5//n//P/8//3//P8PAAkAAAD5/wIA/P8MAAUAAAAFAAAAAAAFAAIA8//z/wAADAAFAPn/AAD5//n/AAAAAAAAAAAAAAAA8v/9/wcABQAGAAAAAAD5//n/BQAFAAUAAAAAAAUAAgD8//b/+f/5//n/BQAMAAAAAAAAAAAABgAAAPn/AAAGAAAA+f8FAAAAAAAAAPP/BQAAAPn/+f8GAAAA+f8AAAAAAAAAAAAAAAAAAAAABQAAAPn/+f8FAAUA+f8AAAAAAAAAAPn/+f8AAAUA+f8AAAAABQAAAAUA+f8AAAYABQD5//r/BgAAAAUABQD6/wgAAgD8//b/+f8JAPz/AgACAPb/9v8AAPn/8/8AAAAAAAAAAPn/AAAFAAAA+f8FAAwABQAAAPn/BQAAAAAABQAJAPz/8P8AAAAAAAD5//n/+f8AAAAAAAD5/wUABQAAAAUA+f8AAAAABQAAAPP/+f8AAAUA+f/2/wkABQAAAAUABQDz/wAABQD5/wUABQAGAAIA/P/9/wcA/f/2//z//P/5//n/8v/5/wIA/P8CAAkABQD5//n/BQAFAAAAAAAAAAYAAAD5/wUAEgD8//D/AAAAAAUAAgDz/wAAAAAAAPP/AAD5//b/CQD8//b/AgAJAAkABQAFAAAAAAAFAAAAAAAFAPn/+f/5/wAA+f8AAAYA+f8AAPn/AAAFAPn/AAAMAAUA+f8FAAAAAAAFAAAA8/8AAAAA8v8AAAAAAAAAAAUAAAD5//n/BQAFAPn/BQD5/wAADAAAAAAABQAAAAAAAAD5/wUAAAD5/wAA8/8AAPn/AgAGAAAABQD5//D//P8JAAIA/P8CAAkA/P8MAPn/AAAFAAwABQD5/wAA+f8GAAAABQD5/wUAAAD5/wUA8/8AAPn/BQAAAPn/AAAAAAAA+f8AAPb/CQAMAAAAAAASAAIA7/8AAAAABwD9//b/AAAFAP3/+f/5/wUA8/8AAAAA+f/8//z/AgD8/wkA/P8CAAkAAAAMAAAAAAAAAAAA+f8AAAAA+f/5/wUAAAD5/wUABQAFAAAAAAD5//n/AAAFAPn/8/8CAAwA+f/5/wAA9v8CAPz/AgD8//z/DwACAPz/AgD8/wIACQAFAAUA+f8FAAUAAAD5/wAADADz//n/BQD5/wUAAAAAAPn/AAALAPP/+v8GAAsA+f/5/wUAAADz/wUAAAAAAAAA8/8AAAUADAAFAAAAAgACAPz/9v/5/wAABQD5/wAABQDz//n/AAAFAAAA+f/5/wUA+f/2/wIAAgACAAIA/P/2/wkAAgACAAkAAAAFAAUAAAAMAPz/AgACAPz//P/2//n/BQAAAAAA+f/s//z/AgACAAUA8P/8/wkA/f8CAAMACQACAAIA/f/8/wkABgAFAAAAAAAAAAUABQAAAPn/BQAAAAIA/P/z/wAAAAD5//n/AAAAAPn/9v8CAAkAAgAAAAAAAAAFAAAAAAAFAAUA+f8AAPn/8/8AAAUAAAD5/wAA+f8CAAAAAAAAAPn/AgAAAAUABQD5/wAAAAAAAAUA+f/5/wUA8//w/wkAAgACAPz/AgACAAIAAgACAAAABQALAAAA8/8GAAUAAAAFAP3/+f/5//n/+f8GAAUABQAAAPP/+f8AAAAAAAD5//z/AgD8/wIAAgACAAUAAAD5/wAABQAFAAUABQAJAPz/9v/8//n/+f8FAAAAAAD5//n/BQD5//P//P/8/wIAAgACABIAAAD5//n/BQAAAPn/BQD5/wUADAAAAPP/AAAFAPP/BQAFAPP/AAAAAPn/BQAGAAAAAAAAAAYA8/8AAAsAAAD5//n/BQAAAAUA+f8AAAUA+f/5/wAA+f8AABIAAAD5/wAAAAAFAAUA+f/5/wAA+f8FAPn/+f8MAAUAAAAAAAAAAAAGAAAA8/8FAPn/+f8MAAUA+f/5//n/+f8FAAUABQAAAPn/AAAAAAUAAAD5/wAABQAFAPn/BQAFAPn/AAAFAPn/+f8AAPn/8//8/wkABgD6/wMABQAAAPn/BQAGAAAA+f8AAAUABQAAAAAAAAAAAAUAAgD8//z//P/5/wUAAADz/wAABQAFAAAA+f8AAAUA+f/5//n/AAAAAPn/DAAAAAAAAAAAAAUABQDz//n/+f8AAAAABQAAAPn/BQAAAAwAAAAAAAwA9v/5/wAAAAD5//P//P/8//z/CQD2/wIADwACAAAADAAFAAAABQACAP3//P/z//r/BgAGAAAAAAD6//P/AAAAAAAABQDz//z/DAAAAPn/+f8CAAIAAAAAAAAAAAAAAPn/AAAAAPb/AgAJAAAAAAAAAAUABQAAAAAAAAAAAAAAAAD5//n/+f8FAAAA8//8/wIA/P8JAAUAAAAFAAAAAAAFAAAA+f8AAAUABQACAA8AAgD8/wIA/P/8//z/9v/8//b/+f8FAAIA9f/5/wAAAAD6/wAABgD6//P//P8IAAUAAAAAAAAABQAAAAAABQAFAAUA/P8JAPb/9v8AAAAAAAD5//n/8/8CAAIA/P8CAAkABQD5//n//P8CAAIACQAMAAUA+f/5/wAAAAAAAAAABQAFAAAAAAAFAAIA9v/5//n/+f8AAAAABQD5/wUADAACAPb/AgACAPD/+f8AAAAAAAAAAAAA+f/5/wUAAAD6//b/AwACAAIACQAAAAAAAAAAAAUAAAD5/wwAAAAAAAAA+f8AAAUAAAD5//n/AAD5//z/AgAFAPn/AAAGAPn/AAD5//z//P/8/w8A/P/8/wkABQAFABIA/P/5/wkA/P/8//b/AAD5//P/BQAGAPn/+f8AAAUABQAAAAAABQACAPn/8//5//n/BQAAAAAABQAAAPn/+f8FAAwABQAAAAAAAgD8/wMAAgACAAMA9v/v/wAAAAD5//n/AAAFAAUA+f/z/wUAAAAFAAwA8/8AAAUAAADz/wAAEgD5//P/+f8AAAAABQAAAAAABQD5//n/AAAAAAAAAAD5/wAADAAAAPn/AAAAAAAABQAFAPn/+f8AAAAABQAAAPn/AAAFAAAA8/8AAAAABQD5//n/DAAAAAAAAAAAAPn/+f/5/wIABQAAAAUABQD6//n/+f8FAAAAAAAAAAUABQAAAAAAAAAAAAAAAAAAAAAABQACAPz/+f/5/wAAAAD5//n/AAAAAAUABQAAAAAA8/8AAAwAAAD5/wwAAAD5/wAAAAAAAAAAAAD5/wAADAAFAAAAAAD5//n/AAAFAAAAAAAAAAUABQD5/wAABQAAAAAA8/8FAPn/8/8FAAAADAAAAPP/+f8AAAUAAAAAAAAAAAAGAAAABQAFAAAAAgD9//n/BQD8/wAAAAACAAkAAgD2//b/+f/5//n/+f/5//z/9v8CAAkAAgD8//z/AgACAAkADAAMAAAA+f/5//n/BQAFAAwAAgD2/wAA+f/5/wUA+f8FAPn/+f8FAPn/+f/8//z/AgACAAIAAgACAAIABQAFAAAAAAAAAPP/AAAFAAUA+f8AAAAA+f/5/wAACwAGAPL/8/8GAAUA+f/6/wAABQAFAPn/+f8FAAwAAAAAAPn/BQAFAPn/+f8AAAAA+f8MAAAAAAAAAPn/+f8AAAYA+f/z/wIABgAAAAAAAAAFAAAAAAD5//n/AAAGAPn/+f8FAAAA+f/9/wIAAgD8/wIADAAAAAwABQD8//3/AAACAPz/9v8FAAIA9v8AAAAA+f8AAAwA+f/5/wUAAADz//r/7//2/wcAAgADAAMAAgAIAAIA/P8MAAAABQAFAAUAAAAAAAAAAgACAPb//f/8/wAAAgD2/wAA+f/z//n/AAAAAAAAAAAAAAAAAAAAAPn/BQAGAAAAAAAAAAAA+f/5/wUABQD5/wAADAAFAPP/+f8FAAAAAAAFAPn/AAAAAAAA+f/z/wIAAgAAAAAAAAAAAAYAAAAAAAAA+f/5/wAADAAAAPn/+v8AAAsACwD8/wIA/f8CAAIA9v/8//b/+f8AAAAA+f/5/wAABQAAAAAAAAAAAAAABQD5//n/BQAAAPP/AAAGAAAADAAFAPn/BgAJAPD/+f8MAAIAAgD2//z/+f8GAAIA/P/5//n/AADz/wAA+f/w/wIA/P8CABYAAAD8/wIABQAAAAAAAAAAAAUAAAAFAAUAAAD5/wAAAAAAAAAABQD5//r/BgD5//r/+f8FAAYA+f8AAAUA+f/z//z/CQAAAPz/AgAMAAUA8//5//z/AgAJAAAAAAAFAAUA+f8AAAYAAAD5/wAABQDz/wYABQAAAPn/AAAAAPn/AAAAAPn/+f8CAAAAAAAFABIAAgD2/wAACQACAPb/8//z/wYABQAAAAAA8/8FAAUA8//5/wwABQAAAPn/8/8AAAwA8//2/wIACAAAAP3/AgADAAMAAAAGAAUAAAAAAAAABQAFAAAA8/8FAAUAAAAAAPn/BQAJAPz/8P8AAAUACQD2//n/+f/5/wAAAAAAAOz/AgAJAAAAAAD2//z/CQAJAAUA+f8FAAAAAAAFAPn/+f8AAPn/BQAFAAAABgAAAAAA+f/5/wYAAAAAAAAA+f/5/wAA+f8CAAAA/P8JAAUAAAAAAAAA+f/6/wUA+v/5/wIAAwAAAAAAAAAFAAwAAAAAAAUAAgACAPb//P8CAPb//P/5/wAAAADs//b/CQACAPb/CQACAAIABQAAAAAABQAFAAwAAgD2//z//P8AAAkA9v/5/wAAAADz//n/AAAAAAUA8//2/wIACQACAPz/CQAMAPn/8/8JAAAA+f8FAAwAAAAAAAAA+f/5/wAABQAMAAAA+f8FAAAA8v/5/wAA+f/9/wMAAwD8/wgAAAAFAAAABQAFAAAAAAD5/wUAAAD5/wAAAAAAAAAA+f/5/wAAAAD2//z/DwAFAPn/AAAAAAUAAAAAAAAABgAMAPb/+f8AAAwAAgDw//P/+f8AAAAA+f8AAPz/CQAMAAAAAAD5/wAAAAAMAAUA/P/5//n/BQAFAAAA8/8AAAAA+f8AAAUAAAAAAAAA+f8GAPr/+f8FAPn/AAAAAPn/BQD5//3/AgAMAAUAAAAAAAAA+f8AAAwAAAAAAAAAAAAAAPn/AAAAAAAAAAD5/wAAAADz/wIADAAAAAAABQAMAPz/8/8FAAkA/P/8//z//P/z/wAABgD5/wAA+f/5/wAABQAAAAAABQD5/wAAAAD5//n/BQAFAPn/BQAAAPn/+f8AAAUABQAAAAAA+f8AAAUA+f8AAAYAAAD5//n/AAAGAPr/+f8FAAAAAAAAAAUA+f/5/wUABQAFAPP/8/8AAAAAAAAAAAAAAAAAAAwAAAD5/wAA+f8FAAUABQD5//n/BQAAAAAA+f8AAAAAAAAAAPP//P8CAAIABQAAAAAA+f8AAPz/AgAMAAAAAAAFAPn/AAAAAAAABQAAAPn/+f8FAAUAAAD5/wUAAAD5/wAAAAAAAAAA+v/5/wAABgAGAPr/AAAAAAAAAAAAAAAAAAAAAAAA8/8AAAUAAAAFAAAABQAAAAUAAAD5/wUAAAD5/wAABQAAAAAAAAD5/wAAAAD5/wAA8/8CAAUA9v8CAAIA/P8JAAUA+f8AAAUAAAAAAAUAAAAFAAUAAgD8//z/AgACAPb//P/8//z//P/5//P/8/8CAAUAAAD2//b/CQAPAPb//f8IAAsAAAAAAAYACwADAPb/AgACAPX/+f8FAPz/+f8AAAAA+f/5/wAABQAAAPn/AAD5/wUAAAD5/wAABQAAAPn/BQAAAPn/AAAAAAAAAAAFAAUAAAAAAAAA8//5/wAAAAAAAPn/BQAFAAAAAAAAAPP/AAAFAAAA+f8FAAAA+f8AAPn//P8CAAIAAgD8/wIABQD5/wwABQD5/wAA+f8FAAUA+f8FAAAA+v8GAAAAAAD5/wAAAAAAAAYA+f/5/wUABQAAAPP/AAAFAAAAAAD5/wAAAAAFAAAAAAAAAAAABgD5//P/+f8FAAwABQAAAAUA/P8CAAIA8P/5//n/AAAAAPn/AAAFAPn/8f8AAPj/9P/0//T/AQAEAPj/+P8AAPn/BQAAAAAA+P/4/wUAAAD4/wAAAAAFAAUAAgD8//z//P8FAA0AEgARACgAIAAgABoAGQAYABEABQAKAAIA/P/l/+L/yv+5/5r/iv+F/3T/bf9l/3H/cv9p/6H/zf/p/xgAQQBhAJAAqADAAMsA+gAEARYBKgE5AS8BCQEFAdwAmABgADUAAQDG/6r/hP9Q/yn/Fv/g/pv+eP5I/i3+/f3p/ej9/f0W/kD+iP7V/hz/Yf/A/wUAWACoAPAAMQFxAcAB6QEZAjoCRAI4AiMC4gGiAWABKAH1ALgAeABFABMAyv+C/1v/EP/C/o3+UP4w/vL92v3C/eD9H/5g/sD+Av9l/7r/BQBSAKgA5AAwAXYBnAHsASsCSAJCAhYC7AGYAT8B1QB4AB8ABwDN/4z/Yf8w/+n+yP6o/nn+Wf5Q/k7+QP5i/mr+nf7R/iz/kP/o/zQAigDRAAkBSwFzAZwB1gHtAe8B9wHlAdwBqQFcAfkAfgANAI7/KP/R/sT+mP50/mj+Vv5C/kn+R/5s/nH+g/6w/uT+EP8+/4n/vP8FAGUAtADzABcBSQFqAYIBmgG2Aa8BsAGwAZYBhwFgARwBpAAtALT/RP/o/sr+wv6a/nj+bf5d/lr+Wf5s/oD+p/7F/ub+L/9c/3D/oP/r/0MAngD0AEwBbQGIAakBwQG8AbMBrgGXAYIBZwFdAT8B+AB4AP7/ef8C/5/+Wv5m/mr+Vv5F/kL+Qv5I/mb+mv69/vT+Fv9I/3n/lv+w/+f/MQCCAPMAaAGkAcEB5AHzAfUB8AHjAecBzQG7AYABVAErAcAAMQCl/yj/xv5u/j3+TP5g/kf+NP4g/gr+H/5G/nj+p/7a/vD+EP9E/07/Xv+Y//z/XwDtAI0B+gEoAhYCGAIYAg8CBQL2AeoBmgFjAUkBCQF8APn/ev/2/qv+bv5l/nj+e/5e/kD+IP4g/kX+af6N/rL+1f7i/hH/J/8j/0z/p/8AAH8APgH1AWcCnwJ8An0CeAJjAlcCPwL5AYEBHgHmAHwAyP8w/6j+WP49/jz+Wf6F/pb+i/59/nH+YP5t/ob+qP7F/tv+5v7w/g//KP9m/8z/MACsAD4B8gFxAq4C2QLqAuACyAKNAkECnAEVAdsAcQCs/xD/f/4s/iH+Mv5L/nX+m/6e/rL+wP6x/rb+y/7G/tf+6/7A/pv+lv6l/uX+YP/4/50AUQEPAsgCNgOIA7ADmQNwAysDwALwAQwBWQDA/xT/UP60/Vf9YP2j/e39Zf7B/sT+3f7g/tH+xv7E/r3+yP7T/rT+i/59/l3+qv4t/+H/pQCCAWsCHwOlAwQEGwT3A68DUgOtArsB8QBEAHb/wf4I/pz9dv2p/fb9h/7o/uj+9P7r/q7+qf6i/pX+g/6Q/kv+CP7s/cD9+P2d/m//iwC5Af4CFgTcBEUFQQXtBGoEqQPHAsgB7QANADH/Uv6v/Vz9dv25/e39Vf6I/p/+3P7//vb+8P6y/nD+Q/4A/o/9S/3w/KH85fyc/bn+PQDlAYQDogR9Be4FwwUlBUQEMQMeAlMBlQDH//r+Yf4E/gz+Vv6K/tT+3v6m/qP+j/5q/mL+N/4J/vj9t/1d/T39s/w+/Iv8OP1x/jkAIQLwA2MFWQbdBoMGpgVqBPUCugHjADQA4/+H///+qP6D/nH+UP5T/vj9vP20/b795P0p/jv+PP5Y/hv+zv1Q/XT8CvwZ/An9vP7zAF4DgAUDB+UHpQe4BiwFbQPPAbAA9//F/9f/jf8k/8z+kv4w/gz+0v1p/XH9gf3V/UD+nv63/uP+0/5s/vb99vwr/K777ftC/UD/rQEZBBcGTgdpB5oGMQWIAwIC+QCYAI4AuACAABcAlf/2/mj+Gv6s/Sn97fwr/WX92f2M/gD/Qv8w/6z++P3M/N37DvtI+5r8nv47AQ8ELwZJB3MHfwYMBXEDAQI/ARoBWQGuAYQBAAEwAFX/d/7K/T39tvxp/Kb8LP3N/bL+LP9R/w//cv64/cz8KPyo++n7RP0w/6QBPgQgBvEG0wayBR0EowJoAeYAAgGRARQCAQJQAWgAT/8v/l794/yI/Hn87/yE/S7+9P47/xf/jf7Q/RL9d/w4/B38rfwS/vn/OAJ0BOUFUgYbBvEEpwOeAsMBcAGjAR0CVQINAhEB0/+I/nj94Pyr/OL8Df2j/fH9X/6m/qT+Y/6+/TP9kvxC/AL8A/zb/Gf+cwAHA0QFfQawBhUGoARJA1YCvAHYAV0C3wK/Ag0CpAAM/8b9Dv3A/O78Mf1j/bH9xP0u/nb+oP4z/tX9QP2u/Gf8Lvx1/If9Y/+jATQE5gV/Bi4GAgVxA0ECywHNAYgCSAOAA9ICRwGB//f9NP34/Bb9Wv1b/Wr9X/2M/df9Fv73/Yf9R/3O/IX8Tvwp/Iv87/05AMACggXvBvoGEAZYBK4C5QH3AYUCogNEBMcDKALe/9391vz2/Iv9Cf4Y/qz9Jf3V/AX9nf0r/iP+pv07/Yf84/tj+3f7zfyM/4gCMQXIBpsGewX1A1oCvwE4Ah8DWAQhBZYEtAL+/7D9xPxj/aT+WP8Z//T9o/z0+0H8ZP1e/pz+3f3w/Aj8APt4+pD6Ivwj/y0CoQQVBvEF7wStA90C/wL3AwEFhgViBQ8EKQI5AO/+l/4q/7f/OP8J/mb8Zfts+4H8AP4A/93+wP2v/Mj77fpF+lf6//vW/j4C+gQuBtkFYARfA9oCIQP4A5kEsARDBBcDkwFKAIj/f//9/woAG/9n/YX7oPpI++z82f7D/1b/tf0t/Dz7vfpi+p/63/sF/sEAcAMABWsFmATQA0oDEwM5A6oDpQNsA9ICkAGQAA4AKwD6AG8B5QAv/wr9WfuP+0/9ef/oADAA5f1w+2H60frN+278vfwe/V3+jgBgA2AF/gUJBf0DPgMgA7sDYAREBJwDMAKFAOf/9f+VACIBiQC8/rb8JPtu+5H9qP/jAAwAV/2z+m35Z/qO/JD9SP1D/Az8A/6nAY8FkgeoBi8EOgLUATIDMQXeBcAEkAIdAD//FgBrAT8CWgHE/iP8g/oE+7r9FwAaAQcA9/w7+kf5c/rS/NH94/xs+0b6EPxRAOcE8AdWB20EEQJNAf0CzQUlBygGeAM9ANz+oP9LAX0C2AGI/7n8HftP+zT9wv8BAZAA3P5y/PT6Bvsz/J/9YP3v+4X6HPqn/PgA5gTwBswFFwPaAeIBnQPKBQEGkwQqAtD/bv9rAKgBLwIgAfz+3/z8+6D8AP5z/x4Apv8I/yD+V/0Q/df8IP06/W/8u/s2+3H8zP9lA+YFAwbbAzwCLgJWA0AF+wXTBMwCmgCO/+//yAA8AYEA6v4s/Wn8w/zH/bX+J//u/pj+jP4F/rv9Of0A/SX9qfzi+yT7TPsF/goCaAWYBuYEugIbAjUDIAUrBlUFCgPJAND/IAAUAZoB7ACR/8v9sPzr/Lj9yf5D/1H/7/5W/jb+1/2t/YT9MP0A/eP7j/rV+V/6ZP0CAtEFAwcUBZMCHgKlA9AFvwaoBUEDfwHuADEBtgF7AZUAdP/x/cP8ZfyO/O/9F//4/8j/sf7R/Xv9m/32/cL9SP1I/LX6yPnX+b77tf/5A4IGjgXrApcBywJGBdMGOQbgA50BDAFtAa8BeQGDAJv/x/6e/aT8k/yM/XD/mADaALn/Rf6y/Qf+qf5X/kj9NPym+xz7sPoH+zP8Sv9AA00GaAZHBK4CPgPoBNgF+wTnAjYBAAFNASMBYwC+/yv/9/7x/Qn95fzv/cj/6AAJASUABf9j/mn+uv5L/pX90PyY/GP7I/qT+c76RP0qAeoEuwaABdEDnANGBbwGSwZiBBwC5wDEAGsA4P9y/3X/LP9s/uD8LvzU/LX+1wCyAYcBcwCI/+7+4P4i/+z+P/71/Mf75/qo+sb6jfuk/Gz+TAEPBeEGzQX3A7EDBAX2BbwE2AL/AIQAQwCa/9L+mv79/mL/2v6a/QX9s/1o/xgBQQF6AMf/mP+X/+r+GP5o/UP95fzs+xv77/qX+yv86fzv/ckAwASkB+cGqASwA8kEMAYWBekC2QAcAPn/lf/l/tT+MP9V/+j+rf0Y/aj9K//cAFABrADM/37/w//4/0j/9f0B/ej8/PxJ/LL7svvI/Hn9Q/2r/OD9GALXBnwI5gWTA9UD1gUMBs4DrwGPAHgAGwBr/x7/w/8qANj/rf6E/bD9S/50/2QAQgExAXkAvP8C/6r+QP6p/en8hfyv/JT8SPww/Nv89/1R/mn9N/2J/70DJAe5BlcEUQNoBI8FbQTAAvEBrQGSAGD/xf6M/2IAFACi/97+Iv9l/8f/sf8mACoBUAFcACv/kv4e/sj9Gv1x/CX8VvyH/K/84/wK/Xz9B/7i/Wz9hP7KAb8FVweCBZYDdwOqBEQELAIkAY8BnQFhAGT/l//oAFIBYQBd/53+kP7W/hf/Uf+T/28AyAAZACz/Sv66/Uz9jv2B/UL9pvxn/KD8Xv2w/cP9tv2c/UD91/1mADUEKgewBsgEvAP7AwIEowLNAcABgAFnAMj/aABSAUsBuQAwAJ//nf7E/W7+jv8eAIj/r/8TAHT/h/4D/vT9D/4s/hT+6f3f/b792P0T/jj+LP76/Yz9/fx6/aL/xgJFBYMFmAQEBIwDBgM4Ak8CpAI4AgsBgwAHAcgBWAHcAFAAsP+N/uL9hP6c/0gACAAAAFEAp/+P/in+Sf7+/Vv9Fv08/Xv9V/1c/b/9EP74/cT9tv3J/fn92f3u/nYBGgSnBTAFvQRlBNgD/QJkAqECgQKYAbgAuQBJAeIABgDX/7P/Av/h/bf9rP7V/0MAJwB9AHMAdP8z/uD93v1k/ff87PxG/X79U/14/dr9C/7q/cv97/1P/nH+Rf64/20CRAUXBlgFqgQwBHkDkAJ1ArcCtALIAdcA5gAVAWYAsP+4/5v/4P78/fj9+/7V/9n/zP9HACcA+P7p/cn91P2L/Sn9Sv1D/Sv9FP1g/cv9Ef42/jb+Rv6B/uv+Kf/s/3EBeAMVBZcFfAUyBb0E4QNAAwADvgINAmcBHwEVAYIA4P/I/5P/2P4Z/tT99v1V/o7+wv45/4v/Kv90/ir+Dv7H/Xz9hf2B/WH9f/2w/f79PP6I/qH+m/55/o/+Zv/5/zEAmgEABHoFXAVMBW0F/ATzA00DDwNuAmMBwgDGALcAEACa/2X/4P4s/p/9cv2L/Q7+xP7k/i//ff84/4D+OP5C/hn+1P3e/ez9v/3I/e39KP5p/qT+yv4A/+b+Qv/P/0UAUQCmAfADOAUBBQUFBgVQBE0DzAKlAhcCTAG1AHIAXAD3/3f/Mv/Q/k3+5v2V/aH9Gv7w/j3/V/+A/3j/2P5h/lv+W/4c/vX9tf1Y/T79Yf3R/Ub+bv4v/lf+6f49/zj/pf+lAGEC2APtBKYFvAVYBa4EHASDA9cCNAKHAeMAkQA+AIj/Sv/4/pr+GP7P/cf93P0w/sL+F/9Y/3X/Xf8X/9/+v/6C/kb+5P2e/VX9Nf1x/c79GP4b/jj+mP7m/v/+R//G/6MA1QHkAgEExAQjBS0FDwWzBBwEcwPIAvwBTgHZACYAk/80/8D+WP7w/ff96f3q/TD+q/7//i3/g/+i/3b/M/8l//z+vf6E/k/+D/7L/b/9/P0z/l7+Vf51/sf+8P4n/4j/BQDjAOcB8ALWA3cEpQS0BIgEGASYA/oCQAJ1AeIAQACk/yb/y/5g/gj+5f3V/cH90P0i/n/+vf7u/kj/cP9Q/0H/Sv80/xP//v7N/qH+dP5d/nz+m/6w/qj+w/7v/gj/Nf9u/9X/kwB2AUUCEAOvA/gDIgQtBCcE1wN9AyQDkwLvAVgBowDf/yH/bv7r/YD9P/0h/SD9M/1q/b39Bf5Q/qr+6/4a/0j/hv+V/5L/kv9t/0r/Gv/r/uL+4f67/o3+k/6u/rT+Df++/2YAIQEQAvECjwMGBHUExgSuBIcEPQS/AxwDRwJlAYgAkP+p/gH+W/3i/JX8cfxz/Kr87fxG/b/9IP6G/v3+bP+4/9j/DAAYAPb/7v/S/6T/cP9V/yD/4P63/q3+ov4B/4T/LQDdANoBqAIwA9EDQwSiBJIEfgRIBNIDQANwAooBlgCR/7L+4/0+/dz8efxI/FL8gfzF/Bj9jf0B/oD+8v5r/7z/9/8YABYAHgAQANH/lf9e/zn/6v7B/q/+x/4l/6r/OwDVAKgBVgLIAjwDqAPxA/YD4AO0A0EDtQIGAkgBiACo/+n+Qv7I/Wv9I/34/O/8B/1A/YP9z/1A/pv+DP9j/6r/8v8WAB4AHgAfAPn/uf9+/1n/KP/6/v7+Cv9H/7j/NACvAE8B+AFtAs0CLQNsA4ADcANSAwMDiwL5AVIBowDt/0P/sf4q/r79Zv1E/TL9OP1a/YL91v0T/mj+yf4T/0j/i/+t/8D/4v/b/9H/wP+3/53/g/+K/5T/tP8MAGEAtQAxAbsBDwJSAqYC2QIBA/AC1wKxAmMC6AFhAdwASwCf/xP/mv4p/tT9iP1W/Ub9Uv1r/Zj94f0y/on+1/4Y/2P/lf+z/+n/AAAAAP7//f8DAPH/7f/2/xMAPACDANAAEwFYAbEB2AEEAicCQwJEAiIC+QG/AXMBLwHIAE4A7f+H/yb/zP6M/lL+I/4Q/gT+Bf4J/ir+SP54/qj+2f4J/zT/dv+c/9T/9P8XACQANwBOAFIAVQBxAJQAsgD8ADkBVgGQAb0BxAHMAcYBsQGRAT4B/QC1AGsACgC1/3z/OP8I/+L+0f7V/sz+xP7Z/v/+Bf8C/yf/Sf81/xv/Lv84/zH/KP8o/0v/Y/+O/77/6P85AHcAxQAfAW0BlgHIAekB4AHcAbkBgAFPAQMBpwBSABoA0f+A/1//Sf8m/xT/E/8g/yv/Qf9O/13/cv9x/3v/bP9S/0r/Rf8p/wD/Bf8F/x3/Qf9p/5n/1v8UAE4AnQDmAAkBMwFTAV0BUgFIATYB/AC4AIQATAAjAO3/x//C/7v/vP+z/7D/rv+x/7b/uf/C/9f/2//j/9D/rP+i/4D/Vv9A/0H/QP9O/2n/iP+v/9T///8lADEAVQBvALEAxgDoAPwA/AD1AM8AqwBuAE8AFwAFAAIA8v8AAP//BwACAPT/2//G/5//h/+E/3b/cv98/6f/rf+g/5b/lf+Z/4j/f/+A/5H/uP/c/xAAMgBAAFgAWABLADUAKwAfADQAOABJAEkATwBJADgALQAsACYALABAAD0AOQAwACcAHgD7/+D/z//F/8D/zv/f/9v/1f/f/9P/zv/E/7n/vv/P/+r/AAAIAAgAAADy/+j/3v/M/8T/0f/y/xYAKQAvADoAMQAmAA0ACwAQAAwAFwArADMAKQAUAAIA9v/l/9v/zf/L/9j/6P/o/+v/4//j/+P/4//g/9j/5f/g/9r/4P/h/9//4P/f/+z/7P8FAAQABQAbACcAHQAfAC4AMAAyADAAMQAlACIAGQAWAAoA/f8CAP//8P/v/////P/w/+v/8//o/+j/3v/f/+f/5f/n/+z/5f/n/+P/6//z/+n/8v/r/+P/6P8DAPj/AAARAAwAEgAGAAwACwAPAAcADQAJAAAA+P8AAAcADAAIAAoAEAAHAPj/AAADAPj/7//5//z/7//k/+7/7P/s/+r/6P/h/+H/5P/p/+f/8v/7//P/AAAQAAYAEgAJABAABgAIAAcAAwAJAAEAAAANAAsADAAOABEACAAGABAACwAFABEACgAVAAgA/v8CAAIA+f/u//H/9P/o//v/9P/x/+7/9P/r/+z/+v/w//n/9//z//f/9//8//z/+//1//P/AgD8//7/AAAAAAAAAAAQABUAEgAKAAMAAQARABQAEAAPAAAAAAAAAPj/6v/0//n/8v/y/+b/7//u/+7/5P/q/+3/7P/s//T/6v/n//f//f/9//T/+f////r/AQABAP///f8BAP7/AwAAAPv/EAACAAUABwAMAPf/9/8EAPv/AgD8//3/+v/2//T/+P/9//f/8P/2//z//P/3//v/+P/z//f/9//6//z/8P/3//H/+/8AAPT/AwAFAAAA/P8LAAcAAgADAAMACAD5/wAAAQACAAAAAAD///7/AAD8//j/8f/w//b/9//y//j/AQD6//D/7f/w//n/AAD4//b/+v8BAAMAAAD2//H/+/8EAAAA+//+/wUABQAKAAUACAAMAAwA//8CAP//AwAEAP//9v8AAPz/+v/3//j/9P/u/+//+f/4//b/+P/7//P/8P/4//b/+P/1//L/9v8FAP3/AAACAP7//P8AAAgABAAHAAYABgAEAAAA/f/+/wIA+//4//j/8v/7//z/8f/0//r/8//z/+3/6P/l//r/+P/4//z/+f8BAAAAAAADAPj/+v8BAP7/+f/9//3/AQD4//7/AgD+/wAA//8CAP7///8BAPz/AAACAAIAAAD3//n///8AAAIA//8DAP7//f/8/wIA+v///wgAAAAAAAMAAwAEAP3//P8LAAQA///+//n/+P///wgA+//7//j/+//8//b/9//3//f/7//3//v/+f/0//v/9v/+//3/AQD4//f//P/9/wMAAAABAP//AAAHAP7///8IAAUAAwAMAAgAAgAAAPv/+v/+/wIA/P/9//b/9//3//r/+P/3//3/+v/4//j/8//t//P/9v/4//b/8f/3//j/8//4/wMA9//7//r/9v/8//f//v8DAP7/AQD+//3//v8BAAAAAQAAAAAA9f8GAAgA/P8AAPr///8CAPz/+//0//r/+f/0//f/+v/1//n/8v/7/wMAAAD3//3/AAAEAAAA+f8EAAIAAQD8//3////9/wAAAQAGAP//AAAAAAAA/P/+/wAA/v///wEA///5/wMA/v8AAP3//v/9/wEA/f/7/wEAAwADAAAABwAAAAAAAgAFAPv/9/8CAAUAAAAAAPn/AgD9//b/BgAIAPv/+f/+/wAAAgAAAP3//f8AAPz//f8FAPr//v8GAP7/AAAEAAAABwACAP3/AAD+/wgA+//9/wAA/P8AAPf///8DAP//AAD//wEA/v/9/////f8CAAYAAAD+//j///8AAAMA/f/5/wUA9//7/wMAAwABAPj//v8CAAIA+/8GAAIABAD7////BwD+/wEAAAD5/wMA/v/6//v/+v8FAAAABgAAAPf/AAD+//3/BAACAAAA+v8AAAYA/P8AAAMA+P/+/wQAAAD7/wMAAAAAAP//AgAAAPz/AAAAAP3/9v8AAAYA/P/9//z/AwAAAPz/AgD9//7////+//v/CAAGAP//AQD//wIAAAAAAP3////6//n///////3/+f/9/wIAAwAAAPb/BwD8//z/AwABAPb/+f8CAAEABgD8//7/AgAEAAMAAgAJAPv/9v8AAP7/BAACAPn//P8AAAMAAgAAAAMA+f/7/wUA+v8AAAAA/P8BAP//9//5/wcAAAADAPn/BwABAP//AQD7/wcA/P/8/wMAAQD3////BgABAAAA//8MAPz/AAACAPj//v/8/wAA+P8MAP7/+P/+/wQAAAD2//v/AgAFAAAA+f8HAAYAAAAEAPr/BQD3/wIA/f/3/wQA+P/5/wAABwACAAAAAgAEAPT/+v8AAAEA+/8AAAAA9P///wMA+f/8/wgAAAABAPr/BAD///P/BwAEAPv/AAAAAP////8AAAcA+////wIA/v/7//z/AQAEAAQA+v8AAAsA+f/5/wYA+//7/wAAAAD6/wEA+/8FAAMA/f8DAAAAAgABAP3/BgD7//f//v8LAAQA+f/4//7//v8AAAEA+//4//z/CgD8/////f/+/wAAAQAAAPn/AwAAAPz/+/8DAAEA/v8AAAkAAgD4/wAACAACAPH/AAAGAAIA/f/5//v/+v8AAPz/AAD///v/BAD9/wAAAwAAAAMACwD4/wMACgAFAPn/+P8QAAIA+f/6/wEA///9//3/AAD8//f/AQAFAP3//f/+/wAA/f/9/wEA///5/wUA///5/wcABgADAAAABgD8//j/AgADAAkAAAACAAAA/P8EAAMAAQD9//v//f/5//j/AAD5//n/+P8BAP3/9f8HAAAAAAAJAAMABAAAAAYAAwD9//n//v8DAP7/+v8CAAIA+/8LAAQA8v/+/wMABQD7//v/DAD///n/AAD6//r////+/wUA+//9/wIAAAADAP3//f8EAAEA/f/9/wAAAgABAAMABgD///z/AAAKAPT////7//z//P/6/wMAAgADAAAAAgD9//r/EAD2//f/CgAAAPb/AQAMAAQA+//+//7/AQD+///////7/wAA/v/9//7/AAABAPv/AAAAAP//+f/6/wIAAgAAAAAAAAD9//3/AgACAAEACAD6/wIABQAAAAAAAAAAAAAAAAAAAAUABQD//wUAAwDx/wAACwD2//P/AAAAAPX/9/8IAAQA/v///wYA+//7/wYAAAAAAP///v8KAAAA9f8AAAAACwD5//n/CwD//wAA+v/7/wAA+v8AAAUA+P8FAAAA+v/6/wAABQD5//n/BAAEAPj/BAAAAPr/+//9/wIABAAEAAQABAAFAAkA/v/3/wIA+/8HAAEA9//5//L/AAAEAP/////6//r/+/8AAPr//P8BAAEACAAAAP3/BgAFAAAA//8EAAsA/P/6/wkA/f/8/wIAAQACAP3/9//3/wAA+f/5/wAAAAD6//r//P8IAP//AAD3//3/CAABAAgABQAAAAUABQAFAAAAAAAAAPn/+v/6/wYA+v/5/wYAAAAAAAAAAAAFAP//BQAFAPn/AAD6/wAA+v/z/wIABQD6//3//f8IAAUAAAAFAAAAAAAAAAUABQAAAAIAAgACAAIA/P/9//f/9//6//n/+f8AAPn/AAAFAAAA+f8AAAYA8//9/wgAAAAAAAAABQAFAAAABQD6//r/AAAAAAAA+f8GAAAAAAAFAAAAAAAAAPr/+v/5//3//f8CAAIAAgD9/wIACAAAAAAAAAD6/wIAAAAAAAAAAAAAAAUABgD0//r/BQAFAAUA+f8AAAUAAAAAAPr/AAAFAAUA/P/5/wAAAADz/wAAAAD5//n/AgAFAAAA+f8FAAUAAAAAAAYA+v/z/wUACwD5//r/AAAAAAAAAAAAAPP/BgAAAPn/BQAAAAAAAAAAAPr/AAAFAP//+f8AAAAA9P/3/wIA/P8CAAcAAgACAAsA8//9/wsAAAAAAAUABQAAAAYAAwDw/wAAAAAFAPn/+f8AAPP//f8FAAAA+f8FAAYA+v8AAAUA//8FAAAA+v/6//r/9v8IAAIAAAD9//3/CQACAAUAAAAAAAUABQAFAAIA9v/6/wAAAAD5/wAA+f/5/wUA+v/t//3/AgACAAIAAgACAAgADAAFAAAADAACAP3/CAD8//b//f8CAPb/8v8FAAAA+f8FAPr/8/8AAAUAAAAAAAAA+v8AAAUABQAAAAAAAAD6//n/AAAMAAUA+f/5/wwABQD5//n/DAAAAPn/BgD5/wAAAAAAAPn/+f8AAAAA+f/9/wIAAgD8//z/DwAFAPP//f8CAAkAAAD8/wUADAD6//P/BgAFAAAAAAAAAAYAAAAAAAwA/P/9//3//f/9//n/+v8EAPn/+f8GAPL/+f8CAP3//f8CAA8AAAAAAAAADAAMAAIA/f/9/wIAAgD2//b/AgACAP3/8P/z/wAABQAAAPn/+f/6//3/AgD8/wIAAgD2/wIACQACAP3/AgACAAgABQAAAAAAAAAAAAAAAAAAAAUAAAAAAPP/8/8IAAUA8//9/wIAAgACAAUAAAAFAAUAAAAAAPn/AAD5/wAAAAAAAPr/+f8AAP7/AgACAAsAAAAAAAUAAAAFAAkA/f/9/wkA/P8CAPz//f/9//D/+f8AAPn/+f8AAPD//f8PAAIABQAAAPn/DAAMAAAA8//5/wYAAAD5/wAABQAAAAUAAAAAAAAAAAAFAPn/AAAFAAAA+f/6//P/AgAMAPn/+f/9//3/AgACAAIACAAMAAwAAAAAAAAAAAAAAAAABQD8//3/+f8AAAAAAAAAAPn/+f8FAPr/8/8CAPz/CQAFAAUABQAGAPn/BQAFAPn/+f/z//n/AgACAAUAAAAAAAUAAAAAAAAAAAAFAAwAAgD9//3//f/2/wIA/P/5//n/8//5/wIA/P/8/wIAAgD9/wIACQACAAUAAAAAAAAAAAAFAAAA+f8AAPn/+f8CAAwAAAD5/wUABQAAAPP/+f8AAAAABQD4/wYAAAD5//L/BwAFAPr/AAAAAAAAAAAFAPn/+f8AAAUAAAAAAAYA+f/5/wUABgAAAAUAAgD8/wIA9v/8//n/AAAAAPn/+f/5/wAAAAD2//z//P/2/wIACQAJAPz/AgACAAkADAAAAAUABQAJAPz//P/8//z/AgD2//b/BQD5//P/AAAAAPn/+f/2/wIACQACAPz/CQAAAAUABQAAAAUABQAAAPr/+f8FAAAA8/8AAAsAAAAAAPn/+f8FAPn/AAAFAAAABQAAAPn/+f/5//z/AgAFAAAA+f/8/wIABQAAAPb/AgAJAAUADAAFAPz/AgD8//z//P/5/wAA+f/5/wUAAADz//n/BgAAAPn//P8JAAAAAAAAAAUABQD5/wAAAAD5/wUABQAAAAAA+f/5/wAADAAFAAAAAAAJAAIA/P8IAP3//f/8//b/9v8AAAAA+v8GAPr/AAAAAPn/AAAFAPn/+f8AAAAABQAFAAAAAAAFAPn/AADz//z/BQD5/wYAAAD5/wUAAAAAAAYAAAAFAAAA+f8FAAAA+f8AAPn/+f8AAPn//P8JAAUABQD5//n/AAAFAAwAAADz/wAADAAFAPn/8/8AAAAABQAAAAUAAAD5//n/AAAFAPn/BQAAAPn/AADz//b/AgADAP3//f/9/wMAAwACAAIA/f8QAAwA+f8FAAAA+f8AAAAADAD5//n/+f8AAAUA8/8AAAwAAAD5/wAAAAAAAAUAAAAAAPn/AAAAAAAAAAAAAAAA8//2/wIACQAAAAAADAAAAAAABQAFAAIA9v/5/wAA+f8AAAAAAAAFAAAA+f/5//P/AgAFAPn/9v/8/wkADwAGAPn/AAD5//b/DgAGAPr/AAAFAAAA+f8AAAsABQD5/wAABQACAPb/8/8AAAAA8/8AAAAAAAAAAPb//P8JAAkABQAFAPn/+f8MAAUAAAAAAAAA+f8FAAAAAAAAAAAABQAAAAAAAAD5/wAABQAAAPn/AAAAAAAAAAAFAAAA+f8AAAUAAAD5//n/BQAAAPP//P8CAPz/CQACAPz/DAAFAAUA+f8AAAUABQDy//P/BgAAAPn/+v8CAP3/AwAIAAAABgAAAAAAAAAFAPn/+f8AAAAA+f8AAAAAAAD5//z/AgACAAIABQAFAAUABQAAAAIA9v8AAAkA/P/w/wUAAADz/wAADAD5/+z//P8CAAIA9v8CAAkAAgAFAAUABQAAAAYAAAD5/wAA+f8AAPn/+f/8/wkAAAAFAAAA+f/5//z/CQD8//z/AgACAAIAAgACAAAA/P/8/wkAAAAAAAAABgAAAAAA+f/5/wwABQDz//P/BQD5//z/AgD8/wIACQD8//b/AgACAAIAAgD8/wkADAAAAAAA8//2/wIAEgAAAPP/AAAAAAUAAAAAAPn/AAD5//b/CQAAAAwAAADz//n/AgD8//z/CQASAPn/+f8AAAAABQD5//n/AAAFAAAA+f8AAAAA+f8AAAUABQAAAPn/AAAAAPr/BQATAP3/9v8AAAAAAAAGAAIA/P/2/wAACQD8//D/BgAAAPP/+f8FAAYA8//5/wUA+f8AAAUABQASAPz/9v8JAPz/9v8AAPn/+f8GAAUAAAAFAAAAAAAAAAAAAADz/wUADADz//n/AAAAAAAAAAD5//z//P8CAAIAAgAJAAUABQAFAAAAAAAAAAUAAgACAP3//P8CAPz/9v/8/wIA/f/2/wAA+v/5/wAAAAD5//b/AgAJAPb/9v8JAAkAAgAMAPn/+f8SAAAAAAAFAAAAAAAAAAAAAAAFAPn/8/8AAAAAAAAFAAAA+f/5/wUAAAD5/wAAAAAAAAAA+f/2/wIADwD5/wAADAAFAPn/+f8AAPn/BQAFAAUAAAAAAAUAAgD8//b/AAAAAAAA+f/5/wAAAAD5//n/AgAFAAAA+f8FAAAABQD5//r/AAAAAPr/AAAFAAAAAAAAAAAADAAAAPP/AAAMAAUA/P/5/wUAAADz//n/+f/8//z/AgAJAAAA/P8CAPz//P8JAAkAAAAAAAAAAAAFAAAAAAAAAAAA+f8AAAAABQD5//n/AAAAAAwAAAD5/wUAAAD5/wAAAADz//z/BQD2//z/AgAJAAUAAAD5/wAABQD5/wAABQAAAAAAAAD5//r/BgAFAAYABgAAAAAAAAAAAAIA/P/8//z/AgDz//n/AAD5//n//P8FAPn//P/8/wkADAAAAPn/+f8CAAYAAAAAAPn/9v8PAAYAAAAAAAAABQAMAPz//P8CAPb/AgD8//P/+f/z//z//P/8/wkACQAAAAAABQAAAOz/AgAMAPP/AgACAAUADAAAAAAABQAAAPn/AAAFAAkAAgD2//3/CAD8//b//f/2//n/+v8AAAAA+f/5//z/AgACAAIA/P/8/wkACQD8/wwABQAAAAUAAAAAAAUAAgD2//n/BQACAPn/AAAAAPn/+f8AAPn/+f8CAAIABgD5/wAABQD5/wAA9v8CAAkADAAAAPn/BQAAAAUABQD5/wAABQDz/wYAAAAAAAAA+f8AAPn/+f/8/wIAAgAFAAAA8/8JAAwA8v/1/wIAAgAIAP3//f8HAAAAAAD6/wIABQAFAAAABQAMAAkA9v/w/wYA/P8CAPz/AgD8//b/+f/z//n/+f/8/wIAAgD8//z/AgACAAIACQAFAAYAEgAPAPz//P8CAAIA/P/9//z//P/2//D/+f8AAPn/AAAAAAAA+f/2/wkA/P/2/wIACQACAAIACQAFAAAAAAAFAPn/AAAFAPn/AAAMAAAA+f/5/wAAAAAFAPn/7f/9/wMAAgD9//3/AgAJAPz/AgAJAAAA/P8FAAAA9v8JAAAA+f8FAAAABQAAAAAAAAD5/wAAAAAFAAUAAAD5//n/BQAMAPz/+f/5/wYABQD5//n/+f/z/wIABQAAAPn//P8CAPz//P8JAAIAAgAMAPn/AAAFAPn/AAAFAAwA+f8AAAAA+f8FAAUAAADz/wUAAAD5/wAABgAAAPn/AAAAAAYA+v/5/wAAAAAAAPn/AAAFAAAA+f8FAAUAAAAAAAUACQACAAIA/P/8/wIA/P/8//z/8P/5//n/AAD5//n//P/8/wIACQACAAUAAAAAAAAA8/8CAAkA+f8CAAUAAAAAAAUAAAAFAAYAAgACAPz//P/9//b/+f8AAPP/8/8CAAIA/P/8/wkA/P8CAAkAAgAFAPn/AAAFAAAA+v/5/wAAAAD9/wUABgAAAAAA+f8AAAAAAAAFAAAAAAD5//n/+f8AAAUAAAAAAAAA+f8AAAAA+f/8/wIABgAAAPn/AAAMAAUAAADz//n/DAD5/wUADAACAPz//P/8//z//P/5//P/8//8//z/AgAJAPz/AgAJAAAAAAAFAAUABQAAAPP/AAAFAAAAAAAFAAUA/P/5//n/AAD5//n/BQAAAPr/BQD6/wYA+f/y/wsABQAAAPn/AAAAAAAAAAAAAAAAAAD5//n/BQAFAAAAAAAAAAUAAAD5//n/8/8CAAUAAAD5/wAADAD5/wAABQAFAAUA8/8AAAwAAgD2//n/+f8FAPn/8/8AAAAAAAD5/wIAAgAFAPn/BgAMAPP/AAAFAAUAAAAFAAAAAAAAAAAA7P8FAAUA8/8AAAwABQD5/wAABgAFAPn/8v/5/wAAAAAAAAAAAADz//z/CQACAAUAAAAAAAAADAAFAAAA+f8AAAUACQAJAPb/9v/8//n/+f8AAPn/AAAFAPn/8//8/wIA/P/8/wkACQACAPz/AgAFAAwA+f8AAAAA+f8AAPn/BQAFAAUAAAD5//n/AAD5//n/AgAAAAUAAAAAAAAAAADz//z/AgACAAIABQAFAPn/AAAAAAAAAAAAAAUABgAAAAAAAAD6/wAABQD5//P/BQAAAPn/AAAAAPn//P/8/wkAAgAAAAUA+f8AAAUAAADz/wwADAD5/wAAAAAAAAAABQACAPz//P/5/wAAAAD5/wUAAAAFAPP/AAAAAPn/+f/w//z/AgAPAAIA9v8CAAIA/P/8/wkADwD5/wUABQD5//n/+f8FAAAAAAAFAAAABQAMAPb/AAD5/wUAAADy/wYABgD5//n/+v/z/wIACAAAAPn/AgAAAAAAAAAAAAUAAAD5/wUADAAAAAAABQD5//n/AAD5/wAADAAJAPb/+f8AAAAA+f/5/wAA+f8AAAAAAAD5/wUAAAAMAAUA7P8AAAAA+f8AAAAAAAAFAAAAAAAAAAAAAAAFAPn/AAASAPz/+f/5/wAA+f/5//n//P8JAPz/9v8CAAIA/f/8/wMACQACAAcAAAAAAPr/9v8JAAUABQAAAAAABQAAAAAABQAJAPz/9v/8//n/+f8AAAUAAAAAAAUAAAAAAAAAAAD5//n/+f/5//b/AgAJAAIABgAFAAUA+f8AAAAAAAAFAAUAAgACAPz//P/8//P/AAD5//P/AAD8//b/CQAJAAUAAAAAAAAAAAAAAPn/AAAMAAAAAAAAAPn/AAD5//n/9v/8/wkA/f8CAAMADwAFAPn/8/8CAAUA+f8AAAAABQAAAAAA+f8AABIA+f/5//n/AAAAAPn/+f/9/wIAAgACAAUAAAD5/wwABQD5//n/BQAFAAAAAAAFAPn/AAAAAPn/BQAAAAAA+f8FAAUAAAAAAPn/AAAAAAUAAADz/wAABQAAAAAA8/8AAAUA+f8FAAAAAAD5/wAABQD5/wUAAAAAAAUABgAJAP3/9v8DAPz/8v/z/wAA+f/8//b/CQACAPz/CQACAAUAAAAAAAUAAAAAAAUAAAAAAAUAAAD5/wAA+f/z/wAA/P8CAPz/AgACAAkAAAD5//z/DAAAAPn/DAD5//n/BQAMAPn/+f8FAPn/+f8MAPn/+f8FAAAAAAAAAAAAAAAAAAAAAAAFAAAA+f8AAAAAAAD5/wUAAADy/wAAAAD6/wMAAAAAAAAAAAALAAAAAAAAAAAABQDz/wAAAAAAAAAA+f8AAAAABQAAAPn/AAAFAPn/AAAAAPn/+f8CAAAA/P8JAAAA+f8CAAAA/P/8//z/AgACAA8AAAAFAAUA+f8MAAIA/P/8//z//P/5//n/AAAAAAAAAAAAAAAA+f/5/wAADAAAAPn/+f8MAAUA+f/5/wAABgAAAAAA+f/5/wAAAAAFAAAA8/8LAAUAAAAAAAAABQD5/wAABQAAAPn/BgD5//n/AAAAAAUABQAAAAAA+f/5/wAABQD5//n/BQAAAAUAAAAAAAAAAAAFAAAAAAD5/wAAAAAFAAUAAAD5//n/DAAFAPn/+f8FAAUA+f/5/wAA+f8FAAUAAAD5/wAABQAFAPn/+f8MAAAA8//5/wUAAAD5/wAAAAAAAAAA+f8GAAAA8/8JAAYA+f8AAAAABQAAAPP/BQAAAPn/BgAAAPn/AAAFAAAA+f8FAAUABQD5//P/BgAFAPn/+f/5//z//P8JAAUA8/8CAAIAAgAFAAAABQAAAAAAAAD5/wUAAAD5/wAABQAFAPn/BQAFAPz/+f/5/wAAAAD5/wAA+f8AAAUA+f/5/wAADAAAAPP/DAAAAAAABQAFAAIA/P/y/wAAAADy/wAABQALAAAA+v8AAAUAAAAAAAAABQAAAAAAAAD5/wAAAAAAAAAAAAD5/wAAAAAAAPn/AAAFAAAA+f8AAAAAAAAFAPn/AAAAAAUADAAAAPP/BQAMAPn/AAAAAPn/+f8AAAAAAAAFAAAA+f8AAAUA8//5/wUAAAAAAPn/AAAAAPn/AgD8//z/AgACAAIAAgD8/wIACQAAAPz/DAAFAPn/+v/5/wAAAAAGAPr/AAAFAPn/AAAFAPn/AAAAAAAABQAAAPn/+f8AAAUAAAD5/wAAAAAAAPn/AAAMAAAAAAAAAAUABQD5/wAAAAAAAAUAAAD5//n/+f8FAAAA+f/5/wAA/P/2/wIAAgACAAkABgAAAAUADAAAAAAAAgD8/wIACQD2//z/AgD2//b/AAD5//n/BQAFAAAA+f8AAAAA+f8AAAAAAAD6/wAABgAAAAAA+v8AAAsABQAAAAAA+f8AAAUAAAAFAAAA8//5/wAAAAAAAAAAAAAMAAwA/P/8//z//P/5/wAADADz//n/+f8FAAAA8/8AAAAABQAAAPn/AAAFAAUAAAAAAAAA8/8AAAUAAAAAAAAAAAAAAAUABQAFAPz//P8CAAIA/P/2//P/+f8FAAUA+f8AAAAABQD5//n/AAD6/wAABQAGAPn/BQAGAAAAAAAAAAAABQAJAPz//P/8//z//P/5//n/AAAAAAAA+f/5/wUAAAD5/wAADAAAAPn/+f8GAAAA+f8FAAAABgD5//n/AAASAAUA8/8AAAAABQAAAAAAAAAFAAIA9v/5/wAAAAD5//n/+f8CAAAA/P8CAAkAAAAAAAAAAAD5//b/CQAFAAUABQAAAPn/AADz/wAABQD5/wUAAAAGAAUABgACAPb/AAACAPb/+f/5//P/AAAFAPn/AAD5/wIAAgACAAUAAAAFAAUABQACAPz//P8CAPD/BQAPAAIA9v/w/wIAAgD2//n/AAD5//n/+f/8/wkAAAAAAAAABQAAAPP/AgD2/wkACQAAAAAAAAAMAAUAAAAAAAkA/P/8/wkA/P/8//b//P/5/wAABQAAAPn/AAAAAAAAAAAAAAAABgAAAPn/+v/5/wUABQD5//n/BQAGAPn/+f8FAAUA+f8AAAUAAAAAAAAAAAAMAAAA+f8FAAAAAAAAAAAA+f8AAAUAAAAAAAAAAAAAAPn/+f8AAPn//P8CAAkAAAAAAPn/AgAFAAAABQAFAPn/BQAMAPz//P/8//z/AgACAPD/BQAJAPz/8P/5//n/8//8/wIAAgD8/wkAAgAFAAUAAAALAPn/CwADAPb/+f8AAAwAAgD2/wIA/P/2//n/BQDz//P/BQAAAPn/AAAFAAAAAAAAAAAAAAAAAPn/BQAAAPn/AAAFAAAA+f/5/wAABQAFAAAAAAAFAAwA/P/2/wIA+f/5//n/8/8CAAwABQD5/wUA+f8AAAAA8/8FAPn/BQAAAPn/AAAAAPn/BQAGAAUABQD5/wUABQACAAIA/P/2//3/+f/5//r/AAAAAAAA+f8AAAAA+f8FAAwA8//5/wAAAAAFAAAAAAAAAAUAAAAAAAUAAAD5/wUADAACAPb/+f8JAPz/9v8AAPn/+f8MAAAA+f/5/wAAAAAAAPn/+f8MAPn/AAAAAPn//P8CAAwAAAD5/wAAAAAAAAUABQAAAAAAAAAAAAAA+f/5//n/BQAGAPn/AAAAAOz/AgAIAAAA/P8DAAIABgD6//b/CQAGAPn/AAAAAAAABQAFAAAAAAAFAAAAAAD5/wAAAAAAAAUAAAD5//n/AAAAAAUABQD5//P/DAAAAAAAAAAAAAAA+f8AAAAAAAAAAAAABQAFAAAA+f8AAPn/+f8FAAAABQAAAAUAAAAJAAIA9v/8/wIAAgD2//b/AAD5//n/BQAFAPn/+f8AAAUA+f8AAAUABgD6/wAAAAAAAAAAAAAFAAAAAAAFAAUAAgDz/wAAAAD5/wAAAAAAAAAAAAAAAAUA+f8FAAUA+f8AAAwAAAD5/wUA+f8AAAAAAAAAAPn/+f8AAPn//P8JAAAA/P/8/wIAAgAJAAwABQAFAAAAAAACAPz/8/8AAAUAAAD5//n/AAAAAAUA+f/5//b/AgAJAPb//P8JAAIA/P/8/wkAEwAFAPn/AAAFAPr/+f8GAAAABgAAAAgA/f/y/wAAAAAAAAAA+f8AAPn/+f/8//z/DwAFAPn/+f/8/wIABQAAAAAAAAAAAAAAAAAFAAUAAAAAAAAAAAAAAPn/+f8FAAAAAAD5//P/9v8CAAkACQD5/wIAAAAAAAUAAAAFAAAAAAAFAAAAAAAAAAUAAgD8//z/AgD8//z//P/2//n/+f/5/wAA+f/9/wIACAAAAPb/AgADAAMACQAAAAAABQAFAAUA8/8AAAUA8//5/wUABQAAAAAAAAD5/wAAAADz/wIABQD5/wAABQAFAPn/+f/5/wIAAAAAAAAAAAAFAAAAAAAFAAwA/P/8//z/+f8AAAAAAAAFAAkA9v/z/wAA+f8FAAAAAAAAAPn/AAAAAAAAAAAAAPn/AAD2//z/DwD2//z/AgD8/wkAAgACAAsABQAAAAAABQAAAAAAAAAAAAUA/P8AAAAAAAD5//n/+f/5/wAABQAAAPn/AAAFAPn/AAD5//z/CQAMAAAA+f8AAAwAAAD5//n/BQAFAPn/+f8AAAAAAAAAAAAABQD5/wUAAAAAAAAAAAAAAPn/+f/5/wAAAAAFAAUAAAAFAAAAAAAGAAAAAAAAAAAA8/8AAAUA+f8AAAAAAAAFAAYAAAAAAAAAAAD5//r/CwAFAAAA+f/5//n/BQD5//D/AgACAAkA/P8CAAkAAAAAAAUAAAAAAAUABQAJAPb/AgACAPb//P/8//n/+f8AAAAAAADz//n/AgACAPz/CQAAAAAABQAAAPn/AAAMAAAA8/8FAAwAAADz//n/BQAFAAAAAAD5/wAAAAAAAAAAAAD5//n/BQD5/wAA+f/2/wgA/f/2/wIADwAFAAAAAAAAAAAAAAAAAPn/DAAFAAAADwD8//b/9v/z//n/AAAFAPn/+f8AAPn/BQAFAPn/+f8AAAAAAAAAAAUAAAD5/wwABQAAAAAAAAAAAAAA+f/5/wUA+f8AAAAA+f8AAAUABQD5/wAAAAAAAPn/AAD5/wAAAAAAAAUA+f/5/wAABQAAAPn/BQAAAPn/AAAFAAwA+f/5/wsA+f/y/wsACwACAP3/AwD8/+//BgACAPb/AAAAAPn/+f/5//b/CQAFAPP//P8CAAkABQAAAAAADAAFAPP/AAAAAAAABQAFAPn/AAAAAAAABQAAAPP/+f8AAAUAAAD5/wAAAAD5//b/AgAJAAIA/P8CAAUAAAAAAPn/BQAAAAUAAAAFAAAA+f/5/wAABQAAAAAA+f8AAAAABQAFAPn/AAAAAAYAAAAAAAUAAAD5/wUA+f/y/wYAAAAAAAAA8//w/w8ABQD5/wIABQAFAPP//P8FAAwAAAAAAAYA+f8FAAUA+f8FAAAAAAD5//P/+f/8/wIA/P8CAAIAAgAJAAUA+f8FAAwAAAAFAAIA/P/8//z/AgD8//z/9v/5/wUAAAD5//n/BQD5//n/DAAFAPn/8/8FAAUAAAAAAAAA+f/z//z/AgACAPz/AwADAAIABwAFAAYA+v8AAAUA+f8FAAAA+f8FAAAAAAD5//n/BQAAAOz//P8CAPz/AgACAAIACQAAAAUADAAMAPb/+f8FAAAAAAD5/wAAAAAAAPn/AAAAAAAABQD5/wAAAAAGAPn/AAAAAAAA+f8AAAAAAAAAAPn/AAAFAAAA+f8FAPn/8P8JAAIA/P8PAPn//P8CAPz/AgACAAIABgAAAAYACwACAAIA9v8DAPz/9v8AAPn/+f/5/wAA+f8AAAAA+f8CAAAA/P8CAAwA+f8AAAUAAAD5/wAAAAAFAAUAAAAAAPn/+f8AAAUA+f/z/wIABQAAAAAAAAAFAPn/AAAFAAAA+f/5/wAAAAAAAPn//P8CAPz/AgAMAAAA+f8FAAAAAAAFAAAABQAFAPz/+f8FAAIA/P8CAPb/+f8AAAAA8v/z/wUABgD5/wAAAAAAAPn/7f/8/wkAAgD8/wIACQACAAAABQAFAAAA/f/5//n/BAAAAAAA+P/5/wAA+P8AAAUA+P/5//n/+f/5/wIACgD2//z/AgAEAAkACgD2/wIAAgABAPr//f8MAAUA+P/9//T/4f/9/+z/9P/q//z/4//5/w0A6f/5//H//P/0//b/AQACAPn/9P/0//j/+v8CAAUABQBAADYAMAA4AHUASgA9AC0AKgAUAL3/2v96/3T/PP9C/xT/Jv8U/zT/cf+Q/8j/6/8YAEAASwBsAEkAVABSAA8A5P80AK7/HgA0ABgAyADQAOEAkAG5Af4B9gG5AeABvQEoAcEAXgDw/zj/kf4p/q79K/3g/L38sfzQ/Nn8Cv2d/bz9ZP6R/7T/SQAgAd0BJQJlAj0DqgOMA3MDaQMgA2kCtAE4AXoAo//v/qL+Ov79/dL97/0k/lD+oP4C/2j/mP+3//r/HAAAAPD/6P/a/73/uP/a/9r/KABSAIAA4AAgAVABhwHdAd8BpgGWAWgBCAGeAAoAxf88/8D+nf5j/mj+KP4n/lf+Yv5H/l7+pf60/t/+P/9y//j/aADaAE8B5gFXAqoC4AL5At8CkAI6AqoBKAFTAL7/IP+S/gz+kf2O/W39WP2l/ez9Sv5l/oX+xv7t/vn+5f4d/+v+GP9W/1v/2P8vAIgAEAGDAQMCbwK+AvgCFAMWA/oCwAJwAswBWQHPABoAg/8n/7f+aP4z/in+MP4V/hj+Nf44/jn+Rf5c/mv+kf7K/vj+XP+q//X/VwCyABMBiAHzAT4CpQLhAgMDGQPlAqACKAK1AQABWADG/0b/zP5k/jT+HP4E/tj9zv3P/cP9y/2//e792P3s/Rz+Vf6q/v7+af/2/1oAxgBmAdsBQAK4AgADUwNqAzMD9gKhAjoCggHfAEwA0P9Q/9D+wP5s/kb+Jf4w/hD+8f3r/fP9C/4N/kP+V/5Z/ov+wP4R/z3/lv/+/2IArQAbAZkB9QFZApsC2gIGA/sCvAJ7Aj0CzQEuAa8AUADz/3D/LP/d/qv+dv4z/iz+FP7+/Qz+Fv4t/jb+OP5e/oz+rv7V/gf/Sv+o/+n/PwCvAA0BdgG4AQ8CRgJpAnICWAJgAiECvQFlASEBuwBQAPD/hv8///f+u/6A/kP+Pv44/hv+MP4v/jz+MP5X/oD+of7Y/gT/T/+4/+f/UACxAA8BbQGqAQACPAJWAmECaQJfAicCzwGGAUAB3AB6AB4Atv9Q/w7/tv5+/lT+Nf5D/in+Mf5P/j7+a/57/oX+tf7U/gr/JP9n/6j/1v8oAHMAxwAKAUsBlwHUAQACCwIdAh4C/wG7AX0BTAEAAakAWAAGAK3/cP81/+D+2P60/on+g/5z/nH+b/6A/on+kP66/sD+5v4e/0n/gv+9/wsAOACAAMgAAAFYAYsBwwHoAQYCFQISAgsCxgGxAW0BLAHhAJgAOQDy/7P/R/8K/+T+o/53/mL+SP42/jz+ZP5u/pj+zv7y/kD/lf+4/wIAQABwAKMA0wDzABsBPgFWAV4BVgFuAUgBMgEGAeoAuACAAEwAGADg/53/d/8x//v+4P7q/p3+mv6m/qH+rv7O/v/+GP9K/3X/pf/w/x8APABvAJkArwDIANkA5wAEAf0A9gD9AOQA6QC/ALcAkgB8AEoAJwAHAN7/tf9//13/OP/7/gz/Cf/j/uP+6f78/gT/IP9Z/1f/jv+o/9v/CQAoAD0AcACAAJsApQDCAMoA3ADhAOEA0ADEAMwAtQCeAIAAWQA9ABgA9//O/6j/oP94/1P/O/8F/xX/C/8R/xf/L/8s/zT/Uv+G/4v/rP/j//f/FgAvAFIAggCAAIkArwCrANEAzwDQANIAuwC6AKAAjAB5AGoATwAtAPT/+P/c/9//pf+W/3j/Sf9e/1//Rf9M/z3/Tf9R/27/fP+L/7r/wv/C//r/BgAwAEgAUAB1AIMAmQCiAKgAugCkALMAmACRAIYAWwBRAC8AAgD5/9X/0v+x/6v/kP+A/2j/Zv9g/17/U/9g/17/Y/+C/3r/sv+8/97/4f8GACQAUACAAHsAeQCfAJAAnQCOAI4AeQB2AGcAQwA7AD0ADwARAB4A+P/v/6//6f/U/4r/tv+d/47/e/+A/1b/bf9t/4D/qP9z/8z/tf/t/xMAOAA9AEQAdABYAG8AdgCcAIEAfgCKAHMAYwBqAEkASQBLADAA6v8OAAEAov+4/6f/if93/2b/aP9Q/zv/Yf9t/0//g/+P/53/1P/4/wgABAA+AGIATAB0ALMAegC3AJwAoACQAIwAfQBlADcASQANAPf/AwC4/6H/av9s/1n/Nf9A/z7/C/8m/0D/P/9V/2f/jP+u/+T/BgArAEwAigDIALkAGgHnAAkBAgHgAAEBywDCAK4AUABUACsA8P/W/87/lf8y/33/M//7/uH+Dv/j/tj+C/9N/w3/Qv+R/6L/uP8HADQAZACZANQA6AD9ACABYAFLAWMBKgEoASYB0QDQAI4AXAAkALr/sf92/w7/Iv8I/8j+g/54/pD+kv6M/sL+5/7w/mX/bf+9//X/UACFAKkA/wAvAVEBgAGgAXwBdgGFAYEBUgEnAb0AkwASANz/pf/l/nn/Gf+4/lf+M/5Q/hj+W/7S/qP+4f4C/27/rP+o/0wAvwCLAPMAYAF7AX0BmgH1AbUBYAGRAXcBJwEBAb8AoAARAKv/xP8K/8T+4P6N/i7+Av4a/if+s/0O/hn+C/5H/kD+/P4f/4L/TADAAC0BnQErAmcCcAKYAsMCnAJTAjACzQGKAc0AnwA0AKv/a/8n/7n+a/4z/gr+uf2I/Xz9OP2A/Vf9ff3N/QP+i/4y/8j/eAAtAeoBhQICA08DkAO5A3YDRAPNAk8C4QEjAccAKQDR/0z/NP+7/oz+Z/4g/t79pv2M/Qz9GP2B/LD8kvzQ/G39+v2Y/qv/kACTAbACVwMPBFUEpQSOBDIErwPfAmMCfAHKAOz/z////tz+sv5t/mz+Vv5N/uf9pv1s/fD8k/wq/FD8Bfzs/Ev9Kf5A/3cAewE3A9ADzAReBegF4gU1BewEFAQoA/YB4AA4ABr/n/5M/sH9sf2Y/ZP9Sf0Y/fb8n/xC/M77u/tX+wf8Ovz//Pn95/6OAOABBgNOBD0FDwY6BuQFfAWuBKUDXAIlAUMAFv/g/kf+VP5f/lf+wP6//jP+2f07/X78yfv1+p36w/qJ+gv8t/wu/qX/rgFuA9QEFQZnB8AHsQcMB6gFRgSSAuIAWP/A/Sz9fvyV/Mj8KP2o/VP+qf5q/kD+yf3a/JL88vvI+1P8hvzA/Qn/EAC/AV8D2QTnBfkGpwdPByMHzwUjBJwCyABH//v9mvxR/C38bPwB/Vz9+f2Y/sT+uv56/rr9//zL+y/86/v0+8r9o/73/9UBuAMkBUUGwQelB1gH0wYrBWQD0AHB/2T+4fy8+537j/sL/Kf8IP3u/Yz+s/63/hb+bf19/Eb72PtY+8v7cf3M/h0AFAJYBIQFrwZnCC8IzAd8B1wFgAPJAWr/5v1n/CX7EPtB++v7w/xl/Vz+Hv9j/27/mP7W/Yf8X/vo+0n7JPyT/fv+dgBHAssEnwX3BrcIKAgJCLcHYgWQA80BQf+j/Sb8FfsF+3j7Bfz5/KP9fv41/1v/Tv9f/nH9A/wJ+2v7APv9+5z97v7mANkCMgVTBngHBwkaCNoHGAeHBPQCHwF0/h794/vI+v76q/tI/Af9iv7c/rP/LgDI/9r+8f1f/ED7qvsn+xb8zv0K/xMBAwM4BSoGsgenCJgHoAcaBuQDcwKEABH+EP3i+9X6cPsr/Jn8gv3t/jL/z/9WAK7/vf7V/TP80vpv+5H6Y/vx/Pv9IgAyApAE5AVoB3MI8QfuB6UGnwQ0AxwBCf94/Uj8P/tt+/77WvxM/Yj++P7m/3wANQBw/6v+6/yS++n74Po8+4383/3Q/gwCyQOYBBkH4AdXB9AH3gaVBIoDzwFd//790Px3+4b7L/xI/DD9cf7o/sz/lgBTAJT/6v6n/dD7SPv2+uD6mPu+/bX+LQH8A8EEAAeCCAoIYAjWB4YFOQR9AtD/Mv4W/Wb7Svvv+9j7qfzw/Uz+IP8FANj/Rf/W/sj9Gvx/+4X7Ffuw+9H9a/7s/wYDngPsBGgHagcsB9gHGwZEBHwD9ADC/q79CvzQ+kD7Rfta+zX9hf1Q/vT//P/X/+L/5/6O/YL84fu0+2z7TfxK/vj+fwHfA4IEwAZ2CB8IcghcCBsGswRaA4MAuP59/Z/77vpe+zT7vfte/aP9i/6v/33/nP9c/3b+nP2K/M37APyD+xb8Df6q/mgASgPJA38F0QdiB4wHBgjaBVgEagPfAKH+sP0B/Nr6Sftl+4/7Nv1T/nT+FgBDAOz/EAAa/xf+M/3o+6n7lvuL+5n8gP4b/70B+AOCBAgHUwhCBxIIPQf4BN0DMwJa/wv+4PxT++H6fvu5+1v8PP4T/2v/wQC5AEcA/f/Y/sD9dPyM+1L7kPu/++/8IP/3//QCywR6BQ8I1QjGByMIQAe6BHQDxwHP/mL9UPy6+kj6GftF+xj8w/3u/lf/cwDFAFEAFAAS/wP+efy1+1j7J/vi+4D8hv4LACMCkgRYBSYHUQjwB1cHmgbQBMMCQAEW/wD9wfs++1z66PoV/KX8/P3d/64ALAEAArMBDQFOAP/+Z/3Q+0X73foZ++H7Gv0t/98AaANbBVQGwwd2CN0H5Aa1Ba0DiQHG/7D97/vm+pT6ofpo+4r8kP3w/oEANgGMAeoBcQGmAMn/T/7N/FD7n/pt+tT6jvsd/V7/KwG4A/IF3wYfCOEIEgjdBmwFJwPhAPP+2/wx+0z6GvqN+pH76fw1/q//SAH8AT8COgJwAVIANf+a/QT8hPob+j76zPrp+6r9JwAnAooEnQaUB3MI6AhCCMUGPQU3A+QA4P4N/XD7d/pn+tD6t/sD/Tf+tP87AeEBCgIfAlYBRgAt/6T9DPyM+hX6U/rg+gj8Xv21/+ABmQOpBd8GDQhdCLgHsgZfBYEDUQFr/7v9Tfwf+636Bfup+6H8rP00/7cAvAEVAk0CFAIMAfz/rf41/Wb7O/qz+c/5V/qX+yT9c/+YAbkDrAVdB4QIsQgGCO4GXQVNAx4BJf93/RD8GPvm+mb7RfxJ/Y3+FQBwATgCbAJ2AuAB3wCq/1j+2Pyw+4n6xvme+Vn6dvs6/Q//CgE1AxwFxwaKByAIIggwB8UFNARsAn0A0f5u/VX8n/ug+xH87vz7/fv+IAA2AekBDwK3AR8BGwAG/9X9kPyi+9z6Tvox+rT6xfuS/TD/5wDQArcEUwYbB6AHtwf0BqwFKQRTAp4AA/+X/Wv8rvuF+9X7mvyD/aj+5v8vAdABBALJAV8BkwCJ/2/+QP1L/Hf7yPot+ib62fp8/Pf9pv9NATIDAgWIBjIHaAdnB6AGdAXaA9ABDACg/kX9Ivyj+7H7Ofwj/TH+T/9wAJMBIAI9AvABdQGUAJ3/eP5I/Yr8+ftJ+6b6iPoQ+2v8+v2a/ygB5AKhBAsG2QbzBuAGYAZABe8DOgJ9AB//+/3Z/E78SPyn/GD9R/44/y4AJAHIAfgBxAE3AXkAeP+g/pn9sPwC/Jr7Jvv4+kT7BPx8/fT+fgD3AWMDtgS4BVEGIwbCBRgF9AOnAjcBqf+A/pz98PzA/PT8fP1Q/kj/MgDYAFsBpAGQARgBWwB4/3X+vv0h/X/8F/z8++n7Dvxi/Bn9CP56/xMBeQKCA1cECwWMBaYFGAVcBGQDPwIjAfP/wP7w/YP9Uf2F/QD+of5w/04A/QBhAXQBWQEYAX8Aqv/O/vr9av00/fP8mvyZ/KD8t/wx/ab9Rf4m/2oArAHQAogDAQRZBKwEswQ6BGgDPAIvAUIAkP+7/jH+Cf4O/nX+Av9c/9j/jgDeAPoAwABgAAYAl//5/lD+x/1h/Vj9cP1D/TP9JP0x/Z79OP7M/qv/5gAeAhQDwQNLBKoE4ASRBAgEJQMIAgoBNQB2/7T+Uf4d/jn+rP4I/2D/7/+RAMgAxwB4ABsAuP87/5H+8P2D/Uj9U/08/RD9CP3l/A/9fv0N/rj+u/8HAUACHwPnA3wE6AQnBdYEUARIAyICGQE2AE7/g/4S/tH9Af6V/t/+HP+u/2kAwADzAJEA9v+F/yz/g/7v/Zv9WP1s/WH9N/0r/Sr9UP2D/en9mf6e//YAPQIJA7YDawTwBDUF8gRQBDEDBwIMARUAMf8y/r79kv3n/Zz+/v5a/xYAHQGcAZoBMAGBAMn/QP+g/rf9Df3m/PD8QP1I/Sb9L/1P/bD96P1A/uv+AgBzAdoCrwMRBGcE8gQiBbAE2QOLAnEBrgAAABj/N/7v/ff9j/5K/7D/DQCoAGEBiwE3AYIAmv/q/mH+1P0b/bH8uvwH/XT9vf2p/cD9H/5f/mL+sv5J/3IA/QE/A/4DVwTWBDAFQAWkBFID8wHiACcAWP9n/pb9cP3X/ZL+Rf+i/wcAmwBKAXwBDQFBAHj/yP4p/p39+/yV/K78EP2e/fD9+v0R/n/+kv5D/u397/0l/+gAdQJAA+YDwgSkBQIGrAV7BPsC8AEIAeL/kP5b/fb8cP1A/gn/wP9hABYBygH3AZ8BxwDZ/yb/a/64/SX9wfzC/Aj9ef0K/mj+fv7A/vj+jf7o/Xj9zf1M/0UBmQJAA/QD3ASABZIFwwQaA68B3gAHAPj+5P1P/ZT9mf6O/0IA6wCwAVoCjwINAh0BBgAO/0P+bP29/G78lvwG/Vz9sP1R/sP+2f4Q/xv/ef6E/e/8S/0e/4gBMQMIBKwEjgUyBgIGwgT/AiMB6/8w/0f+jf1s/Qz+Lv82ANoAVwECAkkC/QEmASMAL/9Y/q79+PyG/Jz88PxT/X79mf0l/pv+df5N/kj+6P0v/ZD8qPxK/lEBzAO6BDwFKgb2BuMGjwVbAywBEwCW/7X+4P2w/Wz+8v8eAXYBnQH/AToClwF8AGj/i/4Q/sP9O/0W/Zb99f0Z/vX9sf0s/sT+gP7l/XD9O/3e/G38WPyP/S4AEwOnBBcFdAXyBQQGHwVPAz0BBACn/0L/vf60/i7/SQBPAbcBegFcAV0BsQC5/wf/m/5e/lX+M/4g/p/+x/53/gr+jf3P/ZT+yv5c/vb9EP4s/p/9tPx5/B7+SwEaBPIEDwW9BYkGKAZWBAQCJgB2/zL/hv4O/of+oP/oAJIBlwFFAVkBJgEMAA//ov6w/q3+fv4b/kD+yP6H/sP9Bv3J/Cr9z/0o/tr98v2F/sL+Pf55/XD9A//DARwEywTzBG4FvgX9BDoDYAEJAKD/cv/t/r3+Uf9QAE8BsAGgAW4BGgGCAKz/C/8f/2P/b/9B//f+/P4c/4L+T/2C/H78AP1d/a39yP0R/qP+6P5s/pv9fv2S/nkAjAJABDYF/QVjBnkFngP5Ac0A+P9u/+n+8/6w/5oAUQGYAbIBpwEUAT0ARv+0/pn+6/4Z/w//Hf8l/0P/4f7n/eP8jfz3/Gn9x/1+/q/+0P76/pb+rv0Q/Vb91v4VAXQDGgXaBTgG/wWzBMoCIQH7//j+Cf9//0YALwHtAV8CSQK7AdEAsP/X/mn+Wf6g/jv/m/94/yH/uP5Y/qD9tPwk/HT8D/2B/VX+9f4Y/zf/Fv9Y/n39K/2c/XL/MQJhBFMFiAWhBQEFhANqAdH/Af/N/kb/+v/LAKUBMAIXAnQBkAAoAKb/R//w/uf+Tv/Y//j/cP/f/nv+TP7Q/SL92/w9/RL+tP44//j+df6I/vb+rv4a/vT9T/7J/2cCcwQVBQgFGQWIBPACKAHB/xz/BP+B/yUAEAEOAowCSQKKAbAA7v9f/wL/rf6W/h//uP+y/1b/3f50/jf+3/0o/Yb8tfx4/R/+//4t/6b+z/43/7H+0P19/bz9If/+ATAEPQViBYEF5QQrA1cBz/9o/2j/y/9mAFABaALGAmgCfgFYAGj/zf6t/oj+p/49//j/AgCA/+v+TP7Y/WT9WP1G/T39nP13/gj/z/8oAD3/3f4n/83+9P2w/dj9if6NAdUE0AWuBWQF6AQ7A0UBZf+l/m7/IgCxAPoAxgEkAswB0wBd/3j+Pf57/nr+4/6T/+v/3v9q/9L+M/7U/cT9m/2A/ZT92/1I/gH/hP8f//j+Mv8D/4n+QP40/oH/CAJoBC0FCgXGBE4E5AIeAbH/af8TAO4AZwGFAf4BBgJsAY8Amv8a/+f+0f7H/jr/wf/t/w4Arv/+/oj+w/0r/eT8NP3B/ar9c/1x/RD+vf54/3r/H/9r/8P/ZP/Z/gD/1v/eAGgCXARwBUIFxARxAxkCfgHoAF0AUACWABwBVgEvASYB4wCDAM7/HP++/tv+Av8a/1T/N//P/kT+vP10/V79rv3T/eP9qv2//fD9aP4C/wD/5v5I/yb/vP6g/kf/mQAoA1YFmAUoBRoEiAKmAeAA7f+h/wAAvwB8AZcBnQGLATABiwCR/9L+Xf5W/o7+7f6K/+b/v/9j//D+C/6a/W79gP2U/b79Gv74/RD+h/4X/87/aQAyADIANQCp/zD/6v4p/9L/QAF6A1EFnwUNBbEDMQJuAa4Anv+A/wkA8QBVAS0BKwEEAbgAw/+a/hj+SP6q/h//Lv9b/5T/av+o/gj+mP2e/bX9tf2G/cv9a/7W/h3/JP8R/5b/lv8H/37+x/7n/6AB1AMYBTYFzwSiA00CcAGoABgAGgCNAEABoAGFAWAB/gBAAF7/tP5L/jn+aP65/in/w/80APP/eP8F/z7+2/3H/fr9Ev4//ov+Pv5S/uT+c/8TAJ0AawAJAND/g/9Y/0D/df+w/14A5wL3BK4FEAWEAwgC5QGJAV8AG//K/oz/6wA/Ab0AYwBaAGoAqf9U/qH92f2x/k7/KP+k/rP+7v7s/n/+Cv7g/Qr+Nv4T/hD+ef5L/wgA//+q/7f/oP83/8T+5f70/8cB6wNNBREFPwQAA/YBaQGdAMr/ff/o/7EAPgETAcQAeAAAAF7/oP4Z/iP+2P6K//L/0v+l/07/CP/h/mD+3f3L/TL+eP6e/pn+Jv5g/nD/PwDkAKEA//8jAAcBAQFwAMj/PP8x/+P/OwHFAsgDBQR0A8EC8gHvAAgAyv+G/9b/XQCXAOgAAAG8AEgAhP/G/nH+av6j/t/+7v76/jj/MP8W/9T+Yv4Y/gL+w/3h/Z7+c/8ZAAYAYf9C/9v/DQDm/37/+v4C/6r/DAGlAsoDRAQQBGkDlwKCAawAVgD4//b/MgBoALkA4AC1AE4A0v9Y/yr/4P6w/rz+5f40/1b/N//Q/nv+OP5K/mr+Mv4f/jT+i/45/8P/EgDp/7n/lf/y/yAA0P92/4b/sv/Z/xQA6QB1AswDsARCBEADUgKIAUAB2gAfAH3/cv/4/2QApwBpABgADADk/4b/H/+S/pr+5/4j/xr/u/6B/pf+wP6U/jn+8v3N/UD+B/+W/6//j/90/8v/LwDo/yL/z/7a/m3/LAAPAV4CsgOuBNYE/wPSAogBwAA7AAIAr/+R/9D/LgB/ALUAZAAFAK7/W/8s/+H+pf7N/gv/Ff/0/rz+lP6l/sL+nP52/iP+1f0U/qj+i/8EADAAJwDH/6j/wf8AAPv/CQDE/5T/hv9NAP4BwwOxBMgEAgQHAycCHQEkAFr/Af/w/lD/0f8OAGwAmwB5AFIA2f9W/7b+hP6X/vr+I/8O/+H+u/7Y/sz+sP4z/s797v2m/oz/GAAlAMf/ZP9q/7f/EAAHAJ//bP9X/+7/LQGaAmEDwQO8A0ADtwLiAQwBRwDa/5L/iv/C/8z/BwBgAG8AXQAYALv/Zv8Q/53+Uv5q/pD+x/7d/r/+qv67/tP++f7R/pD+oP6s/gz/1P9KAF8AIAC3/4b/sP/k/6X/ZP8z/5X/6gCuAugDTgQABHYD2gIQAiQBSACZ/1X/ff/R/yIAbQCRALAAnABOAL3/9P53/lv+Vv5u/mz+WP54/rz+AP8U/73+Yv5e/qH+Rf/b/x8ADwC2/2j/aP+Y/53/aP/9/gz/iP9rAMMBHwP5A0kELQS8AwgDFwIRARYAfv9G/1H/hP+v/+3/GgBaAG8AUQDs/xb/ff5a/kr+Wv5Y/jP+S/6L/sP+3f6g/kT+Qv56/gP/lP/X/9z/mv9A/zT/RP9l/7r/qf/M/1MAiAAAAcsBwwKxA0MERQSYA6YCqwH6AJQAIACt/0P///5N/9L/VgCxAHcAEwCX/xz/6f6m/lP+F/7F/QD+m/76/hD/z/5R/lr+yP47/8//3v+j/4L/SP9d/67/p//C/7r/if/z/24AqgAaAa4BeQJeA/kD7ANJA0UCPQGlAGcAQQAZAMr/iv/C/wkAVQBsAA8Aqv8h/7/+m/5V/hz+6/3G/Sn+nf79/jH/5f6k/rb+8v5//xQAHAD7/7r/eP+x/9T/4P/2/57/ff/w/0sA2ACiAUIC/AKvA+ADrAPxAvMBHAGPACgAFgDX/67/sf+t/7//5//0/8//V//f/nL+Iv4F/tz9+f0P/hr+P/52/qH+4f4S/0z/x/8gAD8AJwCt/1D/LP8e/4D/3//p/w8ARwCHAPUAmgFDAtoCIQM9AxsDuQJAAsgBSQG9AEQAwf+J/5D/hf+j/6j/kf99/zz/8v6w/mb+F/7g/dj9+/0Y/lv+lv7J/vr+H/9V/6L/yv/d/5j/Yv9F/1n/lv/j//X/wv+v/9z/MADWAIYBIAKTAukCFgMdA9UCZwLkAUABxgBmAP7/3P/b/8f/0P/F/7r/u/+b/3D/Nf/k/nz+M/4g/vr9Fv4R/jj+Vf54/t7+I/9Y/zX/Av/i/hL/dP/a/y8A6/9u/zb/qP9RADUBGQJoApgCuAIpA9ADEATbAwcD/wEQAYAANgA0AA0ArP9f/yv/KP9a/1v/QP/h/nr+Kv7v/fL9If41/kn+dv6A/rL+F/9a/3P/Of8A//3+TP+6/w8AOADn/2L/P/+2/3MAUAH7AQMC7AHJASwCzwIvA04DrALcAewAeAA+AEgAUwALAHX/7P6V/pP+yP76/vL+uP5q/jH+L/5o/sj+Bv8f/zX/DP8N/zv/hP/l/wEAAADl/5n/kP+g/+j/RwBgAGoAkACfAO8ASwHAATICfgKYApQCWQIIAqYBNQGwACcArf8r/8P+dv49/gj+5P3H/cH9xv0H/kj+kP65/qf+p/64/uX+Tv+//9z/3v/k/9D/+/8jAG4AeACVAJYAggCoAPEAPwGMAboB8wFEAn0CbwJRAggCkAEiAa8AOwDi/5X/S/8B/8D+of6B/mr+S/4x/hn+Ov6d/gD/bP+G/2H/S/9A/1b/oP/d/wkACQDp/wIAJABxANUA9gAMARABDQElAVcBuQEiAkACHALhAYYBQAETAcwAdQAeAKr/Of8A/8T+lP58/ln+IP7g/ar90P1G/sH+QP91/2r/Uf8y/w7/N/97/67/5v8GAAYACAASADsAdwDBAAoBFwEIAfsAAAEdAT4BggHLAeAByQGpAWYBRAEWAbkAVQDx/5j/Nv/8/sv+k/50/lD+D/7Y/cz9Af5j/tP+Nv9d/1b/Wv9d/47/3/8ZAEwAUAA5ACwAPgBnAK4A6QAfASABFgEaASUBQwFkAYMBkwGHAWoBPQFAATsBIQHeAGoA/f+g/1D/KP/w/rf+dv4//jf+Sf5d/nP+dP5z/nH+gf6u/vP+Lv9f/3X/jf+t/8j/9v8lAGgAmACzAMEAvQDNAO8A8QA4AWUBqAHFAbABmgFoAUABOQEJAeoAuAB3AEgADwDZ/6f/eP9M/wz/5v7W/qr+nv6a/pP+pv6u/q/+rf6o/uD+G/9b/6D/w//f/+D/1//d/+3/+v8nAEsAaABwAGoAbwCXANsAZAHAAegB5wGzAWoBSAE4ASUB6wCcAEcA8f+//5L/W/8//xD/3P6u/o3+gP6J/oj+of66/rD+pf69/g7/e/+L/7D/hf93/4//s//y/x4ASABuAHYApwDjACoBigG4AdABuwGwAaUBwgHQAbsBdgEAAZIANQApABIA6v/A/2D//v6+/qD+xv68/rX+of51/kz+WP5m/rX+1/7J/uj+6P4A/zH/Yf+I/5n/wP/z/2AA0AA0AYMBtgHSAdcB2AHzAe0B/gHuAbsBhwElAdwApwCAAEIA7P+X/0//P/8v/yD/HP/4/s/+sP6B/nb+f/6I/qX+n/6r/rP+vv75/h//Of86/0j/eP/B/yIAhADAAOgACgE1AWoBhgGYAacBkQF4AVcBNQEXAfQA2ACoAGwAKAABAOv/3//C/6j/kP9f/0//Pv8g/w//+P73/ur+5f7z/uz+9P76/v7+EP8T/zj/ZP+W/9j/6/8TAEkAcwCgAOUAHgFLAWABXgFnAWIBVQFRASQB/QDVAJkAYQBFABgA8v/A/5j/df9S/zv/KP8a/xn/EP8K//n+5/7f/s7+xP7L/sj+1/7b/uz+EP87/4n/3P8WAFgAlADOAAkBWwGJAaYBrgGxAZcBhgFxAUgBHwHlAMkAigBkAFAAOgAgAP7/7v/N/6j/pf+V/4r/eP9q/0//Jv8I/+r+y/68/qj+rv66/sv+5v77/iX/bP+y//T/MQBnAJQAxwDwAA8BHAEjARMBFQEOAfEA1AC1AJsAaQBGADgAJgATAPD/8P/Y/8v/vP+5/8n/tP+m/5D/b/9l/1j/SP9I/zb/OP88/zz/Tv9a/4n/uf/y/x0AUwCOAMEA1wDiAPMA9ADyAOIAyACnAGgAVgAoABoA8//E/7j/qP+8/8n/0//J/9L/3f/j/+f/6v/W/6j/lv+S/4H/d/9k/0b/NP9L/2X/hv+x/8n/8v8hAEUAZgCPAJ8AowChAJUApACJAGgASQAuAAoA/v/w/9n/4//m//H//v8DAB0AKAAiABgABQD+/+//2//P/8n/rv+h/5//k/+I/4j/oP+p/87/9P8RAB4AOABBAEYAUABOADcAHwAWABEACAAAAPD/7v/p//D/9v/8/wUAAgARABYAGgAmACgAHQAYAAsAAAAAAPL/4P/Y/9r/2f/f/9L/0v/o/+X/4v/g/+v/6v/o//n//P8GAAAA5f/j//f/9f8AAO3/6P/o//f/DQAKAP3/BQACAAkABQAcABIAAQD9/wAA8f/8/wwA//8AAAAADwAWABcADAAPABIAEAAMABIACADz/+r/4f/j/+b/1P/Q/9P/2P/Y/9H/6P/1//T/BgAPABgAGAAaABgAHQAdAA8AEAAMAP7/CAAHAAoAAAD6/wQAAQADAPT/9v8BAPr/+f/5/+v/7f/q/+z/5v/Y/9b/3f/g/+H/8//w/93/5P/5//H/BAAIAAMACAADABAADQAEAPf/BgAMAAUAAwD///7///8NAA4A+/8TAAgACwAPABAADQAXABIACwD+//L//v/7/+7/2//c/+b/1P/Q/+b/7P/n//P/AgD3//r/9f/4//3///8AAPT/6//5/xAACAAMAPr//v8JAA8AFAAQAA0AGAAaABYADAAHAAkABAD5//X/7v/w//D/8P/w//D/8//o/+f/7v/v//j/+f////f/+P/9//P/AgAIAAAAAAAAAAIAAAD6/wEA+f/z//j/7P/4//v/+v8IAAIA+/8AAAAAAQD///f/8/////j/9f/8//n/9//7//j/AAADAPH/9f8AAAUA/f/8//v/+v/x//n//v/0//n/+/8DAP7///8HAAIA/v8EAAEA/f8AAAEA/v8BAP///P/+/wQAAwD4/wAABgD9//r/AgD9/wUAAQD+//3//v8IAAAA///6////BAD///7/AAACAPj/+v8BAPv/9f8AAAIA/v/8/wEAAQAEAAYAAgD9/wUACAD+//7/AQD///3/AAAAAP7/+/8AAAIAAQD9//r/AAAFAP7//P///wAAAQD9//r////8/wQABwD4//3/AgAAAPn/+v8CAAIA/f/6//r/AAACAAYACAAAAPv//////wMAAAABAAAABAD9//v/AQAGAAcA/v8DAP7/AAD8//7/AgD6//H/+//+//3/AAD3/wYABgADAAYA/f8AAAYAAAD9/wAA//8AAAkAAwD+/wAA//8AAP///v/4//n/AQD+////BAABAPz//f///wAAAgADAAUABAAEAPr/AgAHAAAA+v/7/wMA9P/8/wEABgD///3/+/8KAAoA+//8/wMABwD+//3/BwACAPX/+v8AAAAAAAD+//7/+v///wAA+P8BAAQA///+/woAAwD+/wMA//8BAPz/AgAAAPr//v/5/wMA///9//X/+v8OAP////8AAP//AAAAAAAAAQAAAPz/AwD6//3//v8CAAYAAgD+//3///8EAAEA+//9/wcAAQD5//v/AAAAAAEA/v////b////9/wAA/v8CAAAAAAACAP///v8AAAQABAD//wAAAgD9//z///8AAPn//v/+//v/BAD+//v///8BAAAA+P/+/wcABQD5//v/AAADAA4AAQD3/wIABQAAAP7/AAABAAQA/f8GAAIA/f////z/AgD8/wAABAAFAP3///8AAP//BAD7/wEA9f/9/wQA+v/8/wMA+//9//b///8FAAEABAAEAAYA///6////BgAKAAAA/f8BAPv/AAD7/wAA/P/5//7/9v/7//v/+//9/wQAAAAHAAQA/f/7/wQABQAFAAMAAAAAAAIA+f8HAAEAAAD///r/AwAHAPv/AAAFAP///f/4//z//v8BAPn/AgD+//n//P/+/////v/8//3/BAAHAAkA+f///xQAAQACAAYA/v/+/wMABwABAPz////4//z/9v/1/wAABAD+//7//v8CAPr/+f/6/////P8AAAAA+P/6/wEABQACAAcAAgD5////BQALAP//9/8HAAcA+f8IAA0AAAAAAP//BAD7/wEA9v/z//r//v/1//L/AQACAPr//v/8/wcAEgD6/wAABQAIAPn//v8FAAUA+f8AAAQA/f8DAAcA+//z/wsAAQAAAP//AwD7//T/AwD+//r/AQD2//f/BQAAAAkAAAABAAQA/f/6/wkABQDz/wAAAgAFAPn/BAAGAAMAAgD9/wMA/f/9//7//v/6/wAABQD4//X/AAAAAAUA/P/9/wAA/v8BAAEA///7/wgA/v8DAAUA9f8KAP//+P8GAAAA9v///wMA//8AAPn/AAABAPv/+v8AAAAA+f8BAP3/AwD8/wEAAAD5/wYACAD8//b/AwANAAQAAgAEAPz/AgAAAPv/BQD//wAA/P/9/wAAAgD8//f/BQACAP7/CAAAAPf/CAD4//r/AAAAAAAA/P8BAAAA/f8HAAMA+/8CAAIAAQAAAP7/AgD+//n/AAAGAAcA/P8AAP///f8DAAAAAgABAP///f/+//T/+/8AAAAA+f8BAPv/AQAJAAAA///+/wMAAQD4/wIABAD7/////f8BAAUABQAHAAQA9v/8/wgA8//8//3//P8GAAAA+P/y/wMABAD9/wEA//8BAAUAAAABAAAAAgABAP///v/6////CAAGAPf/AAACAAAADAD9//r/+f///wAA7v8FAP3/9/8CAPn/AAAKAAEABgAEAAAABQALAAkA+f/5/wAA///3//f//v8AAP3/AgAAAP3/AgAAAPb/AQD//wAA+v/9/wcA/f8DAAYA9/8CAAAA/f/9/wQAAAAHAAcAAAABAAcA9v8CAAIA9//3//n/+f/5/wAAAAD6/wQAAwD+////AAAJAP3/AAADAAEAAAD8////AAD7/wAABAD4//n/AAD6//n/BQAAAAcA9f8FAAoA+P8EAAYA+//7/wYA+f//////+f///wAA+v/9//z/CAACAAIAAgAAAAkA/P8BAA8A+//4/wAACAD5//f/AAD6/wAA+v/5////AAD6//3/CwD//wUAAAAAAAwA+v8HAAAAAAD///H/AwD5//z//f/4/wEABQAAAPb/BAAKAAQAAwD//xAA///6/wcAAAAFAAEA/P/8//n/AAAAAPv/+v/+/wIA///1//z/AwACAAYA9P/7/wUAAwAAAPb///8QAAAA9v8HAAIACgD8//b/AAAJAA8A9//0/wAACgABAP//9//2/wQAAAAAAP3/+//+////9f8HAAEA9f/9/wUAAAD9/wkAAgD6//f/BgD7//j/AQAEAP///P8BAAIA/P8JAAsA/v8AAPz/+/8AAPj/+P8DAAQA8//6/wcA+//x/w8ABAD4//////8FAAAA+//3/wwABgDu/wwACgD9//f///8IAPj//v8AAAIAAQD2////+//8//7//f8CAAEA+/8IAAQAAAAAAAEA+//5/woABAAAAPr/AAAGAPn/AAD//wQABQD0/wAABgAFAAAA+f8FAAQA/P/6//v/+v/4/woAAAD0//r/BQD//wAA+v/9/wMAAgAFAAAABQAMAPr/BgAAAAAABQD8//z/AgD8//b/+f/5/wAA8//2/wIAAgD9/wIA/P8HAAIA9//+//3/CAACAPz/DgALAAUAAAD7//r/BQAEAPj/AAD6//r/AAD5/wAA/////wAAAAAAAPr/BgAFAAUAAAAAAAUA+v8AAPr/+f8AAAUA+f/5/wwA+f/6//r/AAAFAAAA+v8GAAUAAAD//wUABgDt/wAABQD4////BQAAAPv/9P8CAAQABAD5//r/BgD6//b/BwALAPP/9/8DAAIA/P8JAAQA+v8GAAYA+f8FAAUAAAAAAAAAAAAAAPn/AAAAAPn/AAAAAAAAAAAAAAAA+f8FAPn/+v8AAP3/AgACAAAABQAFAAAA+v8GAAAAAAAAAAAAAAD//wwA8//6/wAAAAD5/wAAAAD6/wAA//8FAAUA+v/0/wMAAAAFAAUAAAAAAAYAAAAMAAIA/f8DAAIA/f/8/wIA/P/9//f/9//5/wAAAAAAAPr/AAAFAPr/9P8DAAUA+P8EAAsAAAD6//r/BgD5/wUABQAAAAAA+v8AAAUABQAAAAAABQAJAPb/+v8FAAIA9v/5/wYA+v/6//n/BQAFAPn/AAD6//r//P8CAAIA/f/9/wIAAgAIAAUA+v8GAAAAAAAMAAUAAAD6/wUACAD8//3//f/3//n/AAD///n/8//9//z//f/9//b/AgAIAAkAAgACAAMAAwACAAUABQAAAAAABgAAAAUAAgD8/wIAAgD8//3/9v/9//z//P/8/wIA9v/5/wUAAAAAAPn/AAAGAPP/+f8AAAAAAAD5/wYAAAD6/wUACwAFAAAABQD6//r/+v8AAAAABQAAAAAAAAAGAAAAAAAAAAAABQAAAAAA8//5/wUA//8AAPn/+v/9//b/CQAIAPz/CAAGAPr/+v8CAAIA/P/8/wgACwD5//r/BgAFAAAAAAAMAP3/+f8AAAAAAAAAAAUA8//5/wAA+f8AAPn/AgD9//3/CQAMAAUAAAAAAPn/AAD5/wAAAAAAAAAADAAFAAAAAAAJAPz/9v/9//3/+f8AAAAA+f8AAAUABQAAAAAA8/8AAAUABQAAAAAAAADz//r//f/8/wgABQAAAAAA+v8GAAAABQAMAPL/AAAGAAAABQAAAAAAAAAAAPn/AADz/wAAAAAAAPn/AAAGAPn//P8CAAUAAAD5/wAAAAAFAAAABQAMAPn/AAAAAAwA/f/z/wUAAAAFAP3/8/8AAAUA+f/z//3//f8CAAIAAgACAAIAAgD9//3/CQACAAIABQAAAAAABQAMAPn/8/8AAAAADAAFAPP/+f8AAAUA8//5/wAAAAAAAP3//f/3//3/DwAHAAAAAAAAAPn/BQALAAUAAgACAAIA9v/8/wIA/P/2//z//P8AAPn/AAAAAPn/BQAAAPn/+f8AAAAA8//9/wkA/P/8/wkACQAAAAAAAAAAAAwAAAD5//n/8/8JAAUA8//9/wkAAAAFAAUA+f/5/wAAAAD5/wAADAAAAPn/BQD5//n/9v/2/wkACQD8/wIADAAAAAAABgAAAPn/+f8FAAAAAAAGAPr/8/8AAAsA+f/6/wAAAAD5//z/BQAMAAUAAAD5//n/BQAAAPn/AAAFAAAABQAAAPn/+f8FAAAAAAAFAPP/+f8AAAUABQDz/wAAAAAFAAwA+f/z/wAA+f/8/wkABQAAAAAA+f8AAAUADAD5//n/AAAAAAAA+f/5/wUABQD5/wAABQAAAPn/BQAAAPn/BQAAAAAABQAAAAUAAgD9//L/AAAAAAAA8//6/wAA9v8IAAUA+f8CAAwABQAAAPn/AAAAAPn/BQAAAAUAAAAAAPn/BQAFAPn/AAD5/wAAAADz/wAABQAAAAAA+f/2/wkABQAAAAAA+f8AAAAAAAAFAAUA+f/5/wUABQAFAAIA9v8AAAUA/P8JAAIA8P/5//n/+f8FAAAA8/8AAAAA+f8CAAUAAAD5/wAADAAFAAAAAAAFAAgA/f/2//3/AAAAAAAA8/8AAAUA+f8AAAUABQAGAPP/AAAMAAAAAAAAAAAAAAAAAAAA+f8AAPP/9v8JAAIA/P8CAAwAAAD5/wwAAAAAAAAABQD5//P/BQAMAAAA+f8AAAUAAAD5/wAAAAAFAPn/8/8AAAUA+f/5/wIAAgAAAAAAAAAAAAUAAAAAAAAAAAAAAPn/AAAAAAUABQD5/wYABQADAP3/8/8AAAAAAAAAAAwA+f/5/wAA+f8MAAwA9v/5/wAA+f/5/wAABQD5//n/BQAFAAAA+f8AAAAAAAAAAAAAAAAFAPn/+f8AAPn/AAAAAP3/AgACAPz/AgACAAUABQAAAPn/+f8FAAAA+f/5/wUABQAFAPn/AAAAAAAAAAAAAAAA+f/5/wUABQD5/wUAAAAFAAAAAAAAAAAAAADz/wAABgD6/wAAAAD6//n/AgAGAPn//P8FAAAABQAAAAUADAD5/wAAAAAAAAAAAAAAAPn/AAAAAPn/AAAFAPn/AAD5//b/AgAJAAUA+f8AAAAAAAAAAAAAAAAFAPn/AAAFAAAAAAD5/wwAAAAAAAUAAAAAAAAAAADz//n/AAAFAAAAAAAAAPn/+f8AAAAABQAAAPn/AAD5/wAABQAFAAAABgAFAAAAAwD2/wAAAAAAAAAAAAAAAAAABQAAAPP/AAAMAAAA+f8AAAUACQDz//P/BQAFAPn/+f8FAAAAAAAFAPn/8//8/wIACQD5/wIADAAAAAAADAAAAAUA/P/8/wAAAAAAAPP/AAAAAPn/AAAAAPn//P8CAAIABQAAAPn//P8JAAUAAAAFAPn/AAAFAAUAAADz//P//P8JAAwA+f/5/wAA+v/8/wMACwAAAPr/+f/8/wIAAgACAAUABQD5//n/BgAFAAAA+f/5/wAABQAFAPn/AAAFAAAA+f8AAPn/AAAAAPn/AAAAAAAAAAD5//z/AgD8/wIACQAAAAAABQAFAAAA+f8AAAAAAAD5/wUABgAAAAAAAAAAAAAAAAD5/wUA+f/z/wAABQAAAAAABQAAAAAA+f/5//n/AgAFAAAA+f8AAAUABgD6//n/AAD6/wAABQAAAAAAAADz/wUAAAD5/wwABQAFAAAAAAD5//n/AAAFAAUA8/8AAPn/BQAAAPn/AAD5/wAAAAAAAPn/BQAMAAAAAAD5/wAADAAAAPn/+f8AAAYAAAAFAAAAAAAAAPn/8//5/wUA+f8FAAAAAAAFAPn/BQAAAPn/BQD5//P/AgACAAUAAAD5/wAAAAAFAAUABgD6//n/AAAAAAYAAAAFAAUA+f8FAPn/AAAAAPn/+f8AAAAA+f/5/wIABQAAAPP//P8JAPz/AgAMAAAAAAAFAAUABQACAPz/9v8CAAIA/f/8//b/AAD5/wAABQDz//P/BQD5//b//P8CAAIA9v/8/w8AAgACAAIAAgACAAwAAAAAAAYAAAAAAAAAAAAMAPz/8/8AAPn/+f/5/wAAAAAFAAAAAAAAAPr/AAAAABMAAwD8//3/+f/5//n/+f8AAAAAAAAAAAUA+f8AAAUAAAAAAAUAAAD5/wAA+f/5/wwABQD5//n/AADz/wIAAgD8/wIAAgD8/wIACQAAAPz/AgACAPz/AgAFAAAA+f8MAAAAAAAFAAUA8/8AAAUA+f8AAAAABQAAAAUAAAACAPb/+f8MAPn/8//5//n/AgAFAAAA+f8AAAAAAAD6/wIABgAAAAAABQAAAAAA+f8AAAAAAAAAAPP/BQD5/wAABQD5/wAA9v8JAAUABQAFAAAABQD5/wAAAAD5//n/BQAFAAAAAAD5/wAABQD5//P/AAAFAAUAAAAFAAUA+f8AAAUAAAAAAAUAAgD8//z/AgD8//3//P8CAPD/+f8FAPn/8/8FAAAAAAAAAAAAAAAAAAUAAAAAAAAA+f/6/wAABQD5/wYABQAAAAAAAAAFAAwAAgD8//z//P/8//z//P/8//P/+f/5/wAABQAAAPn/+f8CAP3/AgAJAAUAAAAAAAAAAAAAAAwABQD8//P/AAAMAAIA/P/8//n/+f8AAPn/+f8AAAUABQAAAPn/AAD5//n/BQD5//b/CQACAAIAAgAAAAAAAAAAAAYAAAAFABIA/P/2//3/AgACAP3/9v/5//n/+f8AAAAA+f/2/wIA/f8CAAkADAAMAPn/BQAFAPz/AAACAPz/+f/5/wAABQD5/wAAAAD5//n/AAAAAPn/AgAFAPn//P8JAPb/AgACAAIAAgACAAwAAAAAAAAABQAFAAIA/P/z//n/BQAAAPn/AAD5//n/BQAFAAAA+f/5//n/AgAMAAAA+f8FAAUAAAD5/wAAAAAAAAAAAAAAAPr/AAD6/wAAAAD6/wMABQAAAAAAAAAFAAUAAAD5/wAABQAFAAIA/P/8//n/AAAAAAAAAADz//n/AAAAAPn//P8JAAAA/P8JAAAA+f8CAAAAAAAAAPn/AgAMAAAAAAAAAAAABgAAAAAAAAAAAAAAAAAAAPn/AAD5//P/AgACAPz/AgD8/wIAAgD8//z/AgAWAAYA+f8AAAUAAAAFAPn/8/8FAAAA+v/z/wcABQAAAPr/AAAFAPn/+f8AAAAAAAAAAAAAAAAMAAAAAAAFAAIA/P/8/wIA/P/8//z/8//5/wAABQAMAPz/+f/5//n/+f8AAAUABQAAAPP/+f8FAAAAAAAFAPn/8/8CAAIABQAMAAUAAAAAAAAABQD5//n/AAAAAAAA+f8AAAUA+f8AAAAAAAAAAPn/AAD5/wAABQAAAAYABQAAAAAAAAD5//r/BQAAAPP//f/8/wIACQAAAAUABQAAAPn/AAAAAAUADAD5//n/BQAAAPn/AAAAAPP/+f8FAPn//P8CAAIADADz/wIAEgAAAPn/+f8FAAAA+f8FAAAABQAAAAAAAADz//n/AAD5//z/CQD8/wIABQAAAAAA+f8AAAUAAAD5/wAABQD5/wAAAAAAAAAA+f8AAPn/AAAGAAUAAAD6/wYA+f/6/wAAAADz//3/CAACAAAAAAAFAAUAAAAAAAUAAAAAAAUA/P/5/wAABQAAAPn/AAAAAPP/AAAFAPn/AAAFAPn/+f8AAPb/AgD8/wkABQAFAAUABQAFAPz/+f8AAAwAAgD8//b//P8CAPb/+f8FAPn/+f/5/wAABQAAAPn/AAAAAAUABQDz/wUABQD5/wAABQAFAAAAAAAFAPz/AAACAP3//f/8//z/+f/5/wAAAAAFAAAA+f/z//z/DAAAAAAABQD5/wAA+f8AAAAA+f8FAPn/9v8JAAIA/P8CAAkABQAAAAAABQAFAPn/+f/5/wUAAAD5/wAA+f8AAPn//P8JAAAA/P8CAAIABQD5//z/DAAAAPn/BQAAAAAAAAAAAPn/AAAFAAAADAD8//P/AAAFAPn/+f8AAAAABQAAAAAA+f8GAAUA+f/6//n/AAD5/wAA/P/2/wkAAgACAAkAAAD5/wIABQAFAAAAAAAFAAUAAAD5/wAAAAAAAPP/AAAAAAAAAAAAAAAA8//8/wkABQAAAAAAAAAFAAUAAAD5/wAA+f/5/wUAAADz/wAADAAAAAAAAADz/wUADAD5//P/AAAAAPn/AAAFAAAA+f/5/wIA/P/8/xAAAAAAAAAA+f8FAAYA+f8AAAAAAAAAAAAA8v8FAAUA8/8FAAAABQD5//P/BQAFAPn/AAAAAAAAAAAAAPn/AAD5/wUAAAD5/wAAAAAMAPn/+f8FAAAABQD5/wwAAAD5/wUAAAAAAPn/+f/5/wAA+f/8/wIABgAAAPb/AgAJAAAABQAMAAAA8/8AAAAA8//8/wkABQD5/wAA+f/8/wIACQAAAPX/CAALAAYAAAAAAPn/AAAAAAAAAAAAAAUAAAD5//P/AAAAAPn/9v8CAAkABQAAAPn/BQAAAPn/AAAAAAUAAAAAAAAABQAAAAUA+f8AAAwA/P/8//n/AADz//n/BQAAAAAA8//8/wIA/P8CAAkABQAAAAAADAAAAAAA+f8AAAAAAAAFAAAAAADz//P/DAAAAAAADADz//n/DAAAAPn/+f8AAAYA8v/2/wMAAgACAAMAAwACAAYACwAAAAAABQD5//n/AAAAAPn/+f8AAAAADAAFAAAAAAAAAAAAAAAAAPn/+f8MAAwA9v8AAAIAAgD8//z//P8CAPz/8/8AAPn/AAAAAPn/AAAFAAAAAAAAAAUAAAD5/wUABQAFAPz/8/8AAAAAAAAAAPn/+f8AAPz/AgAMAAAA+f8AAAUABQAAAAUAAAAAAAkA/P/9//b/8/8AAPn/AAAAAPn/AAD8//z/AgAJAPz/AgACAAUABQAAAAUABQAGAPz//P/8//n/+f/5//P/AgACAAUAAAD5/wUABQAAAAUABQAAAAIA9v/5/wAABQD5/wAA+f8AAAAA7P8CAPz/AgACAAIAAgACAAwABQD5/wAAEgD8//n/CQD8//b/AAAAAPn/+f/5/wAABQAAAPn/AAD6//z/CwAAAAYAAAAAAAAA8//5/wUAAAD5//z/AgAFAPn/BQAFAPn/+f8AAAUAAAAMAAAA8/8FAAAA+f8FAAAA+f8FAAAA+f8FAAUA8/8AAAUAAAAAAAUAAADs/wAABQAAAAAA8//8/wIAAgD8/wIACQAAAAAABQAFAAwAAgDs//P/BgAMAAAA+f8FAAAAAADz//n/BQD5/wAABQD5/wAA+v8GAAAAAAAAAAAA+f/2//3/AgAIAAIA/P8JAAAAAAAFAAAAAAAFAAwAAgD2//z/+f/z/wUAAAD5/wAAAAD5//n/AAAAAAAABQD5//n/AgD8/wIACQD5/wUABQAAAAUA+f8AAAYAAAAAAPn/AAAFAAAA+f8AAAUAAAD5//n/+f8AAAAAAAD2/wIAAgACAAYAAAD5/wAABQAAAAAAAAAAAAsA+f8AAAAA+f8FAAAAAAAGAAAA+f/5//n/+f8FAAAAAAD5/wAA+f8CAAUA+f8FAAwABQAAAAAA+f8AAPn/AADz/wAA/P8FAAAAAAAAAAUADAACAAIA/P/8//z/9v8AAAAA+f/z//n//P8JAPz/9v8CAAIACQAJAAAA+f8MAAAA+f8AAAAABQD5//n/BgAAAAAAAAD5//n/AAAAAAAAAAAAAAYAAAAGAAYA+v8AAAAA8//5/wAABQD5/wAABQDz//z/AgACAAUABQAAAAwABQDz/wAADAACAPz/9v8AAAAAAAAAAAAAAAAAAAAA+f8AAPn/+f8FAPn/+f8FAAAA+f8FAAUAAAD5/wAAAAAAAAUABQD5/wUABQAAAAIAAgACAPz/9v/z/wAAAAD5/wUAAAAAAAUA+f/5/wUABQAFAAAA+v/5/wAA+f8AAAAAAAAAAAAAAAAFAAAABQAAAPP/AAAFAAUA+f/5/wUAAAAAAPn/AAAAAAAABQAAAAAAAAD5/wAADAAAAAAA+f8FAAAAAAAFAAAAAAD5/wAAAADz/wAAAAAAAAYAAADz//z/DAAFAAAAAAAAAAAABQD5//n/AAAAAAAABQD5/wAABQD5//n/BQAAAAAAAAAAAAAA+f8AAAUABQAFAPn/AAAAAAsA/P/5//n/AAAAAPn/AAAFAPn/+f8FAAYA+f/5//n/AgAAAPz/AgAFAAUADAAFAAIA9v/5/wUAAAAAAAAA+f/5/wAABQAAAPn/+f/5//z/AgAJAAUABQD5/wAAAAAAAAUAAAD5//n/BQAMAAUA/P/5/wAAAAD5//n/+f8AAAwABQAAAAAA+f8AAAUA+f8FAAsA/f/6/wAAAAAAAPn/AAAAAAAA+f/5/xMABQD5//P/AAAFAAAABQAAAPn/+f8AAAUABQAFAAAAAAAFAPn/BQAAAPn/AAD5/wAAAAAAAAAAAAAAAAUABQD5/wUABQDz/wAAAAD5/wAAAADz//z//P8CAA8AAADw/wIADwAFAAUAAAAAAAUAAAAAAPn/BQAAAPP/AAAAAAAAAAAFAAUA+f/5/wAAAAD5/wUA+f/5/wAAAAD8//3/DwAAAAUAAAAMAAAAAAAJAPz//P/8//b/AgACAPb//P8CAPb/8/8AAAAAAAD5/wAABQAFAPn/+f8AAPn/BQAFAAAA8/8FAAAA+f8FAAwAAAD5//n/AAAMAOz/+f8CAAUAAAD5/wUAAAD5//n//P8CAAkAAAAAAPn/AgAFAAUAAAAAAPn/+f8MAAAA8//5/wUABgAAAAAAAAALAAAA+v/5//n/BQAAAAAAAAD5//n/AAD5//z/CQAAAAAABQAFAAUABQD8//n/+f8AAAwA+f/5/wUAAAAAAAAA8/8AAAUA8/8AAAwA+f/5/wAABQD5/wAA+f8AAAUA+f8AAAAAAAAFAAUAAAAAAPn/AAAAAAUA+f/z/wYABQAAAAwAAAD5//n/BQAFAAAA+f/5/wAAAAAFAAAA+v8AAAAAAAAGAPr/AAAAAPn/AAAAAPn/AAAFAAAABQAFAAUAAgD8//z/AgD8//b/+f8FAPn/+f8AAAAABQDz//b/AgACAAIAAgAGAPb/9v8CAAIACQACAAkAEgAAAAAABQD5/wAAAAD5//n/BQD5//n/DAAAAAAA+f8AAAwAAAAAAAAA+f/z//n/DAAAAPn/AAAFAAwA+f/5/wAAAAAAAAAAAAD5//r/AAALAPn/8/8CAAUADAD5//P/DAAMAAIA9v/z//n/AAAAAPn//P8FAAUAAAAFAAAA8//5/wUAAAAFAAwAAAACAAIA/P8CAPz/9v/5//n/AAAAAAAABQD5//n/BQAAAAAABQAAAPn/AAAFAPn/BQAFAPn/AAAAAPn/8//8/w8A+f8AAAUA+f8FAAUA+f8AAAAABQAGAAAA+f8AAAYA+f8AAPn/AAAMAAUA+f8AAAAA+f8AAAAABQD5//P/AAAFAAAA8/8CAAUA+f8AAPz/AgAFAPn//P8JAAAAAAAAAAAAAAAFAAUABQACAPb/+f/5//n/AAD5//z/AgACAPb/AgAJAAIABQAAAAUABQAMAPz//P8CAPb/AgD8//b/AgD8//z//P/z//n/BQAAAAAA+f/5/wUA8/8CAAsA+v8AAPn/BQAGAAAAAAD5/wAABQAAAPP/BQAGAAAA+f8AAPn/BQAFAPn/BQAAAPP/+f8FAAAA+f8AAAAA+f8CAAAA/P/8/wkA/P8JAAUAAAAAAAAABQAFAAAA+f8AAAAA+f8AAAUAAAD5/wAABQAAAPn/8/8AAAAA/P8MAAUAAAAIAA0AAAAAAPn/8f/4//j/+P/4//3/+P/x//7/+P/4//X/9f/1/+L/8P/w/+n/9f/9//3/+P/x//3/+P/x//H/8P/9//j/6//x//r/+v/9//n/AAD8/wIAAgACAAwABQAFAPn/AAAMAPn/+f8AAAUA+f/s/wUA+f/8/wIACQAAAAAABQD5/wAADAAAAPn/AAAFAAAA+f8AAAAAAAAFAAAA+f/z//z/AgACAAIABQAAAPn/AAANAPn/AAAAAAsAAAD6/wAAAAD6/wAAAAD5/wUAAAAAAPn/AAAAAPP/AgAFAPn/9P8BAP3/+P/4//j//f/x//j//f/x//H/+P8EAAQA9P/u//H/8f/x//3//f/x//H/+P/x//T/+v/6//r/+P/4//T//f/9//H/8f/4//T/9P/6/wEA/f/4/wQA+P/4/wEA9P/u//H/+P/4/+v/8f8FAAUA+f8AAAUA+f/6//n/AwALAAAAAAAAAPr/AAAAAAAABQAFAPn/BQAFAAAAAgD2//n/AAAAAAAA+f8AAAUAAAD5/wAAAAD5//n//P8CAAIAAgD8/wIADAAFAAAAAAD5/wUAAAD5/wUABQAAAAUAAAD5/wAABQAAAAIAAgD2//P/+f8FAAUA8//5/wYA+f/5/wIABQD5//z/CQAAAAAABQAAAAAA+f8FAAwAAAAGAAMAAgACAP3//P8CAPb/9f/5/wkA/P/z/wAAAADz//n/AgAFAPn//P8CAAIA9v/2/w8AAgACAAIAAgAMAAAAAAAFAAwA+f8JAAIA9v/2/wAABQDz/wAAAAD5//P//P8JAPz//P/8/wIACQACAAIABQD5/wAAAAD5/wwABQAAAAAAAAAAAAAAAAAAAAAAAAAAAPn/+f8FAPn/8/8CAAIABgD6/wAABgD6//b//P8PAAUA+f/2//z/CQACAAUAAAD5/wwABQD5/wUABQAAAAIA/P/8//z//P8CAPz//P/2//P/BQAMAPn/AAAAAPn/AAD5/wAABQAAAAAA+f/5//z/AgACAAIABQAMAAAAAAD5/wUAAAAAAAAA+f8FAAUA8//z/wIABQAAAAAAAAAAAAUAAADz//b/AgAIAAAAAAAAAAAABQD5/wAABQD5//L/AgAFAPn/AAAMAAAA+f8FAAUA+f8AAAwAAAAAAPn/+f8AAAAA+f8FAAAA+f/5/wUABQD5/wAA+f8AAAUABQAAAPn/BQAAAAAAAAAAAAUAAAD5//n/AAAFAPn/AAAFAAAAAAAAAAAAAAAAAAUABQAAAPn/AAAAAAAAAAAAAAAA+f/5//n/BQD5/wAABQAFAAYA+v8AAAUA+f/5/wUAAADy/wwABQD5//n/AAAAAAAAAAD5//n/AgAAAPb//P8JAA8ADADz//n/BQAAAPn/AAAAAAAABQAAAAAA+f8FAAUAAAAAAAAADAD2//P/AAAAAAAABQAAAPn/AADz//z/CQAAAPn/BQAAAPn/BQAFAPn/+f8AAAAADAAMAPn/BQD8//z/+f8AAAAAAAAMAPz/AgDw//L/AAAFAAAA8/8AAAAA+v8CAAIABQAMAPn/+f8MAAAA+f8AAAAABQAAAPn/AAAFAAAA+f/5//n/AAAAAPz/AgAFAPb//P8JAAUABQD5//n//P8CAPz//P8JAPz/AgACAAIA/P/8/wIACQAMAAAA+f8FAAAAAAAAAAUABQD8//n/BQAAAPn/BQD5//P/+f8FAAAA+f8FAAAA8/8FAAsAAAAAAAAAAAAAAAAA+v8AAAAA+f/5/wYABQAFAAAA+f/5/wUAAAD5/wAABQAFAAAAAAD5//P/AAAAAAAAAAD5//z/AgD8/wIAAgACAPz//P8JAAkAAAAFAAAAAAAFAAAAAAAAAAAA+f/5/wAABQAFAAAA+f/5/wYABQAAAPP/BQAAAPn/+f8AAAAA+f/2//z/AgACAAIA/P8CAAkACAD5/wIABQAAAAAABgAGAAUA+f8FAAIA9f8CAAIA/P/8//z/9v/5//n/+f/5//z/DAAAAPP/AgACAAIAAAAFAAAAAAAAAAUADAACAAIA/P/2//z/+f8AAAwAAgD2//n/AAAFAPn/+f8AAAUAAAAAAPn/+f8FAPn/+f8AAAUA+f8AAAUAAAAFAAUABQACAPz/+f8AAAAAAAAAAPP/+f8FAAUA8/8AAAsAAAAAAAAA+f/6/wAAAAAGAAAAAAAAAAAAAAAAAAAAAAD5//n/AAAAAAUABQD5/wUABQAAAAAAAAAAAPn/8/8AAAUABQD5/wAABQD5/wAA+f8AAPn//P8CAAIABQD5/wAABQAAAAUAAAAAAPn/BQAFAAAABgDz/wAAAADz/wUABQD5//n/AAAAAAAA8//8/wIAAgACAPz/AgAIAAAADAAAAPn/BQAGAAAAAAAAAAAABgD5//L/+f8FAAwAAAAAAAAAAAAAAAAABQD5//n/+f8AAPn//P8CAAUADAAAAPn/BQAAAPn/DAAFAP3/AgACAAIA/P/8/wIA/P/2//z//P/8//z/+f/5//n/+f/8/wkAAAAAAAUAAAAFAAAAAAAFAAUA+f/5/wAAAAAAAAUABQAAAPn/AAAMAAIA9v/5//n/AAD5/wAACwD5//r/CwAAAPP/8/8CAAIA9v8JAA8AAADz/wkA+f8FAAAAAAAFAPn/+f8AAAwABQAAAPP/BQAMAPn/8/8AAAwAAAD5//n/AAAFAAAA+f/5/wAABQAAAPP/AAAFAAAA8//8/wIA9v8JAA8AAAAAAAAABQAFAAUAAAD5/wAAAAAMAAIA9v/5/wAAAAAFAAIA/P/8//z/8//z/wAACwAAAPP/9v8DAPz//P8IAAIACAAAAAAABQAFAAAAAAAAAAYABQD8//n/AAAAAAAABQD5/wAABQD5//P/AAAAAOz/AgAJAPz/AgD9/wIA/P/8/wkACQAMAAUAAAAAAAAAAAAAAPn/AAAAAAAAAAAAAAAAAAD5//P/BQAFAAAAAAAAAAAABQD5//n/+f/8/wUAAAAAAAAAAAAAAAAAAAAFAAUAAADx/wAA+P8GAAAAAAAFAAAAAAACAPz//P/z/wAABQD5/wAAAAAAAAAA+f/z//z/AgACAAkABQD5//b//P8JABIABQD5/wAADAAAAAAAAAACAPn/AAAFAPP/+f8AAAAA+f8AAAAAAAD4/+v/+v/6//r/+v/4/wQA/f/4//H/8f/4//H//f/9//j/8f/4//j/6/8CAAUAAAAAAAYAAAALAAAAAAACAPb/AAAFAPP/8/8FAAAA+f8AAPn/8P8AAPj/9f8FAPj/+P/4/wUA/f/4//n/6//x/wAAAAD4/wAA+P8AAAAABQD4/wAACAAAAA0ACAD5/wUAAAAAAPj/AQD5/wEA/f8AAPj/+P/9//3/6f/1//j//f/6/+7/+v/x/+v/AQD4//H/+P/9/wQA+P/5//j/+f/4/wAABQD4//r/AAAFAPn/AQD6/wsA9P8KAAkAAQAKAPr//P8JAAwA+P8GAAEA9P/8/+7/AAD6//z/9P/6/+v/6f/x/+H/9P8CAPr//f/9/wAA8f/5/wUA/v/9/wAAAAD4//3/8f8IAAUA+f8BAAUABQD4//n/CAAEAAIA5P/0/wIA5v/z//j/CAD9/xAA8f/w/+H/+f8FAPj/6f8EAAIACgACAAIABgAAAA4AaAAJAPD//f/u/+X/4v/1/2EAHAACAOb/3P/Y/9r/9P/j//D/8f/x//n/0gD9AKj/c//K/xEAwP/Q/6j/cP+4/83/BQBNAMD/CQCMAGkAhAAqAJz/3v+M/57/0QAwAND/+P9B/6n/nv+c/yIAIgABABIADQDB/w0ALQA5ANAAIADQ/wAAoP+w/+j/TQAIAEUAzf/a/+b/mP/q/10A1P8BABIA6f8TAN3/6f+KACMA/f9IANn/Zf+a/4n/zf8FAOX/EQGQALj/tf+o/6X/nf/B/zAAcQD8/xAAJQCC/9n/3f+h/xAAMgAAADAAEAACABAA2//0/9z/PAAYACYARAAdABkAdQAqADAAUQAaAAoAKgCiAL0A2P/p/yEAwP9y/1n/sP56/jH+s/3Y/XX+dP6A/6QA9QDGAYICCAPYAkUDwAJkAnwCkAHkAHgAVQCY/1j/qP8p/+n+Sv5Y/s39lv1g/Wr8X/w0/Lj7QPtv+5D8pf1l/6kAmgItBFIFgAUaBqgF0gTdA7AC1gEWAVUAqv+c/7X/xP/k/1MAewBoAC0A6/9R/8H+Jf4u/cj8WPyn+xr74foI+237QPw7/dX+kgBLAogD7ATNBQ0GzQUtBToEOgPMAcQAHQB+/wT/5v4t/5//BgB5ANIA8ADNAI0A6f/h/k7+oP2//MP76fqK+h36Dfqe+pj78PwJ/+AAyAJvBNIFuAbWBtIGDwYFBd0DaQJCASMAY/+z/oL+yf40/63/QQC4AOIAwwCFAOL/uv4Z/rj92/za+0n7+fqZ+nj6yPqG+9v8t/5TABgCygMcBcUFEAYxBqMFpgSnA3MCPAECABf/Z/4d/vn9V/4A/6D/VwDNABoB5wCnACYAGv9d/i3+q/3B/EP8GPzJ+5370PtD/Aj9i/4KAGABiwLgA9EEDwU1BfcEVQSNA4QCiAFsAK3/Ff/q/sr+6P4t/7n/BAAtAIgAlgA2AMr/mf/c/jL+9v3P/Tb9hvxY/CP8AvxY/N38w/3g/oIAwAGgAp8DgATtBNsEpAQDBFADYgJ5AYEAuv81//T+1v4F/4f/3P8NAHoArQBpABcAzv8s/3X+D/7W/Wn9WPwN/AP8jvu8+zb8Hf10/kAAfQGxAvID/ASkBb4FngX+BDAEKgMEAuIA3P8f/8D+af5n/ur+Vf/m/y8AfwB3AC8A3P86/3L+1v2C/T79lfzH+4b7Xfth+8L7XPyb/bn/eQGvArAD7QTIBVcGMwaVBZIEiANRAuUAi/+I/g7+xv2v/SD+/f7z/68A/QAwAQIBfADO/8T+zP0r/eH8q/wU/F/7IPtK+3b7zfuR/En+swCmApQDNATnBN4FYAYQBvAEmwOmAqEBZAAM/yD+5f37/TX+vP6L/30AFAGbAb8BRQGSAND/zP75/Wr9zvyR/Mz7jvtB+0D7avsA/GX9vP9PAuQDfQTnBLEFdgZYBokFxAMpAgkBIgAC/9X9mP3z/Zz+dP8lAP8A5AFhAnYCtQGLAIz/hP5r/aD83fuP+1n7JvtJ+0j7Wft6+3L8Zf7/AA8D9wN8BGgFnQbjBjYG8AQ4A/4B7gCy/0r+hP2K/eH9cP7w/rf/EAFHAtkCYgJTAUYAaf9E/jz9Sfyo+537bfuA+0b7Cvvv+pH7f/0YAJQC4ANcBDIFigY3B6wGdQXJA4cCVgENAH7+Y/1N/Zb9Df5d/tz+EwDVAfgCCgP8AbUA7P8D/8f9jPy9+7L77vsX/B/83Ptw+xz7HPyj/uAB/gNnBIQEtgVDB1kHCAYnBL0C5AGoAAn/ZP3W/Fj98/1p/sX+p/8rAfgClAP3AmwBMABt/2D+8/ys+z37d/um+5j7qPuy+3v7Kfs2/On+mQLQBOoEuQT9BbEHfweqBXQDIAJQATgAif76/NT8pf1d/tH+V/94AO8BHQNGA34CIgHr/xf/Af6k/Hj7EftO+5X7avt6+7D7ufuT+7P8Kv9PAkcEhQSQBMsFQwcJB1oFYwM+Ao8BbQDY/oD9af01/uH+GP9+/4AA8gETAyIDPALHAKX/7P71/ZT8XfsP+4P7wfvn+xj8cPy+++76fft4/hICwwPEAwUEPAZeCAoI+wUQBLgDAAM5Abz+S/2S/ez93/34/RH/wADqAbQCDgMCAyMCmgBK/y/+Ov1+/O37ovuk++/7ZPzA/Gz8NPvO+mv8IgC/Ah0DGAPzBKsHCAglBicEowNUA3YB5f5o/bL9JP6t/WH9av5MAEUBSAGbAZsC4AJiAUf/Rf7d/QH9/vuQ+9j7Uvyd/LH8+fzB/MD7VPsa/bsA4AL1AocD9wVECLgHnwU4BC4ETQPQAIT+yf12/jv+h/3J/aT/WQGbAVwBJQJHA70CbACh/mL+8/10/Eb7eft2/Mj8Pfww/OL8xPxg+9D6Bf3GAGQCOwJuA6kGeQgEB1oFSAU6BRgDYgD+/vD+sv6Z/Tr9Sf7U/4gAywCFAZsCLwOWAtAASf/S/hD+WPyS+9H7Sfw7/P37IvzH/LP8YPs/+oH79f47AZABuAIHBj8IhAcnBncGXgYPBCUB2P8w/xv+qvyY/JT9mv4Y/xMAfgF0Au0CqwIbAqEAX/9w/jL9XPwB/Mz7Evyd/OD8B/1L/e781Ptu+zb95v8eAaYB+QOSBikHYAZ4BpgG/QSgAvQAzf8//gj9rPwW/d/9y/6y/8IAyAFnArsCgALVAWUAO/9e/jT9nfyC/L38Fv0M/Rn9a/2M/ZL8XPtM+wH9Kv9lAHcB9wNABtkGmwbhBoMGzgTqAnAB3v9G/mX9Ev1P/Z79vv7t/98AmQFXAtICegK+AU4AJP8r/vn8bvxm/DL8QPwS/cX9qP1m/Qn9Efx1+9f8Nf9NAB8BCAREBpkGvQaPB7QGWQSmAlcBrv/t/VX9Ff38/J/9qf6l/0AAJAHkAUUCLgLYAdgAdv+q/sb93fxh/BX8hvwj/Y79iv2G/WT9bfxX+937C/7S/4IAkAKNBa4GzAaJB+wHGAb1A+MCVQHJ/ir90/yF/Hv8j/3+/uT/vQDZAXcCkQIlAo0BXADd/gn+Gv1n/GL8afx+/Eb92P3s/bn9p/3Y/OH7b/xq/vn/pADYAmMF9AVdBlQHQwdgBZADjwKxAIH+d/0p/bX8Av0Z/iP/GQAiAfwBaAKfAkwCjQF5ABr/Jf40/XL8afxw/Fb8Fv3Q/dP91f38/WP9+ft2/Cr+rv9pAJICuQSYBQYG4wbYBosFtwPyAgcBHv8h/rL9C/1I/TD+2f7C/8QAigErAloCKwJwAZgAJf8Q/kP9Vfwq/FH8SfzY/Lj9BP4J/jj+//2U/E38sv0O/+n/eAGjA9gEdwWjBhYH9gWqBJMD2AGP/3z+qP2L/Gv8Pv0b/rr+CwAVAfABaAKSAjECWgE3APP+If4U/ZP8yPyY/OP8uv3R/Xn+0P5W/vj9QP3z/Mj9HP8GALIBgAO9BLMFuwaIBscFkQQBA1gBlP9x/mD9qfzP/G/9LP5O/4EAUwFDAsAChgIKAkgB9P+w/tf92Px0/K/8f/wM/eP9Af6r/t/+Q/73/Ur9v/xe/YL+Z//8AOUCKASDBXsGVgbEBckEOQOaASgA1P7I/UP9Rf2o/Vb+Wv9oAD8BSAK5ApYCWAKwAWAATv9l/iL9dPye/Er8Z/yB/Zf98f3a/lf+zf2M/YT8b/y6/a3+2/9uAq4DnARaBrEG/QWsBXYEjAJRAQUAhf7K/Z39Sv2s/YH+OP8VAFIBKgJuApMCGgJCAWgAXP8Y/l/94/zG/Nj8G/2V/f79cP6g/nD+H/55/aD8wPy4/Z/+AwDyATQDQwSyBUkGBQazBagELQPiAYsAIP8h/pv9Pf1Y/ef9n/55/6oAqAHOARgC+QHZAEYATv8C/n/9/vzV/B79Sf2w/SD+L/5v/nv+Hv6q/af8p/yT/TL+wP96AbYCNwS4BZkG6AbQBtYFrgRAA4UBKQDA/rD9Pv0E/Tj99f3H/rj/JQHHAeQBXgJNAW8A7f83/o/9B/1m/OD80vwS/cj9lv3Q/TP+Kv4f/ff8z/t3/Ib9S/6fAH8BcAP4BCYG0wZfB0AG6QXMBKkCxgEOAI7+L/5x/Tr94P1z/jD/lQCbAboBPAJPAhwB2QDW/yf+xv2x/Ef8f/w8/LP8HP03/Zb9Zv4F/qD97fyT/ED9pv1y/3EAAgIcBFQFhQZRBxMHQQbUBcQDLQL8AO/+K/6w/dH8Jf2w/R7+MP9uAPoAXgETAoAB6gDYAFz/d/74/QD99vzZ/M78S/2A/Zn9Jf5E/ij+i/3v/D79Z/0f/hsAtgB4AoYEOQV6BlEHtQZcBrEFlgM4AtcA1P5N/p79t/xS/YL9EP47/y8A0wBAAbABNQHCAHwAEv9g/qT9r/yt/Gv8cfwF/SD9rv0g/hf+fv55/i79ef2x/Vj9TP9gAAMBwwODBGAFFQfOBnMGNQaaBCAD7gEfAAT/UP4w/UH9bf2X/bL+bv8oABABFgGVASQBsABaACD/dv61/Qj9zvy3/LX8Lv1g/bL9Ef7t/Uf+s/3J/MD9bf0V/mQAmwCQAvUE+ATYBrUHzgb2BtEF0APDAvIAUP+j/lb9+PwZ/R39A/6u/j//QQBkAPAA3gBjAHEAg//C/lP+ev1J/Sj95Pxk/fD9rf18/mX+Dv5+/hD9Hv3g/ST9O/9+AMkAlgNmBAEF0Aa1BiwGQga0BEkDZAJxADj/cP4l/UP9bf1x/Yz+Ff+W/34AlwDaAO4APwAYAIH/jf49/pT9WP1w/TP9gP0F/uz9UP6Q/if+d/66/fj8w/2G/Vj+NQB1AEUC8ANJBLYFSAb6BeEFRgXhAyQDsAH6/zj/wP1n/Xz9U/0w/sn+Uf8iAI4ArgAPAaAAWwAbAB7/wP41/rv9qv1K/W39A/6e/Q/+Vf4I/nj+8P14/d/9wf1E/pr/bACnAZcDJQQ8BTUG5QUOBr4FmQTkA4EC6ADU/5n+3P2B/V39mP3+/V7+Kf+S//L/cwAAACYA6f8f/97+PP66/ZX9YP1I/cH9i/11/eH9mv3y/dj9s/2+/av9L/7D/uf/CwE3AscDeASNBQgGAAb/BVIFhQRxAzMC3ACI/6r+9/2O/ZD9s/3h/WD+8P7//s//2v+Y/08AsP+F/3j/jP6I/j3+zf3t/Qj+xP3Z/f39xv08/gf+Ff5H/hn+yP51/1kA0wHsAhcEEAWwBQIG7wWIBdcELwT3Au4B1QB8/+D+P/6L/av9hv2B/Qf+X/60/k//dP+Z/wMAwP+c/2H/yf6W/iT+zf2a/Zn9dv1N/Zb9lP3p/Qv+Gf5Y/mb+Cv9//3AAqgGCAt0DoAQhBeMF1wWBBUoFPASAA3gCKgEyAEH/mf7n/bH9hv1s/eD9HP5z/gD/Ov9//8n/wv+a/5v/H//7/tf+af40/i7+zP10/Yj9YP2C/XX9nv1v/b39mf6Y/ngAUgH7AWoETQQ2BWEGqwX4BUkFIwTXA1wCWgGNAEj/yv4V/p39iv1T/X/9oP3s/Sr+hP6u/uv+OP8f/1//WP/6/j7/ov52/m3+C/7p/cH9wP32/eb9E/4k/gH+/v7u/vD/JQGHAf8CzwOCBDYFGAUxBe0ETQSpA8YC4AH8AA0Aaf+l/jf+0P2h/ab9m/0B/jb+gP71/gv/bv9h/2//o/9h/07/Pv8C/9H+rv50/nf+P/5j/kn+RP5y/kf+v/74/nn/PAAQAfkB8ALjA1sEEAX9BL0EvwTKA00DiAJzAewA9P8v/7j+A/7G/ZL9Zf2d/Zj95v04/lb+uP4D/wL/V/9W/y3/bv8s/zT/Hv+4/oj+SP5D/k/+Uv5o/nz+oP64/kr/of9FAGkB8wFmA0kEugTlBUkFSgXwBPADgQN/ApUB2AD1/zj/j/4A/qL9Yv1B/U/9ZP2b/eX9Af5m/sD+0f5A/1D/Rv9w/zT/L//K/oL+FP7s/RT++v1Y/kX+ff67/mb+Kf80/7L/LgFaAQ8DDwRiBNEFLwUwBQ4F9gO2A8EC9gFGAVgApf/W/kf+vf1h/TX9If0r/Vr9q/0F/kj+yP4H/2T/s/+o/8j/vP+A/zv//f5h/kP+UP4b/l/+KP5R/nv+IP7m/ur+gv8ZAVQBJwPuAyQEeAW4BB0F3gTfA90DrQL4AWABLwCA/6P+C/6A/Tb9IP0Z/Vz9mv3h/T3+nP7j/kb/i/+Z/7//zf+k/23/Sf/P/rL+pf6k/sT+uv7E/uj+wv4x/zP/v/8cABgBBwK/AnMDxANZBGoELwQxBIUDKAOZArwBOQFUAJH/3f4w/tD9Y/1M/Tz9VP2V/b79E/5f/p3+8/4+/4T/kP+b/7D/Y/9I/xb/vf7G/q/+kv7F/rP+tP6+/q/+1/5H/4H/sABZASwCMAM7AzwEQAQPBG4EqAOGAx0DHwLWAecADAB4/63+Of7A/Yb9e/1j/ZH9w/0Z/mb+yP4o/1X/t/+Y/7f/n/8j/y3/0P5//pn+R/5X/n3+Uv5y/qn+h/4g/z//5/8sAW0B2gJFA3ADmAQZBI8EfASdA8QD2wImAsEBnAAGADf/c/4P/pn9Zv04/T39av1+/e39Iv6I/tb+Fv91/4L/xP+M/13/av/5/uv+4/6h/sP+6/69/gj/Dv/2/pb/ZP9YACABbwG+AtYCWAMQBNEDVgQLBIgDhQO2Aj4CsgGkAPv/Of+W/ij+mv1x/VD9Sf1u/Z79yf0n/nD+p/78/ij/Wf9U/0v/Lf8Y/9z+sP7O/pX+tv7U/qv+8P7f/gD/cP+v/2EALQGpAagCIgNuAzEEJQSIBE0E3APBA/8CdgLHAcQABwBM/5j+Hf6O/VD9LP0Y/SD9Uf14/cD9IP5U/rL+9P4Y/0P/U/8u/zf/IP8G/yj/5P4B//H+3P4Q/xz/Uv+x/xEA1QBeAQMClgIMA2ADuAPZA9gDmQNlAwUDgALyAS4BcADA/yD/hP7+/bD9c/1m/U79hf2q/cn9K/5F/pX+2P7p/hf/K/8p/yP/Jf8d/xj/T/84/z3/Uf88/17/bP+X/wQARwD+AIYBEgKzAvcCTQOoA6MDsANvAykD4AJQAs0BFAFZAL3/Lf+n/lj+6P3L/cj9lf29/bH97P0r/jD+dP6r/sj+3f7q/vD+3P7p/tT+1/7o/uP+2/72/gX/QP+I/8P/PwC+AH0BGwKEAiADYQOtA8YDvQOgA1kDAQOAAhECTQGeAMr/PP+0/kD+9P2h/af9hv2B/bX9zP0U/jT+bP69/tn+Df8c/zH/Ff8I/w3/7P71/uH+xv4E//T+QP+l/+P/dAD0ALIBUwKvAkQDewO3A7MDfwN/AwgDugJTAp0BEwFOAMj/Nv+p/kj+4v3V/Zz9gP2Z/ZD90f3n/RL+UP5j/pn+ov6w/r7+wP7Y/t/+7/79/gb/K/9O/4n/zP8KAIEA7wByAeYBSgKzAv4CJANVA3QDaANFA+QCpgJCArUBMQGkADAArf8t/9f+ef44/vj96P3O/cb9y/3d/fX9B/4n/kL+Vf5i/oD+kf6x/sb+1P4G/yT/U/+A/7T//f8zAJQA8wBZAbkB/gFQApcCtwLaAtgC0QKgAk0CEAK4AVUB2ABwAAgAk/8s/+H+kf5D/hv+/f3d/df92v3l/f/9D/4i/kP+WP5y/pr+sP7U/gD/Kf9R/4P/nv/S/xoAUwCYAPUASAGUAdwBIQJgAogCnwKqAqUCjgJgAjEC6QGVAT4B0wB1APz/jv8y/8j+a/4i/vL90P2u/Z79sv3K/df9+P0t/mX+l/7c/iv/Xf+w/+r/GABYAGQAkADLAOkAEAEsAVoBhwGVAaQBxgHZAd4B2QHYAa4BjwFaAR8B8gClAHAAHQDg/5//VP8e/9b+ov5v/kX+Lv4L/g7+Av4U/hH+JP5I/mn+pf7I/gP/SP99/8f/5/8qAF4AfAC9APAAGgE5AWcBiAGfAacBuAGzAb8BngGLAWoBSAEnAeYAxwCTAGMALADw/7b/dP9B//7+1f6r/of+aP5Y/lf+Q/5Q/lf+b/6K/qP+2/7//jH/cP+e/9f/BABAAGcAnADKAPIAFgE9AWkBdQGAAYMBgwF8AV4BTgEyAQQB7QC+AKIAcwBBACUAAgDo/77/m/96/1L/Of8X//3+1/7E/sn+vv7A/rf+uP67/rH+2P7z/gv/KP9G/4P/of/Q//n/JQBQAIQAuQDnAA8BKQE/AVsBYwFgAVcBQwEuARAB6wDIAJsAbQBMACQAAADr/9H/zv+x/5P/jv+B/3j/YP8//zj/KP8V/wn/EP/7/v/+8P7w/vn+Dv8d/0X/cf+O/8H/+P8fAE0AfgCvANAA9AAZATsBPQFJAUoBQAEsAQoB7gDBAJQAZwA6ABgA+//M/7L/n/+Q/4j/iv+E/4b/fP97/3j/cP9q/1z/dP9v/2H/Yf9Z/2L/Xv9o/3P/hv+T/63/zf/e//v/LwBTAHMAiACcAMAAyADRANgA0gDRALoApwCFAGcAWAAwABcA/v/f/9D/v/+w/6j/sf+b/5z/n/+l/6j/sP+0/73/xP/C/8X/0P/K/87/2P/T/9//5f/t//j/CAAHABgAKwAvAD0AQwBYAGYAawBqAGoAaQBoAFUATABBADIADQD5//D/4P/P/8j/u/+j/6z/rf+q/6j/rv+w/7P/wP+//8X/zf/U/9f/4v/q/+X/7f/s/+j/6f/s/+//8v/6//n//v8KAAsAEwAUAB8AMAAvADAAKwAwAEIALwAmAB4AIQAbAAcAAAD///D/3//b/+T/4//e/9j/3f/i/+P/3f/m/+j/7v/w//3/+P/7//3/CAAKAAYAFAAZABEAFAAOABQAFAAQAAoACwABAPr/AAD4//b//P/2//f/+P/7//n/BAD///b/DAD5//b/+f/s/+7/7v/t/+7/7//i/+H/4//u/+T/5f/w/+j/+v/7//z/+P/+/wgAAgAJAAkABAAGAAgABAAIAAgA/P8AAP//BAAJAAwABQD0/wQADAAFAP7//P/z/+7/+P/5//L/4v/w//z/7v/v//z//P/1//T/AQD/////AwACAP//AQAMAAgAAwADAAUACAAGAAAAAgD6//b/BAALAPz/9//y//P//v8DAP7/+v/8/wEAAAADAAAA/v8AAAIAAwAAAAIA///5//v///8CAAAA+P/7//T/+P/1//D/9v/1//7//P/0//3/+P/z//z/+f/0//j/+P/9//j/7/////n/+f/8/wEAAwD+/wIA+P/+/wAA9///////AAAFAAQABgD6//f/8//4//3/AgD0//T/+f/5//b/+f8DAAAA/P/2//3/AAAAAAIAAQABAPr/AAAAAPv/AAD7//T/8f/2/wcAAgD2//j/9P/8/wsACAD+//z//P8AAAQAAAD//woABAD///3/9f/7/wMABQD+//r/BQADAPr/9f/5//f////4/+3/9P////7//f/6/+7/+P/5//j/+f/1//n/AAD3//b/9//2//b/+f/6//T//P/9//T/9f/2//r/+P/3//z/+f/8//z/AQD///7//f/3/wcAAwD3////AAAAAP//+/8DAAAAAAAIAP7//v/9//3/CQADAP///P/3/wAA///8/wMA///6/wAAAQAAAPz/AwAIAAQA/v/6/wAABQD+//r/AAD8/wIA/v/z/wAA//8AAAEAAQADAP//9v///wwA/v/8/wEAAAAFAAIA+f/9/wMA/v8BAAAA///9////AQD9//z//v8BAAYA///5/wAACAABAP///v8BAP//+/8AAAMA/v/6//3/AQAAAP////////3//P8EAPz/AQAFAAIABgAAAP//AAACAPr/+P////7/AAD//wAAAgADAAAA/v8GAP//9//9/wYAAgAAAP7/AAD7//v/AwADAPn/AQADAP//AQD+/wAABQAIAAMAAAD9//f///8CAP7/+//5/wAAAwD7//v/BQABAAAABQD5/wAAAwD///z//v8CAPn/+/8EAAEAAwADAAAA/f/8/wUAAAACAAAAAQAAAP//AAD3/wEA9f8AAAsA+v8BAAIAAAD9/wAABQAEAPz//P8AAPz/AAAAAP3///8BAAEA//8AAAIA/P/9/wMABAD9//j//v/+/wAA/P8AAP//+v/9/wYAAQD7/wAA+P8AAAMA///+//z/BQAAAPf/AgAEAP7/BAABAAAAAAAAAAYA/f8AAAAA//8EAPz//v8CAP7/+f/+/wUAAwADAAMA9v/8/wMAAAAAAAEA/v/4//f//f8AAAIAAQD//wAA/v8AAAYABQAAAAAABgAAAAEA+v/4/wAAAAD9//v/AAD+/wAA/v8EAAkA/f8DAPz////7/wcABQD6/wAA+f8AAAIA/f/8/wcAAQABAAIAAAADAAAA///6//7//P8FAP7/9//9/wUABQD//wQAAAADAAUAAAD3//z/CAAEAAQA+v/1/wMAAgD1/wAAAwAAAAAA/v8BAPf//P8AAAAA/v/8/wEAAgADAAEAAgAAAP3//v/+/wAAAgACAAAA/f8IAP7/AAAFAAEA/f/+//j/9v8EAAUA8/8AAP3//f///wEA/P/7/wYAAAD7/wQA///9/wYA/v8AAP//AgAAAP3/AwABAAMA/P8BAP7/AAD+////CAACAPj/+f8HAAgABAD2//n/+/8BAAMA/P///////v8DAPv///8FAAUA+v/9/wEA///+/wYAAwD3//7/AAD8/woABgD4//7/BQABAPn//v8EAAEA+//4/wUABQD4//P///8AAAAABgAAAP//BQD///T/AgAJAP3/AQAEAP7/+P/5/wYA/P8AAAUAAAAAAPn/AQAGAP//AgACAAAAAgAAAPf//P/8//X/BgD1//j/CQACAPz/AAALAAAA/P8AAAMA/P8EAPz/9v8FAP//+f///wkABAD7/wEAAgD8////AQACAPX/+v8CAAAA+v8AAAEAAAAFAAUABQAFAP//9/8FAAAA/v/8//n/BgABAPv/AwD9/wEAAAD4/wMA///8//z/AAAJAAYA9//8/wkA+//8/wQACQD///z/AgAAAP3/AQADAAAAAwD7//v/AgACAAAA/v/9//7/+v8HAAMA8v8CAA0AAAABAPv/AAD9/wQAAwD6//z/AAD4//b/CAAIAPz/+/////3/AgAAAP3/AgAAAPz/AQAAAAMA/v8EAAAABQD1/wEABAABAPr/+f8EAAAA+//0/wQA/v8AAPb///8JAPz/BgADAAMA//8EAAUAAAACAAIA/v/+//z/+/8GAPz//v////r//P/6//7//v/5//r/AAAAAAAA+v8CAPz/+/8NAAAA+/8FAAQABAD6//v/CwAEAP//BQD4//7/BAAEAPv//f8LAPb/AQD6/wAAAgD///j/+v8BAO//+/8GAPz/AAACAAIA/v8AAAQAAQAHAAkAAQAAAAgAAAACAAsAAwD7//r/+v/9/wAA9f8CAPj/AQD9//r//f/9/wEA/P/5/wQABAD2/wYABAAEAAEAAgAFAPX/AQAAAAAABQD5/wQABAAAAAAAAAAGAPv/AAD4//7/AAD2//r//v8GAAUA9f/9/wMACgAEAP3/AAAEAAMA+/8DAAgADQD3//v/BwD7//v//////wEAAwAAAAAA+f8BAAAA/f8AAPz/AQD+//j/AwD9/wAABgD7/wEAAAD1/wAACAADAPv/BAD+//j/BgABAPv/BQD8/wEABAD9//7/CAAFAPH/9v8CAAUA/f8DAAgAAAD3/wIA/v/5/wYAAQD8/wEAAAD+/wkAAwD5/wAABgABAAEA+//5//7/AgD3/wYAAQD9/wEA+f/9/wEABAD0/wEABgD6//r////7/wkAAAD6/wsABAAEAAMA+f/1/wUABAD///r/AAD6//r/DAD5////CwD6//r/BAAKAAEA/v/2//v/BAADAP//9P8AAPr/AAAAAPr//f8BAAgAAAD6/wIACwAFAPv/+v8LAAQAAAD6/wAA+f8FAAUA+f8GAAAABQACAPz/AgD8//3/+P/0/wAA//////L/AAAAAPf/AwACAAIA/P8HAAsAAAD6/wAAEQAEAP3/+v8AAAUAAAAAAPr/BgD5////CwD6//T/BgD5////CwD5//r/AADz/wQACwD6//v/9/8IAAoABAAAAPX/+/8GAAUA+P8EAAsAAAD6/wYAAAAAAAAA+v8AAPn/AAAFAPP/AAAAAAAA+v/9/wIA/P8IAAEA/P8JAP3//f8IAAUAAAAAAAAABQAAAAAABQD6//r/AAAEAAoA/f/5/wAA+v8FAAUA+f8AAAAABQD6//r/AAAGAPr/+v8AAAAAAAAAAPr/AAAAAPb/CAAFAAUABQD5/wUABQAAAAIAAgD2/wMA/f/8//z/AgD2//P/AAAAAPT/9v8IAAEABQAAAPb/CQD8/wkAAAD6/wUABQAEAAUABgD6//r/BgAAAAAA//8FAAAA+v/5/wAAAAD5/wAAAAAAAPr/AAAAAAAABQAFAAAAAAAAAAAAAAD//wsA/f/6/wYA+v8FAAEAAQAJAPD/9/8AAAAA+f8AAAAAAAAGAPr/+v/5/wUABAAAAPr/9P/9/wgABQD//wAAAAAGAPr/+f8LAAUA+f/6/wAAAAD5/wAAAAD5/wUAAAAAAAAAAAD6//n/AgAFAAUA+f8AAAYAAAD5/wUACwD5//P/AAD6/wYA8//9/wgAAAD5/wsA+f8AAAwAAAAAAAUABQACAPb/+v8FAAAAAgD2/wAAAAD5/wAAAAD6//r/+f/8/w8ABQDz/wAABgAFAAUABQAAAAAAAgACAP3/9v/6/wUAAADz/wAAAAAAAAAA8//9//3/AgACAAIAAgAIAAUAAAD6/wAAAAAAAAAA+f8AAAUAAAAAAAAABgAAAAAADAACAPb/+v8FAPn/8//6//z/AgACAAIAEgAAAPr/+v8AAAAAAAAAAAAAAAAAAAUAAADz//r/AgAFAAAAAAAAAPr/AAAFAAAAAAAFAAAAAAD6//r/BQAFAAAAAAAAAPn/AAAAAPP//f8CAAUABQAFAAAAAAD5/wAADAD5//n/+v8AAPP//P8IAAIAAgD2/wIACAALAAwA+f/5/wwAAAD5//n/+v8LAAAA+f8AAAAAAAAAAAYABQAAAAAABgD5/wAABQD5/wAA+f8AAPn/+f8AAAAAAAAAAAUA+f8AAAAABgAAAPn/DAAMAPb/+f8GAPn/AAAAAPn/8/8CAPz/CAAAAP3/BgD5/wIABQAMAAAAAAAGAAIA+v/z/wwABQACAPz/9v8AAAAA+f/5/wUA+f/5//n/AgAAAAAA/P8CAAYA+f/9/wgABQD6//n/AgAFAAYABQAGAAIACAAJAAIA9v/9/wIA8P/2/wAAAAD5//P/9v8CAPz/AgACAAIAAgD2/wIACQAIAAUABgAAAAAABQAFAA8AAgD2//b//f8CAPz//P/8//b/AAD5//P/AAAAAAAAAAD2/wIAAgD9/wIACQACAAAADAAFAAUAAAAAAAIA/f/9//z/AAAAAPn/AAD5//n/+f8AAAUA+v8AAAYABQALAAkA9v/9//z/AgACAPb//P/5//n/AAD5//P//f8CAAIAAgACAPz/AgAJAP3/AgACAAUADAAAAAAA+f8AAAwA+f/5/wAABQAFAPP/AAAGAAAAAAAAAAUA+f/5/wAA+f/5//z/CQAAAPn/9v8JAAkA/P8CAAIAAAAFAAAABQAAAAAABQAAAAAAAAAFAAAAAAD5//P/AAAAAAUAAAAAAAUABQD6//n/AAAAAPP/AAAFAAAAAAAAAAAAAAAAAPP/BQAFAPn/AAD5/wAADAAAAPn/AAAAAAAAAAAFAAUA+f/5/wAAAAD5//n/AAAAAPz/AgACAAAAAAAAAAUADAAAAAAAAAAAAAUA+f8AAAUAAAD5/wAABQAAAPn/+f8FAAAA+f8AAAAA+f/5//z/DAAAAPn/AAD5//z/CAD9//3//f8JAAsAAAAAAAUABQAAAPn/DAACAPb/AAAAAAAAAAAAAAAA+f8FAAAA8//5//n//P/8/wIACQACAPz/9v8CAAIACQAMAAUABQAFAAAACQAJAPz/9v8CAPz/9v/2/wAA+f/z/wAA+f/8/wIA/P8CAP3//P8JAAIAAgD8/wIACQACAAAADAAFAPn/BQAGAAAAAAACAP3/AgD2//n/BQAAAAAA8v/5/wAABgAAAPn/AAAAAPn/AAAAAAUABQAAAAUAAAD5/wUAAAAAAPn/+f8FAPn/AAAAAPn/AAAFAAAABgAAAAUAAAD5/wUAAAAAAPn/AAD5//n/AAD5//z//f8CAPz//P8CAAkACQD8/wIACQAFAAAAAAAMAAAAAAAFAPn/AAAAAAAA+f/z//n/AgAAAAAABQAAAPn/BQD5//r/AAAGAAAA+f8AAAAAAAAFAAUA+f8AAAUAAAAFAAAAAAAJAAIA9v/2/wIA/P/5/wkA8P/5/wUA8//5/wAAAAD5/wIAAgACAAAAAAAFAAAAAAD5//n/AgAAAPz//f8JAAIAAAAAAAAAAAAAAAUAAAAMAAkA/P/8//b/AgACAPD/AAAAAPn/AAD5//n/9v8CAAkA/P8CAAIA/f/9//z/CAADAAIACwAFAAUABQAAAPn/+f8FAAUA+f8AAAAA+f8AAAUAAADz//n/AAAFAAAA+f8AAAUAAAD5/wAADAAAAAAABQD5//n/AAAAAAAAAAAFAAUA+f/5/wAABgAAAAAABQD5//P/AAAAAPP//P8CAAIAAgD8/wkAAgD8/wIAAgAMAAwA+f/5//n/DAAFAPn/AAD5//n/AAAAAAAAAAD6/wAA+v8CAP3/AwADAPb/CAAJABMAAAAAAAUA/P8CAPb/+f8FAAAAAADz//n/AADz/wIAAgACAAIABQAAAAUAAAD5/wAAAAAFAAAAAAAAAPP/+f/8/wIAAgACAAwABQAAAAUAAAAAAPn/8/8FAAAAAAAFAAAA+f/5//n/BQAAAAAABQAAAPn/AAAAAAAAAAD5/wUABQAAAPn/8v8AAP3//P8DAAMAAgACAAUAAAD6/wwA+f/5/wUAAAAFAPn/+f8AAAAAAAAAAPn/AAAMAAAABQAAAAAAAAD5/wAAAAD5/wAAAAAAAAAA+f/5/wAAAAD8/wUADAAFAAUA/P8CAAIA/P/2//P/+f8FAAUA+f8AAPn/+f8AAPn//P8CAAIACQAMAAAAAAAAAPn/AAAGAAAAAAAFAAUA8//z/wUABQD5/wAA+f/2/wIAEgAFAPP/AAAMAPP/+f8FAAAAAAAAAPn/+f8FAPn//P8FAAUABgD5/wAAAAAAAAAABQD5/wAAAAD5/wUA+f8AAPn/+f/8//b/AgACAAkAFgAAAAAAAAAAAAAA+f8GAAAAAAAAAAAA+f/z//3/AgAFAPn/AgAAAPz/DAAAAPn/DAAFAAAABgD8//n/AAAAAAUAAAD5/wUA+f8FAAYA8v8LAPn/8v8FAPr/+f8AAAAAAAAAAPn/9v8CAAIAAgD8/wIAAgD8/w8ABQAAAAUAAAAAAAwACQD8/wIAAgD2//b/9v8CAPn/+f8AAPn/+f/5/wIA/P/8//z/CQAPAAAAAAAFAAAABQAGAAAAAAAFAPn/AAAAAPP/8/8CAAUADAAAAPn/8/8FAAUA+f/5/wUADAD5//n/BQD5//n/BQAFAAUA+f8AAAUABgD6//P/BQAAAPn/AAAAAAAAAAAFAAAAAAAAAAAAAAAFAAAA+f8AAAUAAAAAAPn/+f8FAPn/+f8AAAAABQAAAAAAAAAFAAAAAAAFAAAABgD5//n/AAAAAAUAAADz/wAABQAFAAAAAAAAAPn/AAAAAPn/AAAFAAAABQAMAPb/+f8FAAAA8//z/wIAAgAFAPn//f8MAAAABgD6/wAABgAAAAsAAgD2/wAAAAACAPn/+f8AAAAA+f/z/wIAAgD8/wIACQD8/wIABQAFAAAAAAAAAAAABQAAAPn/AAAAAAUABQAAAAIA/P/5/wUAAgD2//n/AAAAAPn/8//8/wIACQD8//z/CQAAAAAABQAAAAAABQD5//n/+f/8/wIAAgACAAwAAAD5/wUAAAAAAPP/AAAFAAAABgAFAPP/+v8GAAAAAAD5/wAAAAAFAPn/+f8FAAUA+f/z/wwADAAAAAAAAAAAAPn/AAAAAAAAAAAAAAAAAAAAAPn/AAAAAAAA+f8AAAUAAAAAAPn/+f8FAAUA8/8FAAUA7P8FAAwABQAFAPz/+f/z//n/9v8CAAwAAAD5/wAABQAAAPn/DAAAAPn/DAAJAPz//P/2//n/BQAAAPn/8v8FAAAA7f8DAAsAAAD5//r/AwAFAAYABQAMAPz//P/8//z/AgACAPb/+f8AAPn/+f/5/wAAAAAAAAUA+f/5/wAAAAD8//b/AgAJAAIA/P8JAAUABQAFAPn/+f8AAAUAAAAFAAwA9v/5/wAADwACAPD//P8AAAAA+f8AAPn/+f8AAPP//P/8//z//P/8/wkACQD8/wIADwAGAAAAAAAAAAUABQDz/wUACwDy/wYABwD9//b/+v/5/wAABQAFAAAA8/8AAAAA7P/8//z/AgACAPz/DwAMAAAAAAAFAAUA+f8AAAwA/P/8/wIAAgD8//b//P/5//n/BQD5//P/AAAFAPn/AAAAAAUAAAAAAAAABQD5//n/AAAAAAAA8//8/wIACQAAAPb/CQD8/wkAAAD8/wUABQAAAPP/BQAMAAAAAAAAAAAAAAD5//n/BQD5/wAAAAAAAAUABgD5/wAABQD6/wAAAADy/wYABgD5////AAANAAUA/P8DAAMA9f8CAAMA/f/v//n/+v8AAP//8/8DAPb/9f/8/woAAgABAAkACgAGAPj/BQAAAAAABQAAAAAA+f/5/wAAAAAGAAAA8v8AAAYA+f8AAPn//f8MAAAA+f8AAAYAAAAFAAAA+v8AAPn/+f8AAAAAAAAAAAAABgAAAAAABgAFAPP/8/8AAAAA+f/8/wIABQD5/wIAAAD8/wwABQAAAAUA+f8FAAUA+f8FAAAAAAD5//n/DAAAAPn/AAAFAAAA8/8AAPn/AAAFAPn/AAD5/wAAAAD8//z/CQAGAPn//P/8/wIA/P8PAAAA+f8MAAUABQAAAAUAAgD2/wIA/P/z/wAADAD2//n/AADz//n/BQD4////AQABAP///P8DAAQAAAD5/wIA+/////7/AgAMAPv////6/wAA//8AAPv/AQD4//7//P/9/wIAAAAAAPb/AwAHAAIA9//8/wQABQD6//f/AgAAAPb/+v8AAP7/+/8CAAEA//8IAAQA+//8/wYABQD///n/AAANAPr//f////3//v8DAAIA/v8EAPz////+//f/AAAAAPn/+P8GAPr//f8PAP3/AwACAAAA+//7/wAAAAD8/wIACQD2/wYACQD9//3//f8AAAAAAAD+//D//P8BAPH/+/8HAPz/+f/+/wEA/v/2////8/8CAAcAAQAGAAsACQAGAAYACgAUAAAA+/8DAPv/AgAAAPj/AAD///z///8DAP3/AAABAAAAAAD3/wAA+//7//v/9v8AAP////8DAAAAAgAHAAgA/f/+//7/+//8/wcAAQADAPv/+v8BAPj/9P8AAP///v8DAAEAAQAAAAEABgABAAgAAQD8/wAA/P8DAAAA9/8DAAYAAgABAAAAAgAAAAAA//8FAAIA+//3//n//P/6//v/8v/4//r/AQD5/wEADAAMAAQA/f8MAAYACgAJAP7//f/2/////f/8//v////+//f/AAD+//z/AAACAP7/+v///wUA9v/7////BAD8//3/AgABAAIACAAFAPf/CwAIAPn/9/8EAAYA/v8AAP///P8DAAAA/P8DAAEABwAEAPr/AAD6/wAA/v/+//r/9f8AAAAA//8AAAEABwAIAPr/+/8PAAUAAwACAAAAAwD6//7//v/+/wAA+/8BAAUABAD7/wEABgAAAPr/+//5//n///8AAAAAAAD+/wAA//8DAPz//f/9//z//////wEABAACAAEABQACAAEABQABAAMA/f/8/wIA+v/+//n//f/+//v/9//6////AgAAAAAAAQD//wQAAQAAAP7/BQD////////+/wcAAAABAAYABgD3//r/BAACAPr/9/8AAPv////+//3/AAD7//3/BgAFAPj/+/8AAAAAAgD+/wEA//8DAAEA/f8EAAoABAABAAEAAgD+//n////4//T/+v/+/wEA+P8CAPr/9v8GAAEA+/8DAAAAAgAEAAEAAAABAAQABwAFAAUAAgD//wEA8//7////+f/8/wEA/v8CAAcABgACAAMACAD+//f//P/+/wAA+//6//n/+v/2//n///8EAAMA/P8AAAUACAACAAoABgACAAkA+v8BAAMABQD///z/AwAAAPr/8f/8////+f/7/wIA/P8FAP////8AAP3/+v8EAAoAAQD3/wUABQD6/wAABAALAAAAAwAAAAAACgD9//7/AgAEAAEAAAACAAYAAwD2/wEAAgD2//L/+/////f//f/+/wMAAAD2/wAAAwABAAQABQAPAP//+P8BAAAA/f/6//n/AQAFAPX/AgAGAPz/AAAEAAUAAAD+//f//f/5//3/AwACAP//9v8AAP//9f/8/wAA/f/+/wUABgD3////BQD8/wIACAAFAAAA/v/8/wgAAwAAAP7/AAD//wAAAAD9//r/9f/2/wEAAwD7//j///8BAP3//v///wEABgD5/wMACAD7/wEACwAHAAEACwACAPv/BgD+//f//f/7/wAA+f/7//v////7//T/AQD//wcABAABAAsAAQD//wcACQAIAAYAAADz//3/AAD8//r/9/8FAPz/9f8DAAAAAQAGAPv/9P8DAAAA///7//v/+//7/wAAAAADAAYAAgAIAAAACQAHAP//CAACAPr/8/8AAAQA/f8BAP/////6//j/AAD///T/+/8DAPj/9v/+//7/+f8BAAgABwAGAAMABQAIAAAABwAEAP//AQD+/wIAAwD8/wMAAgACAP3///8AAP7//f8AAAAAAQD4/wEAAgD5//r///8FAPr/AAABAP///f8EAAQABQD+//3/+//5/wMABgAEAAIA9v/2/wEA/P/1/wUA/P/8/wMAAQAAAAIA///4/wMA///2//v/+/8BAAAA+//8/wQAAAADAAQABAAFAAAAAgAAAP7//f/6//X/+f/4//z/9v/+//z/+v8AAAEAAwD7/wAA//8HAAUACAAIAAIACQD7//z/AwD7//3/BgADAPj//f8HAAEABAD5//3//v/7//b/+P/9/wcA/f/8/wAA+//+//7/+v8AAPv/AAAHAAMAAgAJAAoACAADAAIAAQD2//v/BgD7//v/9/8CAAIA9/8AAPz/+//+//3/+v8AAP7//f/8//j/+////wIA/P/2//n/AQADAAQABgADAAMABwADAAcA/v///wsA/f/8////AAD7//X/AwADAPz/AQD7/wMAAwD+////+v8HAP7/+//+/wAA+f////3/+//+/wIAAQABAAYABQAHAAIABQALAAEA9v8CAAoA/P/9/wUAAAD//wAAAAAAAAAA//8BAAAA9P/3/wMA///3//f/9v/7//7/AAAAAPz/BAALAAIACQAOAAIAAAAIAAMA+/8BAAgAAgD+//7////+//j/+P/6//z//P/2//3////0//r/BgD///z//P/+//z/AAADAAAA/v/6/wUAAgD8/wEA//8AAAAAAAABAAAA/v8DAAYAAQADAAcA/f/6//3//P/7//j/AgABAAAAAAD5/wcABQAAAAAABAAEAAAAAAD+/wYAAwAIAAwAAAD7//z//P/6//n/+f/2//v/+v/8//n//v8DAP7/AAD5//j/BgAEAPv/AgAFAPv/AAAAAAYAAgAAAAUAAQAGAAEA///9/wMA+f/9//3/8v/6//r//v8AAP7/AAAAAAMAAAABAP7/BAAHAAgAAAD6/wMA/P/7/wIABAAAAP7/AAABAP7//v/9/////v/9//z/AAAEAAAA/////wIAAQD7////AAD0//T/9//5//7//P8AAAAAAwADAAAABwALAAgABQAIAAUAAAAAAP7///8CAP7/CAAMAP3/+v8EAAQA9//3/wAA/P/z//3/AAD+/wIAAgD+/wgAAAD8/wAA/f8AAAAA/f////v/CwAHAPv//P8FAAQA/P8BAAAA//8DAAIAAQAGAP7//f8CAAAA9//9//r/9P/+//v/+//8////BAD6//7/BgAFAAIA/v8HAAYA+P8AAAYA/f8BAP7/+v8DAAUA/v/6/wMACAD6//r/BAD8//j////9//3/9/8GAP//9v///wAAAAAGAAAAAAAIAAYA+P8CAAcA+/8GAAoACAD/////AAD8//j/AwAEAPz////+//7//f/z/wAAAwD6//3/BAAAAAAABgADAAQAAgABAP///v/+//j/AAD6//X////+/wMAAgD3//r/AwD+//3/BAD9/wEAAAD+/wAABgAAAAAAAQAAAPr/+v8FAAMA+//9/wAABwD///7/CAD//wQAAgD7/wQABgD+/wIACgD7////BAAAAAEA9v/7//v/+P/9//b/+f/6/wMAAgD7/wUACwACAP//AQAHAAQAAwAIAAEA+v/7/wQAAQD5/////v/4/wAA9f/4//z//v8AAAQA+f/2/wAA/f8AAAEAAAABAAkACgAAAAcAEwAFAP///v/8//3/9v/5//3/9//6/wAA+P/8/wMA+v/5/wIA+P/9/wYA9//5/wIAAwABAAMABQAEAAgAAQABAAkACAAIAP3/+v8CAPP/9/8BAP////8CAAIAAAALAAAAAAAEAAAA+v/7//n/+v/5//P//f8AAPn/AwAAAPX/AgAGAAMAAAACAAgABgADAAAA+v8CAAYA//8CAP///f8AAPr//v/6//7//f/6//v/+v8CAP3/AAADAP7/BAAAAPn/AAAEAAEA/v8DAAYA/v/6//3/AQD6//r/AQD7//3/AgD7/wAA//8DAAkAAAACAAwAAAD6//n/AAAAAPT/AQAEAPz//P/6//3//v/8//v/AAAAAPv/AAAMAAQABgAMAAQAAgAGAPz/AAAHAPb/+/8GAP///P/8/////f8CAAAA///9//7/BgD+//3/AAABAAIA/P/7/wAA/v8AAAoACAD//wQAAwAFAAcAAQABAP///f/1//P/+v/7/+//9f/8/wAA/P8AAAMABQABAPz/AAD+//7/AQABAP3/BQAAAP7/BQD+/wkAAgD6/wIA/P/5//z/+//8//f/+v////r/+//6////CAAEAPz/DAAGAPb/BwABAPP//P8FAAQAAAAAAAQABwAFAAAAAgAFAAUACAD///z/BgD9//v//f8BAP//+////wQA+v/+/wEA+v/7/wYAAgD4/wEABQD9/wAAAwD///7/AQAGAAYA/P/6/wUAAAD6/wIABAD//wMA+v8FAAgAAAACAAQA///9/wEAAAD9/wAAAgD6//7/AgD8//z/AgABAAAAAAD+/wAABgAAAAEA///8//r/AAAGAAAA+v/6//3/AwABAAAAAQACAP///f8AAAEA//8CAAIAAAD6//7/AwAAAAAA/v/+/wMA///+/////f/9/wAA/f/4/wMABgACAPz/AQAAAP3/AgD8//3//P8AAP3/AAD7//z/AgAAAAAA/v8FAAMABAALAPz//P8GAAEA9//8//7///8AAP//AQAAAAAAAQABAAAA+v/5/wEAAAD6//3//f/4////AAAAAAAA/P/7/wQACQACAAQABAAJAAMA/v8AAP3/AAD7//v//f/////////6//v/BAD9//j//P8CAAAA/v/+//3/AAD//wAAAAD4/wIAAAAAAAYAAAAEAAEAAgABAP7/+v8AAAMA/f/8/wgAAwD9/wIAAAAFAP//8v/7/wEA9v/8//7//v8AAAcAAgAAAAcAAQABAP//AwAFAAEABQAAAAQAAgD/////AAD8//r/AAAEAPz/9//9/wAA/f/8//3/9P/6//z/+/8EAAUA/v/8/wMAAgD//wMACAAAAAUABAD7/wQABQAEAAMA+//9//7/AgAAAP3//f/+/wAA9P/5/wAA+/8BAAQABQD///j/BwADAPz/AQD9/////v/+//7//f8AAAMAAgAAAAAABwADAP//+/8BAAcA+//6///////7/wAAAAD+//z////4//j/CQABAPz/AgAAAAEABgAEAAYAAwAAAAgA///+/////P8AAPj/+f/9//z//P///wQAAQD+////CAD/////AAD+////+////wEAAAD7/wEA/f/6/wEAAQAAAPn/AAAGAAUA/v/+/w4A/f///wAA/P8AAPb/AQAAAPr/+/////v/AQABAAAAAwAAAAAA/f8CAA0ABgD8//z//v/8/wEA+P8EAAEA/f8DAP3/+/8EAA0A+P/+/wsA+//0/wAAAAD4////AQD//wEAAAAAAAYA/f8CAP3/+v/+//f/AAAAAPz/BAAGAPr/BgAJAPn/AAAAAP3//v/0/wEABAAEAPr/AQADAAEABgD6//n/AAD+//7/+//6/wAABAD9//3/AQD+/wAA+v8FAAIA+f/9/wMABQDy/wAADAD4//3/AAD9/wUAAAAHAAAA/v/+////AQD2////AAAAAAEA/P/8/////v/+/wIA/P/5/wEAAgD/////BgAAAP7/BgD/////BAAJAP3//f8JAPz/8P8FAP3/+f/7//z/BQD7//v/+/8DAAAA/v8FAP7/AgD+/wAA/v/9/wcA+/8CAAIA/v/+//z/AgABAP7///8CAAAA///7//r/BQACAPb/AAAEAPf//v8CAAQA+//9/w0ABQD2/wAABAAAAAAA/v8AAPj/+/8AAAAA/f8HAPf/9f8DAP3/+/8CAAEA9v8GAAcA//8LAAYABAAAAAAABQADAPz/+//7/wYAAADx//3/AAD+/wAABAAAAAEAAQAEAAMA+v8FAAEA/f/8//7/AQDt//7/AwD1//j/AAD//wEAAAD+//7/BgACAPz/AAACAAUACAD6/wIA/v8BAAIABwAAAPv////8//n/AQAEAPn//v8FAAAA+f//////AAABAP///v/+/wIA/P/8/wAAAAD7////AwAAAAcAAAD+/wUA/f8CAAMAAgD8/wEAAAACAPX/AAADAPf/AAD+//z/AQAAAAAA///8/wEA/P/2//z///////3/BwAAAPv/+v8JAAoA/v8LAA0AAAAEAAsAAAAAAPz////5//b////5//P//P8DAPb///8AAPn/AAABAAEA//8CAAAA//8FAAgAAAAAAAMA+v/+//n/9/8HAP//+/8CAPP//P8AAP3/AQD///j/AAAAAPj/AQAFAPn/BAACAPH//P8DAAAABgD4/wAAAgAFAAEA+v8DAAAABAD9/wAABAD4/wAACAAAAP3/AgD+/wEAAwD5//r//v/4/wIA9v/6//n/AAABAP3///8DAAgABAAEAAUABwAGAPf/AQADAP7//f/6////+//6//7////9//7/+v8FAAUA8//7/wAA+//2/wYABgD7/wgABwAAAAUAAwACAPz//f8FAAMA9/8CAPj//P8EAPv/AQD7//v/BAAFAPr/AwAAAPz////z//z//P8FAAQA+/8AAAQABgABAAIABQD9/wcAAgD7/wQA/P8CAPv/8/8EAPf//f8GAP//AwADAAYA//8CAAAAAwD9//7/AgD8//r//v/9//b////+//n//P8CAAIACgD7/wAABQD9/wIA/v/7/woA/v/8//3//P8BAPn/CgAAAPv/AQAFAPv/AQACAPD/CgAEAPv/+//8//v/BgD1//3/AAD0//z/+P/+/wMA/v8AAPn/AwD7//3/AQAAAAMAAQD4/wMABQAAAAAA+v8BAAEA//8BAAIA9f8FAAMA9/8GAAkA+f/8/wMA9//1//j/AQABAAEAAgALAAAA9P8FAPz/9f/7//f/7v/s//L/9v/l/+3/+v/w//v/5//2//j/7//1//n////y/wQA//8DAAkACAD//wwABgD8/wgAFgAIAA4ACwAKAAQADQD+/wkA/f/z/w0AAwACAP7//f/9//7/AQALAPn/+f/x//b/7v/4//L/9P/w//3/+P/1//X/+/8AAPb/+/8CAA4AAgADABMAGwABABYADgAHAAYA9/8DAPT/6f/n//r/1P/Y/+b/3v/Z/+X/3//r/+b/6P/5/+j/9P/z//3/8v8FAAgA+P8LAA0ACwANAAsAIAAPAAYADQAbAAQACAAHAAgACADn//7/AQDy//X/+f/j//n/BADn//L/9P8KAPn/EgAYAMD/AAAAAOn/AAD8//P/BQAQABUAKAAIABIAFwAjABEADgAXAO3/+/8CAPv/9P/8//j/6//o//H/8v/r/93/8f/j/83/3/8MAMr/zv/+/+b/3P8GAA8A9/8QABgA5P8EAAYAKAACAAMAEwAZABUACAAlABUA3f8FABUA9/8MAAIA+v/u//j//f/3/9T/GgD5/8H/9f/+/8H/1v8CANH/w////ygA2P/g/xcAAgC6/xMA/v/p/+r/LQAoAAAAIAAwAB4ADQAZACUAHAANABkA9v/5//v/AgAMAAUA+v/Q/9D/3f8yAEgARQA4AAcA8v/c/wYAAgDQ/9j/rf+v//H/7//n/8n/yP+//5H/kf+9/wkAOABaAH0AkgBRAEAAKAATAAAA7//1/+L/4v8OACIAKQA1AA0A6//A/8L/5v/+/wYA2v++/7D/av9J/yD/N//t/sj+8f4f/7H+Q/82APAA+QGxAg0DswIiAoQBagFMAe8AmwBYABgA4f+2/7H/mf9e/yT/+v7z/ob+Tf4w/hP+bf0L/Qz9UP3+/Fj8Dfwx/Fj9TP82At8EKgYgB7wGsAUlBEYBqP8A/w3/8v+rAEUByAGMAScBtwAxAOn+ov2y/V3+A/8//zz/cP9o/4v+ff3s/Nj83vwm/IH7Yfs1+2P8mP8rAuQFUAg+CN8HMgXQAYz/xv3a/fH+WQCLAoUDfAORAt4AR/8n/p39K/1O/Wj+lP+SANcASQDL/xj/5P38/LD8FP24/b/9+vzw+8H63PtWAAIE1QZUCE4I1QXRAsf/lfz6+zP9if9VAg4E7gQqBPAB6v9Q/ir9OP0m/qj/ygCEAZYB4ADB/zz+Rf00/db9l/5p/7//MP88/nb80/rL+Vz6qv6BAxkHZQnkCNYFCwKo/UD6Mfpc/O7/0gMzBukGBgWVAbb+dvxo+xn8IP6MACMC0AJmAvgAY//U/W/9FP4A/8//0P8D/zT+A/2t+wX71vp5/MP8xv5bA3EIUgpGCDQEwf8O/Mr5b/qI/tsCKAafB8AGAASV/yH8//pD+/D8ef8BAlID3QJfANT+Ef6v/UP+vP9UAbsBnQB//mn7nvp0+gb7eP1H/qT+S/4U/hoBhQWfBwoG/QKFALz+lf0i/g4B0APhBGIEyQLaAH/+K/1d/Xn+wf/1ALABpgG2AHX+rf22/q3/vgB3AcUBDAEN/339Yvyl+9j8v/68/6AAoP65+3f6/PpKAJsHRQqOB8AC5f5x/J77jf1NAgAGTQYSBPMAd/6//Kr8b/6SAMwBYALkAZoAeP6m/AD9qP+zAV8CDAL4APv+mfy8+yj9o/41/9//gv+l/nP9n/p8+Xr6+f1+BcMLuApIBUT/nfuH+qf7+f/UBVIIiQaPAj7+Nfz0+579HQFMA5gDMwLa/6797Pvf+yv+dwFdAwYDuwBM/kT8YPug/Df/6AAZAdH/pv12/Ar8EPyI/LL9awA7BtUJXweoAan9ePx+/Vb/hwLdBbQGUQR7AE39q/x6/WH/6AFoAp8B9P9j/rr9ev3B/ssAMAIAAikAA/4A/Yr9Mv5o/xkAiP+P/gf9E/zv/Bz+ev5C/bv8Uv+vBIIIhAZ4AUv+W/0K/zUBWANCBfMExQK2/7j99P0Q/4wA3AH1AZ8Awf7S/Y/+UgDVANgA6f9G/zL/Af8r/zb/qf9d/6r+0f38/HL9X/7E/hn/CP8k/lj8gPsX/s4DKwkKCNkCCv5u/Dr/uQKyBCwF9ALt//79Lf71AMMC2gJVASr/VP4P/h3/ewDHAJcAJv/z/f39fv5U/+j/wP93/jH9WPyc/Cn+cP+Y/yr/bP4p/cT7Z/xEAFMGTwneBY4ATvyr/YUBcASCBQYEJwGS/mP9f/96ApoDAgPeAPH+TP4a/rb//AAXAUUAR/5f/dD9v/6x/wwAbv+p/VT82/vC/NH+xv/l/9j+qP0K/BD7B/1AAWwGuwh3BSABx/38/RIBZAPRBEcEFgLi/xX+Ff+hAecCMgMNAkEAB//m/ZD+/P+sAOYAkv8r/sD93f0H/77/+P5r/Rf8TfxM/Zn+r/5e/g/+Wf68/fD7A/yK/ogDcAjdB6IEJQBA/WD/CQKYBN4FrQNIAT//4v4iATsC+AIwA/sA1f9u/vn9fv/n/4kASgCz/i/+hf3z/QT/Xv7o/aL8+vt5/Jj9e/5U/uf9Qf4N/lf85ful/aQCRQgqCJ8EhACp/aT/nQFgAwgFewNjAX7/2f4NAVgC4wIZA5gBPADp/gP+Of8bALYABACz/mj+jf2M/T/+3f7P/lf98Pvg+7L8y/3p/QL+GP6l/Rj85Pv2/WQClwfcB/8ExwEX/ycAuQH4As4EbgTQAuIAlP9GADoByAH1AVIB4QAXACH/P/+g/x0Auv/R/rH+Hv7M/eP9iv7h/sr9g/z1+338gP3A/cn96/3Z/cD8UPwj/vMBBQdiCGwFNQKf/wEA1gGMAsMDKQQAAzMBdf9Y/6gAjQH4AWkB/AAYAHv+H/6Y/nv/qf8F/2D+pP1n/dD9Lv5x/uD9Gf3o/C39lv3i/Q7+aP5B/kD9EP00/3sD7AcUCKsEQwEI/w0A0gGIAucDAgSgAs8ACv8//6gAkQEmAugBuwBP/0z+SP7X/jL/if81/5n+Qv4G/gD+4v2P/YX9Pf1o/Y39rf3M/bb9Ev2C/GL9QACYBMYHJgcVBNsA1v5o/4AA+AHHA/YD5wLYAIX/yf+mAIsB2wHpARQB9P9L/wj/CP8c/03/Jv/q/rn+Zv4O/nv9Cv3V/A79wv3a/Yj9Af2h/Fn8VPx8/YkA8wQdCJIHlwTEAKj+1/5uABkCRQOYA+MChwEVAKP/AgD1AJEBtgEGAcf/qf/N/8//d/8M//D+rv6p/pv+af4T/oH99fzK/Hj9If7k/Qr9Nfy4+xP8MP2U/6MDoAffCOMGDgIL/jv9Xv9lAhUEVAQ4A8UBkAC5/4P/EwDzAKgBQgEFAI3/RQDRALIAvv+5/mn+aP6f/nH+Lv7H/Uf90/z5/Oz9Gf4e/d37gfqA+iL8eP/jA7QHtwiCBgICif4B/gQAgwL5A/ED6wKRAWgAkf9d/+b/0AB4AQYBAACz/1kAHgHYANH/4v6O/qr+2f6//oj+MP7B/W39VP2f/c/9Uf2s/LP7WPuZ/JD/ugMwB+UHqQVfAUn+1f2L/7gBEwNeA7gC9AEKATgA3P/W/5EAOAH9ADMA6/9UAMIAYwBl/5v+Z/7j/pr/nf8l/y/+U/30/Mb8S/3L/bL9Rv1R/JH7Svx//pYCeQYSCAcHSQOL/7X9L/4oAAACAgPRAkkCrwEXAbUABADP/xAAJwBZALkACAEcAUwALP9R/uH9cP6A//j/of9E/sT85fsi/Fn9RP46/lf9Efyh++/86//yA98GfAeABTUCd/8//vH+OQB9ASECAALlAbsBsQFMAYIA8v/B/+f/ZwABATsBEgFBACj/SP72/Zb+T/+c/xT//P3U/FX8+Py//d/9Q/09/K37h/wy/ywDmAbQB2gGRwNSAJv+xv7g/wkB0gHSAcMBlgE6AdMANgDh////SACoAOsAogBAALf/D/+s/ov+7/5e/5P/IP8O/ur8QfyU/FD9e/0Y/Tn8mftF/NX+4AK0Bl0IPAcpBL4Ajf5N/iD/bQBxAbUB3QHUAW8BDQF/AB4AQgCFANEAzACPAC0AhP/+/oH+dP6r/vL+PP/u/iT+SP3X/Ov88/zk/Hf8D/yB/E7+sQFxBeAH+wfgBaMCvP9X/j7+4/7o/5AA8ABZAXABbQEwAakARgAxABcAGAA6AB0Az/98/wX/0P7Y/ub+I//y/lD+vf16/V/9X/1B/bz8Uvyg/P79yAAYBKAGbwdoBv0DUwF0/3/+gP4k//L/qwBdAdABAgLyAT4BlAATAMD/t//o/87/e/8S/4P+e/6r/tD++f6e/vD9Z/08/V79Yv3S/E/8FPzK/AD/QAJHBS8HJQfHBZADZwH///D+of7W/kr/GwAAAZQB2AGyAS8BtQBTAOj/o/9//zb/FP/B/qP+pv7X/g7/7f5z/uH9k/00/dT8Ffx2+3n7gvwN/3QCZwUJB98GewWOA8ABsADr/1v/UP9w/+L/qQBAAYIBiAFTARIB1gBUAOH/i/9g/1D/Fv/J/nr+Z/6B/mT++f2N/VX9M/3G/L/7+fre+t77Cf8SAxsG1Qc4B3gFoAPbAc8A6f8N/9n+Kv/4/+gAdgGiAZ0BcAFNAesANgCG/xX/6f4B//7+4v7q/vj+7f6o/i3+yf2G/Uj9g/yQ+zf7qPuo/XABrASZBhgHzQUWBFsC/gDe/+n+jf7g/pD/QQCYANMACAE9AXIBWAG+ABkAb/8U/wD/5f7B/rH+2/4Q/wT/Z/7T/Wf9Mf3P/Nr7Sfuv+0n9xgBqBJgGTQd4BtgEHwNpARgA8/57/vX+tf9eAKcAywD+ADcBYgE5AZkA5/9L/wT/7/64/o7+nP67/v3+Av9L/pj9kf2z/X79jPxr+5j7fv2WADEEEQZ0BsoFggQaAy4Bjv+Z/oX+Lf/h/1sAbwDsAGYBpgGNAdoARAC9/3X/Wv///q/+if6y/uv+8/5r/pf9ef2b/YT9uvxj+2f7EP3R/ycDNAXyBfIFQAU4BFoCUwAY/3n+z/5L/4n/kP8NAOcAcAGmASEBjQAOALX/ef8F/5/+e/6Z/tD+GP/i/i7+4f3A/Zj9HP3C+2j7sPwF/0ECsATLBRwGqQXBBCMD6gBJ/47+wv5O/7X/zf8/ABEBpQHJAWEBzgBhAK//EP9b/iL+R/6F/tf+Kf8D/2b+Ev68/VL9r/yT+4v7lvzs/kQCowQaBoQG+wX4BCED2QAh/1j+ef4I/13/kf8hAMIAOAFCAeoAzgBbANb/Qv+8/rf+mP6Q/pT+qP5J/qD9WP3z/L/8EPyb+xH8t/3AAL4DowWNBnIG0QV5BEYCMADw/mH+lv70/lL/JwBTAeMBAwLRAawBJgE0ADH/dv5a/hv+6v37/UD+M/6w/Vf9//y8/BD8mPvQ+1D9+v+rAo8EyAVnBiUGxQTBAvIA6v86/9X+uP4I/y8AQAGfAZcBtQHAAQQByP+4/lb+QP4Z/s39E/6g/o/+IP6t/XD9BP1K/ML7HfzD/W8AtwJKBJoFWAb8BW8EagLkAPn/IP92/nP+Dv8TAKgABgFrAQ0C0AG2AOb/X/8l/4v+3/3Y/UH+Tf7c/Wj9Pf0i/Y/87/sB/CP9f//BAUQDqgS9BQ8GCAVOA9kB5QATAPj+m/7V/pD/IQBjAOcAoAHSASsBZQDU/4D/6P4W/rz98f0R/s79iv17/YT9KP2f/Hb8K/32/voAZwK9A+QEaAXeBKkDQgJAAWUAbP/n/uj+cP/a/x8AdwD4ADgBwwBKANv/jP8u/4H+Iv7U/af9ef1a/UD9If0i/Tf9j/3M/qsALwIuAwAEswS7BO4DugKwAeoAMACC/yL/Mv9o/6r/8f8/AIEAcABYABYA1v91/+D+if4d/rH9Rf39/NX8j/yL/Lb8MP16/mYABAJoA2IEMAVIBecEvAOUAl0BYQCC/83+fv5u/sD+OP/Y/0sA1AASARAB9QBFAHr/wv77/Rn9Xvz6+9f7f/uH+/37Gf3q/hkBAAOeBMQFKwY2BncFWQTgAlgBFQDj/vz9f/1p/Z/9S/4d/9H/twBWAZoBpQEtAbEA/P8z/0D+XP3H/F784fuP+7z7kPz3/cj/ggFQA9QEuAXwBcsF9ATIA1EC0AB0/1X+ef35/PX8SP35/fL+3/+pAD4BkAGgASUBgwDR//D+G/5J/a/8Zvz++6z73fvJ/FP+JgDCAWED2gS2BdAFfAWpBHUDAAJtAAf/7f1B/dH8+vyH/Rv+/v74/9QAYgGuAdgBbwHYABkAG/8t/lj9tfxW/AX80fsh/Af9eP4bAIkBGQOUBJYF0AWuBTsFMwTMAlkB9v+a/of91fyY/L788fyG/af+mv9SAPAAggGXAUkBrQDp/xT/A/5C/aj8JPzw+zj8D/1Z/tD/+wBzAuQD5QRMBXAFUAWTBHgDMgL/ALz/oP6q/S39C/3m/Br9zP2T/jb/0P9yAOkA5QCpAFYA4v83/5v+LP7Q/X39fv3n/Zv+a/8CANEAxgGGAuoCGQNjA1ED1wJWAtgBLgFyAMj/P//C/nn+UP5F/nT+rv7w/iv/gv+5/8v/3v/q/9D/qP+C/2X/U/89/yf/Nv9C/1X/h//Q/yoAcACaAOkAJQE2ATABNQEqAewAuACYAHgAVgBHADUAOAAjACwAKgAGAAIA1v+s/4P/Xv8///3+5P7Z/sD+uf69/sj+3/4A/x7/Rv9q/5b/y/8DAEoAfAChANAA+wAdASwBSAFYAU0BRgFCAToBHwH6APAA1QC1AIUAYQAxAOz/ov9o/yr/8P7A/p/+kf6P/qH+sP7C/uX+Ff8v/1z/iv+2/+L/EgA6AF0AgACtAM4A6QD2AAMBHQEsATEBKAEaAQkB7ADLAKsAeQAzAAEAwP+F/0T/EP/m/sL+uP6c/pv+r/6+/tH+2v74/hr/Lv9Q/2//hv+0/9X/+f8gAFcAjgCqANwABwEgATwBVgFYAVMBTAE0ARAB5AC1AIsAVwAfAOf/t/+Q/2P/Rf83/x7/Df8J/wD/9f75/vn+CP8P/xj/P/9N/2H/gP+h/9v/DQAyAHUAqQDqABkBNAFFAVoBXAFYATwBJgH+ANUAsQCAAE4AHgDt/8b/pv9//1z/Sf8//y//KP82/zD/O/9P/1j/af9o/3D/iv+S/5z/qP+4/9P/3f/8/x8ARwBrAJAAnQC8AM4AyADBAMMArQCPAH0AYAA3ACAA9f/W/9D/uv+u/6j/pv+k/5r/o/+h/5n/m/+I/5L/iP99/3//gP+f/6//wf/r////JABKAG4AfwCZAKkAtACvAJ4AnACFAGgAXAA5ACoAEQD8/+r/2//M/8f/wv+w/5z/mf+Q/3//ev97/3r/cP95/3z/j/+y/7D/w//c//v/CQAdAC8ARABPAE4AWABZAFUAVQBPAFYARQBEAEUAMAAzADUAJgAWABAAAAD5/+z/3//R/8D/t/+p/6j/sP+v/8P/w//W/+z/8f/7/xIAGwAgACYAJQAxAC8ALQAsACAAHQAYAA0AEQAZAAcA9f8CAO//5P/q/9T/0P/T/8P/t/+2/7f/sv+9/8r/1v/X/9r/7/8AAAAAEAARACAAFAASAB4AGAATABoAFgASACQAJAAoACMAJAAoACgAJgAbAB4AEAD//wQA8v/1/+j/2f/k/9D/2P/j/97/5f/b/+L/+f////T//v8GAAQAAAACABAADwAGAAgACwAUACMAIgAgAB0AKgAgABgAGwAXABAA//8AAPf/5P/j/+r/2f/m/9j/2P/e/8v/0f/Z/9D/0v/Y/9r/6P/x//b/CAD8/wAAFAAmACUAIAAcACgAKAAoACoAKQAeABUAGAALAAAA8f/p/+3/6P/b/9j/zv/P/87/2v/g/97/4//m//D/8v/w//j/+f/3//r/AAAOABAACAAEAA8AEwAQAAkAEwARAAYABQAHAA0A9f8FAAwA/f/1//D/7P/q//r/6f/l/+f/4//v//L/4P/n/+n/6P/y/+z/7v/6//z///8EAAoA+P8IAAwA+/8QAAUACAASAA0AIgAeAA0AGgALAAAA8f8AAPj/BgDx/+f/7v/o/+X/7v/m/93/9P/s/+b/+P/s//f/7P8AAAMACgD1/wgABwD+/xoAGgAFAAUAEgAYAPL//////zMAFgDE//D//f/q//H////g/8//9f/u/+3/AgADAPL/7P8OAAsACAD//8j/+//2/9j/EgAMAPr/BQAhAAUAPgDV/7AAWgCi//3/8v/I/9n/OwDc/7D/6P////L/9P8eAAAA/P/X/8n/FwDg/93/DwCbAIsAlP8AAJT/3f9y/+kBY/9D/2P/yv+i/4n/FwCr/7j/7P9IACkALwBXAFoAeQBwAFgAOgBKABIAAQAEAPj/5P/h/+n/3P8IAPb/+f/I/woA8P/1/wAA+//v//H/BwDu/+n/+P/9//T/7//z/+//GwAEAP//9f/M/9j/wP/L/+//7P/7/x0AEAAAAAgABwD9/wIAJgD6//7/HgDo//b/EAAFAAUA6//c/77/qP/G/97/4P8DAB8ACwDr/wAA+/+x/+X/DQAAAAgAKgAoABAAKAAgAD4ASQAJABcADgDq/+b//f/k/87/z//H/8z/4//q/9j/9P+n/7X/tP+e/6r/5P89ADEAZgCoAIoAkADoALkA5QCoALoAcQAuAAoAx/+L/1//Pv+U/yf/hP+K/xj/2f53/vD94f1n/bn9Gf5c/84AqgEvA/8DRASPBAYEigNiAn0BhQCF//L+ef4w/hz+PP7l/q3+M/9g/wD/LP/f/hf+iv3j/AH80PsT+5j7lPyo/k4BEgOoBUQH3gewB8YGdwUxAzgBhv/V/dn8OPzB/GD9PP7h/goAzwDXAAIBFAFnAAj/Kv74/IL7jfpF+v35gvrQ+9P+2AEaBOgGYQjWCD0IuQZiBdACgAC4/gD9V/zY+9D8Nv7u/u//MwHbAZYB+AC4AJH/0f0a/Tf8BPuB+nj6IvpL+nf7SP6DAfkDkgawCAMJVAi/BsQEkwLv/yH+/vwk/Dv8L/2D/tf/EAFOAskCsAIKAuwAzP8u/sD8DPw7+6r62vrb+tv6AvvV+yX+ugDYAiwFDQegB0MHIgawBKgCUgC2/rT94vzf/ND9+v4xAB8BIwKFAkMCrwGfAKn/R/5B/bH88Ps/+zr7Bvu8+vv6vPtI/joBOAOVBVkHuQdrBzAGygTNAjkA5P7D/Qj9H/3K/Qz/+v8TAcAB4wG5AfwACAAl/xn+Zv0B/aD8IfwY/Pb7dPuM++D7WP0pAEMCkwRkBhoHWwf9BfQEbQMCAaL/gP7c/aD9rf3i/pH/jgB2AZABzAEZAVAAev9W/qL9Av3B/Dr8Ivw7/K/7mvud+0z88P4TASYDfgXBBqoH8gYOBiIFsQIYAZ3/df7n/VH9F/6W/hz/LABAALIAngBJAPL/Jv+b/uf9n/0t/Yj8cPxc/PX7svvS+y38RP6QABcCNwSaBaoGlQavBWsFtgP9Ac8AeP+q/rr95P13/nv+aP/y/1UAqAB4AGYA0v8n/2r+4/09/Wj8Mfwl/L/7ovsA/IT8oP6NAHsCFwRNBZEGfwb6BbgFlgQmA+UBpQB2/xX+uv22/Xb9CP6V/iD/zP8OAFUAMADG/yH/oP5V/tz9iP18/Y/9gf3I/Rv+xP6R/0gAHgGQAQMCdwKiArACtAJiAjAC0AGiAUgBtgCJAEMA8P+4/4n/dP+E/37/WP9D/xX/1/6s/sD+rf6S/sP+1/7V/tP+8P7g/s7+o/6b/tz+Gf9c/5X/1/9MAK8ACAF8AcsBDgJCAm4CmgJ4AlACKgLnAZIBHwGnAGgAIgCQ/xP/1/6K/jH+Of4y/iz+F/40/iP+Af7m/aL9pP35/Tf+t/4S/83/pwB2ATgC7gKFA/ADQwRpBC4EBQSaAwQDUgJ5AasAFABp/3/+6P2X/UD91/yw/Kz8o/ye/Kf8wfzg/Pn8/Pwr/Xb95v1y/hb/3v/SAM0B0AKjA2sE+gRfBXsFUAUABWkEtQO3ApoBiAC4/+L+1P0w/dn8lvw9/Cn8ZPyF/Kj84fww/W/9kv2g/a790f0Q/mz+2v56/1kAUAFYAkADHATuBIsFugXCBaAFNgWMBKwDmwJnAXAAY/81/mb92/xY/PH7u/ve+/j7Hvxj/Kf8+Pwk/Tn9Nv1Z/a39HP6M/lP/VQBgAXUCcgN6BGkFDwZQBmEGUgbaBSMFRwQVA7QBewBG/wn+FP12/Mz7c/s++2D7gPu3+wX8Rvyd/Mj86vzg/AT9Of2W/Rj+0f7H/9gACQIgAz8EOwUQBoQGqQaoBmEGzwUTBQYEsAJwAR4A7P7E/f78W/zY+5f7j/u6+9b7JPxs/MT8Gf1Q/XD9c/1x/ZL91/1Y/h7/FgAgATgCQQNFBBwFwQUnBjQGFAa2BRgFZwRQAyQCAgGz/53+oP3W/D38uPtk+0v7Xvt++8H7JPyb/Af9WP2X/bT9vP3m/Tv+uP50/2gAagFlAmQDTQQbBcQFPgZeBiYG3QVCBXIEgwNKAtMAlP9w/mD9ifzq+3r7IPsK+x77V/uo+xL8m/z7/Gr9wP0B/v79B/4x/o7+J//h/+IA5QHpAuIDxASaBWcGpwbTBq4GGQZgBYEEXwNSAvUAe/9h/jr9S/yN+xn7sfqg+o/68/p2+/v7o/xe/e39bv7I/ub+yv6h/qj+4P5O//n/7gAvAlADXARiBTYGmAa0Bj8GngXcBOEDuwLPAWsAEf8A/t788/tW+9v6hPqN+qH6HPu4+2L8PP0H/pj+KP9T/3v/ef9U/3D/zf9BAMsAlwHGAr0DggRZBe4FNwY/BrsFDQVPBC4D8QHsAKP/L/4Q/Qb8MPut+kf6GvpH+oT6I/sB/MD8rP2I/j//t//R//n/6f+w/8L/GgCRACAB+QEqAxwE0QR4BdYFEQbzBWsF1AQNBAIDzQHJAJL/Jv4O/RT8N/uu+mf6T/qR+uf6fPtK/AL95f2c/j3/n/+9/9z/xv+Y/63/9v9zABUB/gEuAxME0ARmBccF7gW+BSgFlwTQA5oCdgF8AFD/8P34/A/8V/vz+sL6z/od+4X7JPzW/J79Zv4G/4f/0v/H/8f/gv8p/zn/gf/v/5AAlAHKAtADwQRnBdkFDgbvBXYFsQT4A+0CxwGRAHT/F/7t/Pr7OfvL+oT6k/rY+jz7xfuB/Dv9+/22/jj/pP+5/6j/i/8t//b+Gf9g/9b/swDtAQ0DCgT4BJgF+AU1BvMFjwXbBPYD3gK0AX4ANf/s/cz89Ps4++L6tfq5+hX7g/sY/Mf8ev1B/tz+Wv/I/9j/wf+e/0v/GP84/2v/zP+ZAMAB2gLEA6sEXgXpBR4GDwarBQ0FHgQUA+wBngB9/0r+EP0f/Hb77fq++sL6BvuD+/f7i/xI/e/9mf4o/4r/0v/Q/6X/bP8m/+/+QP+2/1AAWgG1AugDpARaBdgFLwb2BZAFCAUfBBgD+gHCALX/nf5g/Vb8vftn+zb7SftP+6L7M/yk/ED90/1z/gn/WP+a/6T/av87/6v+zf4//6r/aAA+AXgC4QO6BE8F6AVwBm4GxQXvBOUDggIUAbb/LP7Z/Bn8s/ud+7/7svsR/Fj8h/z4/Er9CP7E/jn/qf/E/5//S/+Y/lX+3/26/fv9D/+gAIwCOASABcAGSgdCB88GdAUNBFwC5QB5/yr+Sv0g/bn8Yvy0/Bn9hP3t/Q3+X/53/nj+s/7k/lH/1f/x/wEAqv9r/8X+3v1W/Vf8v/ut+8L8i/42AcADDAYcCL4I3whWCG8GwAR9AlQAmP59/cT8Pvyv/Ef9r/1O/g7/WP9H//P+if5T/uT99f1A/q7+hf/q/yAAnP/6/m/+R/2x/Aj8dPvx+u/77P2mAPgDiQboCJcJ8QjGB2EFRgNdAXT/r/47/mj+Wv6Y/k//YP95/7//cv/q/kn+nf1Y/YD9yv2Y/l7/WADpAOUATwBU/5/+i/1k/Of7avvH+ib7MP0zAOIDQgZeCGgJZAivBl0EOgKlAB3/qv7Q/in/aP9c/9H/LADi/xUAev+n/uP90vxX/IH8Vv1o/pb/aAALAQABPgAP/zH+cf06/K77mfsD++r6Y/y0/vQCtAWUB18J3wheBxsF5gKCATUAvf+9/+n/+//c/8P/3/93/2D/+P4y/rH96/yO/Mb8fv2C/pH/UADUANgAJgAz/3j+3v37/CT8FPzI+5P7cfzm/TYAzQScB2cI3Ag/B70ERwJxAD0ATgCYAAYBuwACAGD/of5W/kP+lv7w/nj+8P1M/bf85vwh/pT/PAEaAv8BkAEgAKX+vf15/Un91PwL/Y38AvwT/EX9Lf8gBIkH4AeSCKYG0AP+AUoAqABKASkB+gGmAU8ArP/c/nj+lv6x/gv/ff5d/a38//tA/Pb9vP+RAckBdAHIAFj/UP77/af9Ff3e/Jj8XPwH/L37UfwXAK0F+wb4B2gIdAUQAx0BZgDYAEMBBAJTAncBSgB4/8H+cv6Y/gP/D/8l/i39gfwN/Br98P7cANgBpQFKAScAzP44/gf+gP2K/Y/9Uf2M/LX7IfuX/DACEwdIBzoISAdNBJIBBgA1ADwBtgFTAjQCygCW//D+gP6l/hn/g/80/+r99/xI/EX8xv3W/wgB1QGyAfIAeP8u/gr+jP1w/Sn+IP48/Tj8Wvtm+x7/XgX8BhIH8Qe2BdUC5QAhAA4BzwHfAUYC2QFnAIT/AP+b/rj+9v4X/1L+lP0l/Rz9Nv1I/r//qgDVAXkBgAA7/479Df2s/Mj80/3E/ej8Nvz7+3H8swHnBlkGiAfSB2YERwKwAD4AjQHjAd4BagKcAQwAdP/X/mL+mv75/rP+hf6q/TH9Vf1s/Wb+AgA5AfYAbADI/0v+ef0H/TP91/2x/dX8C/1q/MD8lQK5BnkF1wZPB6cDfQFmAEEAWAGpAe4BbAJ8ASQAjv/w/n/+0/73/mD/tv5p/WP9AP0X/Y7+MgAZAeoAsQCV/y3+av0g/Rr9xv1O/Tj9Rv2A/BgAXwUYBZYFlwctBVkCmQDC/+0A+gCgAbQCMwLuAAAASP9y/un9Fv7C/iX/Mf7j/Rj+cf3e/TH/7P9YANwAKwAJ/yf+WP20/MP8Nf3N/Ez9S/2Y/TgDbwaIBP4F/gY8A48BkwBfAFgBywDSAekC3AFFAekA7f/+/kD+IP6u/rb94P0A/uT8tP2l/iD/XQCwAAgAk/+K/p39/Pze/Nz8sfxt/UL9Rv/IBFEFcQR7BiQFdgKVAQ8AhACeAHEA0AEbAosBEQFmAL7/0/7+/ZL+GP7K/QP+p/2Z/cT9+P4YAGEAVQD6/0r/V/5g/TX9KP2i/Fv9VP3u/YcDnAQcBH4GnQWYA7sCqAAgACgAvP+4APQBHgK+AUkBsQCL/2j+QP7I/Xv9nv1C/UL9ff37/fj+f/+S/6D/bv/v/mP+rf2E/Q79jv14/cL+yAJnBA0FuwYpBroESgMzARQApP9Q//P/mAATARgBUQEmAT8ABP+r/vX9lv2E/XP9yP3R/Sn+5P4Y/1z/iP9n/1D/zP5Y/gb+sP3P/bT9AP/HAcQCRwToBcUFRwUzBHQCPwE6AI3/hf/b/+H///+tAKIAIQB9/+L+MP6a/QD95PwH/QH9qv1A/sL+UP+F/6r/q/9T/wH/uv6c/vD+Zf+nABkC9AIxBPwE5ASSBLEDcgJxAYEAsP87/xD/3P4k/0T/Zf9N/xD/1f5w/hT+1v3P/a79xP3//Vv+iP7h/iX/bP+i/67/yv8uAE8AdwDoAH8B6QH0AXsCuwLDAqACQALYAVYBxwA+AM7/cf8j/wv/+P4H/wj/1P7U/rD+iP6K/oD+p/7k/vD+Nf9o/3j/1v8HADAAaABwAIkAfwBKAFgASgAvADMAWQCJAJwA1wAAAQkB4gDRAKoARQALAPD/6f/l/+z/7//z/wIA4//g/7D/cf9m/1L/Xf9f/2L/iv+b/9L/AwAMACIAXABQADoAAADt//H/w/+y/9D/yP/V/97/+P8PAA4AGQAzAAgA8P8OACUAOQA+AFUAXwB3AFkAHwAAAPP/vv+Y/7n/yv/F/9r/+v8MAAUAAAAYADcAFQAFAO7/3/8FAPz/2//i//f//f/t/8r/2//s/9X/sv/A/wsACwDx/wgAMQAqAAUAIQAtACAA7v/+/ygADgDc/+H/BQAAAPL/4v/b/+v/5v/7////+/8DAAIAAAADAP7/AAALAPT/8//6//b/9//8//n//P/j/+L/8f/y//7/CQAJAA4AEwARAAgABQAgABQABAACAAMABgD2//b/8P/z//D/5//1/wAA/P/4//b/9//4//b/AQD1/+v/AAD6/+v/6f/4//b/8f8HAA8ACAAdABoADAASAAwADwAVABoAFgANABgACAD///v/7//k/93/1f/T/9P/4//m/+P/8P/n//T/+P/z//P/7/8AAAQA9v/x/wAA//8AAAEAAgACAAcAHQAQABcAHgAsADEAGAAPABcAGwAQAP7/9v/2/+7/4v/n/+n/4P/O/87/6P/o/9z/2v/o//D/8P/+/wQA+/8EABAAAAAFAAMA/P8GAAoADQAaACUAFAAaAB0ADQD3/wEACwABAO3/8P8IAAUA6P/m/+r/7//R/+D/4P/b//H/8f/W/+//+f/o/+X///8GAPz/+f8JABIACgD9/xEAEgD8/wAAGwApACoADQAPABcA/v/w/woADwD4//H/8/+OAGYAQv9M/0AAXABI/03/OwAeAIT/pv8kAFYAJwDg/6n/8f8FAN3/4P8mADQAAwD1/xkAJwARAEUAOABHACwABAD0//X/FQD7/+D/8v8MABAA+v/p/+r/9P/h/9D/TQAgAPn/KAAWANn/1v/G/9z/+f/t/9j/7P8LAHcAFQDg//v/JwD1/7n/8v8YAJz/yv8fAA0AdP86AKQA0f/i/xsAdwCq/z//sP9dANv/PP+E/5sAIABg/+j/kABXALf/0/9BAJAArf/f/1EAQwDF/7b/OwA1AFP/OgBjANj/s/8nAFEAzP+0/y8APQDf/1n/mgDZAIf/Bv+IAMQATP8h/4gAwwCE/0T/BwC5AGn/TP/q/5wA+P9t/7n/sgBJAGr/0P+vAMUAd/+X/6gABwE9//3+JgGWAPD+LP/hAL4A7P4T/wEBwgAK/0j/6AD4ALL+rP+VAEgAsv/s/psALQBj/4z/YgCWAHr/cf+lAI8AiP+M/3UAmgDB/0T/HQHt/yr/PQD5/6MAeP+Z/5UAfwC3/7//OgDDAJb/fv9iAD8A3v+g/93/8QBc/y7/qwAFAPX/F/9nAIcAuP+l/0AATADG/6L/MwA4AOb/MQC5/+b/NgDH//z/yP9XAPz/kv8yAO//GQC4/1wAAADt/wcAhf9YAMv/UgDG//3/wP9vADf/BAA/AOf/rf/x/+X/CADH//n/JQATAEcAt/8/AFcAqf8PAP3/JgD2////CgAXAEkAgv9iAPP/EwDy/8z/FgAVALn/KgD1/zsArf/5//3/5f/r/zYA1/8FABsAz/8jAGL/OgC2/xAA4//2//j/GQCw/0gA6P8NAAgA+P/s/wwA8f8EALT/SwAIAPf/+v8JABwAWACL/zgAGgD3//L/GgA1AKH/BwDv////+//O/1oA6v/O/+//AwDo/w0A1//t/wsA5f8hAND/EgDe/+j/LwDz/8b/IwCo/2wAPQCQ/0AAwP9AAOP/HAABANv/0f8EABwAEADm/yAAsP8SAPP/2v8bAAYA7f+m/ygADAAdANf/EgAKAOz/BAD0/xcA9//Q//3/UQDU/8H/z/9QAEgAkP8zAPD/BQDY/xMAYwDY//b/xv9BAOX/4f8NAF8Av/+t/97/hgDU/83/GwAdAPj/x//V/14A9f+U/yoACwAMAKf/OAAbAO3/CADe//r/OwAHAM//8f/8/wIA6//4/xAACQDp//b/EAAzAMP/LADY/zsAyf/+/wgAAADL/yIA8/8FAO3/GADr/wgA2/8YAP3/4P///+//CQDo/ysA5v8cAOn/6P8FABUA6P/7/wAA8P/1//H/MADT//r/9f8GAAEA5P/y/wwA7P+7/ykAFgDT/ycA7v/7/woA2P8UAOz/8f8SANb/IAD4/xUA7//5/0IAxf8UAM7/FwDo/yIA6P8dAO3/+P8bAAsAGQDd//f/8v8CALb/DQD1/wQA9f8AAO3/+P8QAOj/DgDz/wIAEADh/xAA+v/0/wsA4P8dAOz/+v8CAO//6////+z/BADA/zAA+f8KAPr/BwBQAMD/4//4/yEA6P8JAOL/FQDp//D/8f8KAP//4f8UABwA2/9BALr/HQDd//b/BQDh/xcA7/8XAOX/AwASAPL//P/A/1AAxv9mAPn/AAD+/xUA6v/0/wwANAAOAMj/wf8MABUAsf8GAPX/AADQ/yMA4f/R/xgA5P8eAN//CwANAOb/+f/w//3/9//k//v//f8gABsA5P/p/yIA2P85AOn/NQDT//n/7//v/zAAFADU//3/3v8bANP/AgDJ/wYAsv8UAMr/GgD1/wsACgDq/9X/KwDx/0UADADx//D/6f8PAO7/EAD9//P/AgD7//n/0P8YAAwA+v/1//n/+v/5//z//f8DAO7/+v8JAPf/9f8IAP3/BgDt/wYA4P8eAPT/DAAQAOz//v/g/w4A9f8BAP3/AQD3//f//v/3/xgA9P/8//P/AgD2/xgABADf/yQA2P8RANf/GQDb//D/CgDw//b/CQD//+T/AAAKAPb/9f/9//v/5P8VAPL/EAD7//7/+v/+/wAA/P8BAPz//f/0/xcA9P8VAOL/JQDt//f/+P8QAPb/CAD5//P/9f/5//f/CADk////3v8XAPD/+//8//r//v8LAPL/6/8IAPb/+f/3/wAA+P/6//7/+//+/9z/CAD0/wkA4/8IAPn/+f8FAPf/BwDs//f/EQADAPP/9P8DAPX//v/0/wAA8f8EAAEA+/8BAO//BQD+//T//v/+/wgAAAAAAOX/AAD8//j/BAD+//v/9v///wQA/f/6//7//P8EAAAA9f/3/wkA9v8AAAkABwD6//n/BgDw//b/AgD7//7/7v/5//j/BgD7//3/8P/4//r//P8HAP//AADx/wYA+v8BAPj/EQD6//v/AQAAAPb//f/+/wcA9//v//f/+P/3/wEADADv/wIA6v/1//P/9/8DAPP/9/8CAPP//v/4//b/9//4//D/8P8YAPH/7/8HAAAA/P/7/wwA3v8QAP3//f/y/wAAEADv//7/9f/7//X/+v/g/wMAFADj/wUA/f8AAPT/bQCIAOr+fgAC/44Aq/9SAL3/+v+e/wwAIABZAP//3P8gAN3/BgAIACoA8v/r////CgD+/wMAEAD9/7T/IwACABEA+v9EAJX/MQCg/zYA6P8MAAgA6/8cANb/3/9XANj/SgC//xIA4P/6/9f/HQD//+7/TADD/wkAyv+4/88AeP88ANb/CADU/wwAHgCCAKb/AADv/+T//f8DACAAegCK/xAA4v/b//T/aAGD/iX/ZQAy/ycAgADLAIz+CwCd/xYAGgDOANf/jP+//wYAGwAMAFAA8P98AIb//gBz/24A0P8eAPf/0f8yALf/DQDc/2L/VADx/xAA6f+iAGj/UQAg/zYBUP/tAKD/DwDa//f/9QBF/yUBGv9QAHH/4gCQ/yEA5/9rAHj/2f9r/ygB2v4cACX/JwCU////mf///7D/zv8ZAPj/JwDL/x4A5P8CAP7/X/94ALf/UAAm/7AA8/6TANP/SQARAM7/nv/gAKn/8ACl//QAYv/3AM/+dwFd/z8A7f/J/0gAj/+e/zkA/v/l/xcA6f9z/1oAIf/AAKj/KgDx//3/IQCvAKP//f8NAL8Aj/8eAAQAAwD+/8X/PADn/y4Ao/8oAO7/hv97AK3/6ACW/psAfgDT/0H/FQBYACMAOP/H/6//2QBx/1UAe/9LADAAxv/g////NwDN/woA2P84AOf/Wv8GAXz/IgDc//z/4v8aAHv/ZwC1/y8AFgDy/xkA/f/z/yYAGgDd/x8A4P9mALX/+/9aAMr/uv8oAEAAtf8LALf/PQD3/9f/t/84AK//AwAVANv/MAD7/+j/HwAlAN7/DAD7//7/AwDn/40A1v/t/+f/EwD3/ywAy//F/1EArv8XAMf/HQDa/wgA9/85AL//JAC0/xYA9f80AML/+P8LAOT/AAAhANj//P8BACcA4f9YALH/AAD4/1cAav/n/xwA6v/6/8b/IADn/wEA1P8YAOr/IgCX//r/OQADACgA7v/0/9T/CQD5//z/3v/o/+7/CQAKAAAA9/8HAOj/+f8DACAA2v/+/wIA+f/5//T/6P8BAOv/IQD2//f/BgC1/xYAw//w/xYA+/8IADMA6//9/wEA+f8UAP7/0f9SAK3/KwDp/zUA8v/7/xAA8v/X/zEAAQATAOn/9P8AAPX//v8CAPv/6/8AABYAEgDS//r/CADy//H/MADl//f/+v/8//3/8f/8/wMAz/8NAAAA1f8PAP3/AgAmAAcA//8LAAAA6v8EAO//GQDo//P/EQDi//z/+P/7/+3/6f8JAOH/BgDw/wUA8P8JAAAA7v8LAPz////2//7/+P/8//X/7v/0//3//f/+/+T/EQD4//7/+P8FAPX/CAADAPj/CAAGAP//+P/1/xUACAD6/wYAAAAIAAEA/f/6/97/CAAZAPL/5f8GAA8A6P8TAPH/8f/v/wEADADr//7/+P/+/+///P/7//X/9//p/x4AAgD0/////P/t/xcA6P8iAAMAAAD4//n/GADe/wUA7v/1//b/8v/8/wAA+f/x/wQA9P/w/wEA///1//X/+P8PAPD/AgD5//z/9P8AAAAA8f8CAP//8v8CAPL/JwDr//r/9f/x//z/9v8kAOH/+//t/wwA6//i/wsA+P/y//b/BwD2/+//CwD3/wcAAgD0/wgAAQAKAPD/CAD3/wYA9f/0/+j/AAD6/woA6v/5//b/AQDg/xwA1P8JAPr/BQD//+3/AAD0/xAABQDu//b/AgD+/wgA7P/g/yEA/P/k/xQA1f/9/w0A/v/6/wsA/v/w/wIAAQD9//z/+//7//z//P8kAMr/AAAEAAIA9v8AAAIAFgD1/+7/LAD6////CQD7//P/4P/5/9//BwDr/yEA8P/5/+P/+/8AAPn//f/u/wMA+f/7////+//9/9X/6P/+//X/0f8JACMA9f/s/xcAFQD8/xgAIAAQAP3/+//0/+//9/9AALH/4P8WANn/6v8JABIA5/8CAAoACQD+//n//P/y//j/+f8EAPj/HADL//z/FAD1//L/2/8NAC4AFgDc/wMADgAjAAIA6//0/x0A5P8IAPf/9//2/+b/8v8XAO3/DwAEAP7/9//6/9X/7f/8//3/tf/w/z0AGAC3//X/IAAJAOv/+P8KAAEA8P/V/wgA+f/w/8H/AgA8ABUA6v///yEACgDx/ygADgDx//X/+P/9//P/7v/z//b/6f/4//j/+f/8/1QAEgA3AEcABQDk//v/EQDm/+j/1f/g/9v/2f/n/+L/5//y//7/PAD8//D/EgAQAPj/RgDA/4j/pv+y/+X/n/+y/9r/EwAIABkAOAAcACsAKwBPAB0AFgAyAEkARgC5/8r/yP/i/+D/1f/z/+v/+P/+/xMADgAWABoAFAADAC4A+f/+/w0A9P8CAOn/EQDw////5f/u/+z/7P/x//b/uv/9/yEA5P8rAPj/9P/s/wkAAgD6////7v/9/+//AAD6/wMA8//w/xwA4f/j/wAAGAAAAF0AbAAUAFL/dv/I/6H/4P/9/x8ADAARAAsA+P8hADwAMwD3//b/yv/t//j/JQAYAP//BwD+/wMABQACADcAbwAgANT/yv////P/5P/7/+//0//Y/8D/8//J//z/AAACAA8A5f/g/+P/BAA1AD4AOAA1ABAABwAJAPj/8f/w/wAAIQDx/+D/6P/2////AQD8/+n/9f/0//T/+P8YABkACQDK/67/n/+R/7n/2P/c//P/m/9f/0D/ZP/F/z0AHwBsAHgAAwEQAqMCuQI3AjMBPwAPAP3/KgA7AOv/qP9S/+j+zv6//rj+U/7r/YD9PP2Q/Sv+z/1e/bf8jfxs/e7+8AEbBMUG6wecBpoEHgKd/1/+/v20/tgApQJ3AxQDSAEz//T9SP2H/XD+PP8YAGwAif+e/kT+/P0a/k3+SP5k/t3+ef5E/cP7cfp9+gb8df79AiAHAQpuCkMH5gLO/579Z/29/mkA3AKlBJ0ERwNEAdn+rP1y/d39D//x/5gAuwBm/+n9Qf2h/XT+l/8dAAMA2v/5/Tj8nfqN+XX6dfx4/q7/WwETBd0H7giuBlUB0v34/Ar+NgCmAYwCUQO8A4oCmgBe/hL94P1x/+oAtAEiASwAx/74/Cv8Lv2w/+EBTwLTALP+w/xe+zv7zfsh/cT+GP9S/m/8B/y+AMcGkwrlCUQERP+6/VT+9//uALsBJwPuA2ADuABY/lz9qv7yAJgCtQJdAZf/iv5m/b38tP0sAHYCZgInAF79tful+7L83v09/8j/Uv/K/XT7Ivr3+Y39kATuCbQL+wceAab8y/vg/fwA7gKlBAMFnwO7ALH9qvz1/SEAAAJ0AokBOgAJ/1H+if0N/oz/nAFBApsAMP5l/IL8Xf1g/pb/9/9l/4D9NftZ+i37j/z6/WIB8gXyCKcIUgNS/Sn7FP1aARcEeQQBBEUCawCP/s79Mv9ZAcMCuQKOARkATf85/yD/Ff+//8EATgGcAE/+qfyp/Br+SP8w/9/+jv7o/f380Pvg+zz9Ov7d/Z3+VwIQB44J6AZ8AFj8TPyM/+AC4QMfBCQDRwGM/zz+DP/1ABEC7QGzAMn/ev9//6D/iP9U/7z/xP9p/1X/wf6d/m3+Uv5k/gT+NP6U/kn+0P0A/ef8vP3g/Q/9YP3ZAKwF6gj2Bq8BAf6//R0AbwIHA9cDuAMmAjwAUP5C/lgAbwLgAvoA0f7b/UD+a/8aACEADAAfAIH/af4S/l/+Kf9m/1H/Ff9m/uf9pP1q/YP9ff2c/Q7+C/5n/YX9fgB4BTcJ/geNAs39tPwx/zMCpAM/BHED3AEaAC/+3/2Z/84BpQIyAWD/UP6P/oL/5f/o/x0ABgA0/z3+7P24/sP/GgBx/1X+U/0t/ar9IP6O/q/+c/4C/iX9qPzq/YEBsAUTCR8IjQIK/n38vP6xAnQEJQUbBIwBqP/l/dP93//xAecCxQG8/7D+K/6p/jv/b/8OAEEAK//Y/S39+/16/yIAmP80/gL9ivwE/ZX9GP6a/pD+G/6m/Sb9R/1s/7sCawZpCKkFVQCA/Z/9CAH/A7kEfARnAhsA7P5M/mr/eAHWAkACJwBZ/uj9tP4IAKgAgwBjAOL/kP4p/Sr9mP4XAG0An/9z/qD9SP2Y/TP+xf69/l/+sP2S/f/9O/5A//gA1wSpCCAIRgOg/pv9mAAHBOIEJgR6Am4A8f79/Ub+GACVAXABFQCz/jP+kP5q/zQATgA0ADv/+v1e/Qv+bv9OAA8AJP8c/mz9Vv3M/aP+2v58/uz92P1I/mD+Fv4o/3gCpQfGCf0F3/+K/Kv9IwEkA9sD7QOlAlEAYf6x/T//TwETApoBIAC4/vT9K/5P/zgAqQAqAMf+xf3B/S3+y/4h/0r/Gv9H/nP9ZP0H/n/+WP7s/SL+OP7n/RX9vvyeANIGqAqpCEAC4v34/fn/DwKCAxIFIwW9AiL/vP0Y/nn/xwB6Ae8BAAEa/5z9fv1p/nD/AwARAHH/nv4r/vD9Fv4s//j/EgCs/8D+wv1W/dz9XP6w/gb/sv71/fr8m/tJ/ssEogktCTkEm/9U/rn+7/8yArcEkwV5A/X/EP4H/uL+MABEATcCxgHg/8j9GP23/cP+c//f/27/u/4//vH9Gv7f/qL/5v/d/1T/Z/7o/TX+cf61/hb/Cf94/rj9UPyi/dkCUweuBy4ExwCo/z3/U/9qAb0DTwUEBOoAIv+y/vr+2f/JAIoBWQFVAHb/iP4+/lf+xP5w/13/0f63/pP+dP40/kv+RP8FALD/Jv+r/lD+tv2s/Ub+lP49/vb8tvyKAIoFmwccBlYDUwGe/yf+aP8lAlsEqAScAhcBrv+D/lb+S/+pABwBwwCHAM7/x/6e/Vb9eP5l/83/6P/o/3D/YP6S/Sj+b//3/6D/QP99/on9BP3G/bL+zv7Q/dv80P4jAyMGcQbXBP0C7ACL/gL+IQChAsYD7wIvAlABtv94/pD+uf+6AO4AQQECAdH/GP5Z/eH9zP5R/+j/QADu/8z+vP2D/Xz+M/+o/+L/eP9Y/l79Qv3O/df9d/33/MX+WQOlBvYGGgXnAlUBTP8w/mv/mQH9AuQC7AJ7AtQAKP+Y/lT/uP8NAKgAxQDg/2r+v/2a/eD9YP5I/x0ADAC0//X+nP5a/iv+N/6o/rT+b/43/nP+df70/Uj9ff0cABgEoAb0Bl0FJQPsAN/+i/6a/wUBXwKUA00DNQLpANL/P//3/hv/8P9IACgAmv8P/0n+rf2n/Uj+8v43/4r/gv8y/63+I/7u/Qb+Df4n/mr+yv6R/vv9aP2M/er/1wICBTQGswWQBKgCTQCo/2P/2P9fAVQCngI1AqsB1QDu/z3/Iv86/7j/BQAiAMz/E/96/ib+I/4m/m7+2P4F/wz/zP5p/jD+5/23/dH9Iv5W/vr9jv3o/O79dwD4AkEF5wVEBUEE1QF7AOT/IP/u/wIBmgFcAjgCKAKcAZQAEACX/4v/j/+A/37/HP8a/6H+gP6N/lz+m/7d/tj+AP+u/ob+YP4G/qn9qP22/Xz9RP2x/JT9OQB2AvEEZwYqBnsFYwOkAQEBmv+h/6AAtgCIAbQB/QHeAT0BwgA+AJ//SP+8/rD+Zv6W/pz+c/6z/oP+f/6p/pP+sf6Y/nb+gP45/sr9v/3A/XL9P/13/Oz8NP8LAWADoAXfBQQGNQWpA7ICgwCf/7j/jf8wAP8A5gFcAhMC4wEdAWwAwv/3/r7+hP6Q/oj+mP7J/p7+v/7C/lv+TP4g/u799v25/az99v2f/Xz9JP2O/Bb+0P/qAHID1gQYBV0FjQTJA2wC0AB5AL7/qf9MANYAtQHpAQwCJAKMARkBTwCT/wb/aP5D/hj+AP4W/iz+Xv5R/jP+Bf7N/bX9ov1s/a/9nv1//Zj9Dv2U/YD/gAAhAhEEuAQKBbYEGARnA+QBTwHrAAMAJQBTALEAHwFQAWgBmwEPAXcA6P85/5b+Vf4n/hL+HP4C/jn+I/4+/kX+Lf5Q/lH+LP48/if+8/2o/Uf9gP0P/wMAYQEwAzYEqQStBF8E6QOlAuIBPQFuAD8AOABQAKoArgAsAWQBIAH0AJ4ACAB2/w3/lv5Y/gf+y/3Y/cj96f32/QH+Nv5e/vv9Dv40/tf9tf2o/U7+p/9EAF0BxAIgA2wDugOFA1oDugI9AgsCTAH1ANgAjgCjAH8AaACjAGEAHgAeAMz/cP8t/9z+rP5o/ir+Kf4B/gT+GP4J/lj+nP6D/pX+1/6//qf+qf7N/mX/sP8sAM8AQAF8AagB+wH3AeoB7wHiAc0BgwFWATMBBQHsAL8AngCZAHcAQgAjAOn/qP98/zj/D//l/q/+lP6G/oP+dv5j/nr+qP6q/qn+5v76/g//Nv9l/2//rv8KAEgAkQDbAC0BOgFBAXcBkQGVAagBwwG4AaABegFZAQIB1QCSAGAAPwAQAOb/vP+Y/2T/N/8J/+P+4/7H/sj+v/7Q/tP+yf7p/tb++f4Z/yr/d/+W/7b/z//o/0wALQBjAHkAvADFANMABgE7ATgBSQFKATkBGAH9ANQAuACXAGoAWAAuAAoAAgCa/4z/a/91/yD/K/8g/1D/IP8e/9j+Kv8b/w//Hv8x/23/a/88/3r/oP/Y/7H/zP/R/y0AWAA4AL8AqADeAOMArADhAJ8AxACtAKcAkgCBAL0ANABWADcAKwAGAPD/LQA/AL//0/+2/+X/yv9c/5r/kP9+/2X/X/+A/4H/v/+k/7D/qf+F/8T/wv/Y/8P/xf8IAAIADwCDAAcAYwA8AGIATgA2AFoAjwBuAAYASABYAFsAGAADAEUAUgD7//D/zv9MAP7/AwDb/8H/5v/C/3j/mP+b/w0A/f/L/+P/1/8SALn/zf/a/+v/5f/M//L/6P/i/9D/8//h/y4A7/8TAB0AHgBEAB8ALAAuADoAKwAqABwALABZACwA6v8gAP//+f/Y/+X/+P/o/9L/tv/T/wkA1f/T/9b/8v/i/8j/BwD5/9D/tv8NANP//f8EAPX/+v/7/wcA8f8wACEACAAQABsAVAAGAAcAMAAYAA4A8f/r/w4AFQDo/+3/+f/w/+D/7v/d/+D/HADp/+X/y//e//j/7v/Z/9L/+P/2/8r/6v/w/xcA9P/v/wYADwARABIA9P8RABUACwAMAPz/AgAnAAgAFgAIAAsADQAIAAwA//8DAA8A8P/1/wIA6P/6//X/7f/f//f/7v/2//v/7f/1/+X////r/+D/6f/z//X/6P/0/wsACQAIAPz/CAAQAA8AAgAEAAUAEQAaAA8ADAD8/wgACAAPAAoAEAALAAUAAgAJAAAA/v8GAPj//v/u/+j/8v/l//T/8P/p/+b/7//v//L/7v/u//H/8//6/+P/7//2/+//7//8/wMA+P8FAP3/EgADAAIACQAFABQACAAVAAsACAAGABwAEAD3/wYACgAGAAgA+f/+//n/9P/r//j/8f/4//D/5//w/+X/+P/0//L/6//y//H/8f/5/////f/4//r//P/3//f/AAD6//v/AAABAPr/BAACAAUAHwAIABYAEAAPABEA+v8EAAQA///+//X/+v/x//L/6P/k/+f/1//k/+X/4f/k/+v/7v/5/+//9P/+//3/9v8AAPz///8LABAABgALABEACAAKAAgAEgAFACMAHwAbABoADQAKABIACAAAABgAEAACAPv/CgD//wEA+//0//T/6P/o/+L/6P/v/+r/7f/p/9P/3v/4/wwAGgAbAAsA+/8AAPD/4P/Z/9T/3//8/ywAVQBoACUABQDD/4D/ZP9O/17/aP+C/5H/pv+2/8z/4P/w/wcAOQBbAF8AcQCFAJMAjwB7AIwAhwCMAHsAbACiAIQAgABiAFAANQATAAgA9P/f/9D/w//H/7P/o/+c/5v/mf+Q/5L/jv+V/5r/mf+c/5v/rP+p/6v/xv/Y//b//v8PAC8ASABcAGAAXgBaAE0AOAAhABAABgAAAPj/8P/t/9z/w/+j/4f/c/9k/2X/Sf8//zT/OP8p/yv/Hv8l/z7/YP+c//D/YQDTAFEBuQEaAnMCswLTAvECygKeAkgC6AF0AeAAVAC//0j/wP44/rD9T/0G/dz8wPyj/J/8v/zo/A79S/2V/dv9Lf6M/hH/u/99AFABQgIGA9ADggQEBTQFPAUhBbUEFwRtA7sCwwHSAPH/FP84/n/9Jv3C/Hn8Q/wr/DP8Y/yJ/JP8xPwR/Wf9ev2l/dT9Bf6B/vj+Zv9AAAwBKwJqA2AEHgW6BSIGHwb/BYwF4wQVBDkDUgI5ASkAO/9U/mz9qPw+/CP8Bvz1+/r7Nvya/OX8Fv1F/ZT91v32/fD9//0I/lD+1P4z/83/pACRAQADNwToBGEFywUIBhoG4AVQBYUEwwPkAtIBrwCj/47+gP2o/Pf7jft7+2D7dfuU++37aPzb/EL9pP0Z/oH+uf6y/sD+rf7D/jf/cf8NALwAewHAAtkDkgQBBZUF9gU6BjgGrwXtBBgEOwMOAsEAev9l/ln9hvzq+2r7FPvw+gn7Ofue+//7ffzv/HH96f0f/kv+Yv5s/rb+EP9g/w0AtQC4Ad8CxwOTBCUFrwUIBkcGFAZ7BbkE4gPoArYBcwBL/yT+Hv07/Lb7TfsT+/z6OPuY+//7hPwC/ZT9EP5x/ob+m/6j/o3+vP78/j//5v+TAIsBuAKYA18EAgWIBQMGRwY5BqQF6wQiBC4D+gHHAJD/U/5I/Zj87PuG+zz7J/tE+537Bvxz/An9j/0I/nz+u/60/rH+iv57/rj+AP9v/wwA1gAIAgQDzAONBB8FpgULBjgG/AVVBZEEwAOQAlMBMAAG//f9D/2U/Pb7oPtj+3L7qvsO/HH85vx7/db9Pv5//oz+f/5n/jT+Nf6I/ub+X/8IAPgAQgJXAxkEzgRpBfAFSAZWBuwFLgVEBDgDAwKtAFn/Mv42/XD8+Ptn+yX7IftO+6z7EPyV/Aj9mf3h/Sn+bv57/nn+Wf4z/mD+7/53/woAtgCgAeAC7AOMBBkFhgUIBkUGKAaiBc0E5gPbApgBOgAD/+L92PwY/KT7Nvv1+u36Mvu4+0X85vyG/Tj+ov7e/jD/Ov8I/8X+c/6M/gH/lP8DALwAvgEbAzgE7ASgBSkGuAbbBrgGCgb6BNoDUAKaAPH+dP0A/Pf6cPoQ+vf5cfoh+xj8If02/i7/v/8oABYAwf9F/4D+0P0f/e/8VP1I/rH/6wBIAroDKgWuBRIGKQbxBawFFAV9BGcDYgIvAeH/dv41/Vn8ifsh+w37J/uV+2b8Wf2e/pD/fQDOAA0B1wAxACv/H/7z/Nz7yvpo+tj6J/xM/kIASgJqBG8GcwcSCEAIDghYB2IGYAXwA64CUgHr/2T+D/34+1/72vqv+gT7cvtS/F79f/6j/4MAFwEfAR8BtADv/+r+4P3R/Nn73vpJ+kn6Mvs1/fn+EAFQA0kFiQZhB84HvQc2B2AGMAW4A30COAGz/4z+bP17/AP83/vH+x/8tfxq/WD+av9nAAoBfQFrAR4BzQACAAf/xf22/KD74fpQ+nH68fp//Cz+TgCcAr0EKAYiB7gHdQfnBjUGHQXDA/UBrAB4/zz+Zv3T/Ef8APwm/I784PyU/U3+Ov8RAPIAUgGAAUcBvgATAEb/Uf4e/TD8evsZ+6T6wPpC+3f8Zv53AOwCFQW8BpYHMwjbBxEHJgYUBboDOwKtAJf/n/6z/Uf97/yM/En8i/z3/KP9Zv5X/xwA2ABNAVEBHgF+AMP/6P5M/k39b/zH+3L7Mful+sT6Rvug/Kv+AwFsA4EFGgfsBykIrQfTBqkFVQThAkEBAAAC/yv+lv1f/UH9CP0G/Wz99P2V/pr/ZgAVAXkBoAFoAdMATACP/7D+/P1Z/b78E/zw+9f7jvuU+yD88PxZ/o0AtAKXBOEFnwa6BjYGXQVcBFIDOwIkAQ8ARv/O/nT+NP4x/vP93/34/U3+mP4O/9H/WACqAP0AGgG5ADUA1P8y/2/+wP1O/az8Ivzo+wj89Pvy+6v8V/2p/g4BKAPhBLYFrQaYBv4FOwVyBKADgAJ4AYgAoP8s/7z+fv5T/vX90/3I/Rj+j/4P/wIAVgCSAMQAsgBYAM3/Yv/K/ib+gf0Z/Xb85PsI/Ar87vvX+4L8AP0W/tkAAgPeBNIF4AYUB1sGpgXBBOoDtwLQAQUBNADM/13/Gv+B/iP+0v25/fb9cP4T/9j/eQB3AKEAfQAhAJ7/IP+p/u/9Dv13/Bf8h/uQ+8371vuz++37f/wA/X7/NwKOBOEFmAZuB+0GNQZQBaYEsANeAo8BsAAoAKn/X//d/nf+Pv7e/fn9WP7p/oD/PgCYAI4AgwAnANf/Xv/K/jP+cf2o/Gj8BPza+wj8TfxC/C/8efyk/Mv9HwBWAjAEZQVlBtUGfAbtBTAFfwRzA1YCZAGIAAAAtv9P/9D+lf5T/uf9/f1h/rj+R/8XAEUAZABpADYA9v+X/xv/kv7l/Sj92Px1/D/8V/yH/HP8hvzI/Nj8mv12/0UBHQO1BP8FwgbWBoYG/wViBVEEWANYAj4BYwDH/1n/8v57/ir+5/3D/cn9B/5o/tD+d//B/9j/AADW/57/W/+6/jX+jv3W/Gn8MPzZ+wL8WPyz/Pj8Rv2J/eT9Of/QAIQCZARjBVYG4AbPBmIG5AUxBQsEEAMoAhkBIwCF/77+Lf64/W39Tv1m/Z/96v1d/un+f//C//r/LgAOANL/ev/W/k3+2v1Z/UT9EP39/Dj9bP3H/ej9VP6O/rn+3P6Q/3QATgGGAlEDKgT5BGUFbgV9BUsFsQQQBGgDjQKnAekAEABD/43+AP6B/TD9/Pzf/Pn8OP2X/fn9Pv6K/sH+AP/4/uP+4v7K/oj+mf5n/j3+Mv4u/iH+HP5I/lv+k/6g/kH/5/+oAIoBSwJcA1IEAQVhBeQFFgbIBWAF8AQ3BE8DfQJ3AVEAUP9Y/qr93vxH/L37i/uZ+7H74ftA/LH8OP2y/Q7+hv7e/hv/cf+U/5L/hf97/1v/Pf8W///+6f66/g3/f/8hAOgArQGbAqQDXQTaBGMFvwWqBXoFMgWIBLwD1QKrAbAAoP/q/gD+TP2b/Cv8DPzg+9j7//tK/Kj8GP15/eL9Qv6i/uf+K/9B/1f/Tv9Q/03/I/8F/+3+sv67/gn/c/8ZAOMAvwHZAs0DTwTyBF4FvwXOBaIFYwXLBAYEHQPcAZAAd/9o/of9rfw//LT7kfup+877BPxY/BT9jv0E/mn+2P4U/0b/av9e/y//If/v/sD+jf6N/oj+Wv44/nf+y/5i/2EAXQHTAicEBgW4BRIGRgYoBrAFKAVgBIIDcQJtARQADf/5/Qn9VPzw+8T7m/vo+3X84vxx/UD+A/8h/4D/mf+X/1v/QP8j/7H+e/52/ij+E/4Q/kH+Uf5S/l7+vP7h/n7/qgC4AU0DwATSBYkG4wbmBoIG4gUVBQEEAgP4Ac0AeP+o/sX9+vxA/Pn7+fsC/Dr87vyA/Qj+y/5t/7L/qP+S/1//uv5X/gD+xf1O/Tr9YP1E/XD9uP1L/q3+Ev94/9D/EgCFAGEBcgK4AxIFvQU4Bi4G4QViBXoEpAOwAs4B+gA/AKj/Qv/H/lr+2/0v/dn81PzX/AL9qv0s/sH+dP/5/ysADgDq/4j/9/6T/jX+AP6o/Z/92v3U/QH+KP6k/s/++/4W/yr/WP+2/4oArQE/A48EZQW8BeQFbgXpBCMELANqAnwB1gApAMX/cP8L/53+9f1c/cP81/zv/GX9RP7w/of/KwByAHoALADL/1j/uP5g/u/90f2D/an97/0M/kT+eP7i/vf+A/8F/zb/W/+e/0MABwFhAs4D/QRmBZYFdgWfBNMDCQMuAnIBrAAcAKj/Y/8O/73+hP4N/rH9Sf03/XD9yP2H/hH/kP8cAFMAeQBRACQAyv9a//D+fv4p/s/94v3s/RL+MP5S/oj+xv7m/gz/Dv9V/3H/zv9aADgBgwLAA5cE0wQJBdAEAgRlA+gCSwLCAUQB1ABYAL7/SP/n/kf+wv1U/UD9TP1t/en9lP4A/6D/LQCAAH4AWgAVAK7/JP+g/jr+zv2U/av9zf3w/TP+W/5T/oT+2v4A/9v+MP+v/7v/ZgBEAYkCwAN/BBkFVgURBUoEswM/A7wCrgFSAcUAOwDJ/yj/Lf+X/g7+lP1E/Wj9bv24/Wj+8f53/xMAWAB3AD8AMADc/2b/C/+o/lD++/3C/b/9uf3Y/fT9/v0j/n3+4P4Z/zz/CAAYAHoAZgFVAn0DRAT5BC4F4gSOBM4DcQMKA/cBjAH/AFAA5v87/yL/rv4I/p39JP04/UD9rP1x/s7+Wf+o/yUA/v+6/9//jf9D/5r+h/7+/bv9pv2B/cD9vv0d/nD+ef7G/jD/g/9g//T/VQBPAEwBUwLyAugDsATqBKkEeQQ5BE4DKANvApkBLgFgABgAWv/0/un+O/7Z/WX9T/1h/Y79Mv57/s7+Yf+T/5b/gv97/2v/Fv+7/qv+Qf4m/hz+zP0G/gn+NP6A/qP+6/5I/5D/k/8IAHcAewA1AXACHgMLBMIEDAXaBIoE7ANGA+ACFwJoARIBjAAYALX/Qv/9/o/+7v1n/Rz9D/0c/ZP9BP6G/nD/s//l/wMA8P+g/37/F//O/p3+Y/6B/mD+Nv5U/j/+aP53/rj+Hv9u/5L/qf8qACUAogDIAYIChwNiBMME0QSxBCQEeAP4AigCggH5AGQA+/+S/yD/2v5+/gf+kP1c/T/9T/2z/RX+lv5o/8H/4v8YAPH/qP+O/zL/0f6//oj+Vv5C/gj+QP5B/nj+vv4F/3X/l/+y//L/HgAsAHEAwwGCAg8DUgSdBLMEWwQBBH0DqwIbAn0B4wBNAOj/hf8I/97+iv4H/qv9cf1i/WH9uf0t/rn+bf+x/xMALQArACUAl/9r/0j/7f61/j3+LP4R/vb9J/5O/qH++P4c/1D/jv/b//D/PwB3AUYC4gLvA54EtwRnBDIEwgPzAj4ClwHkAA0AfP8x/7b+a/4x/gL+xP2Y/bD9vv0D/mj+yv5t/8L/+P9DAB0AHADG/43/Wf/q/qT+XP47/j3+Nf5v/rP+3v5G/33/sf/i/yUAXgBtANgAXwEVAqkCDgOqA+8D6QO+A2sDAgOHAtwBSwGmABsAqP9E/8n+e/4l/tn9oP2A/YP9o/3d/TD+m/7h/hf/Vv+B/4r/kv+N/5n/aP9Q/zT/8/72/tv+8f4S/wb/Tv97/4f/s//2/x0AKAB5APAAcAHhAUECtgIKAyIDQQMzAxYD3wJwAgACagHQAEMAsv8f/7L+Sv7//bv9lv2o/bT91f0E/kb+lP7Q/g//PP9Y/4T/nf+m/4v/gf9s/z7/Kf8d/yb/PP9X/4D/qf/Z//v/IwBRAG4AnADoAEABmgHgATcCggK0AuoC8ALwAtACfAIdAqABEgFpAOb/SP/J/lr+B/7Q/ZX9k/2U/an9yf3v/TD+Zv68/g3/Uf+G/67/0P/s//b/+/8KAAAABwAIAAUADwAjACQAOwBQAGUAmQCiAMsA7QAQAUUBZwF2AZQBrwHBAbgBnQGOAWcBNwHtAJEAJgDN/4X/H//S/o3+Zv46/iH+E/4S/ij+R/5o/pz+0f4B/zj/cf+n/73/1P/4//T/CgAbAB0AJQAqADcANgA+AE4AWABcAH8AiQCbALgAwwDGAN0A7wDoAPMA6QDsAOkA1QDIAKgAjABkADIAGADi/73/of91/1D/Mv8b/w//9/7x/vb+7/4L/x7/MP89/1D/bP9+/5L/ov+8/8T/yf/k/+f/8f8AABIAFQAgADAAKwBJAEsASwBmAHAAfAB8AIkAkACLAJYAkQCGAHoAcwBeAEkAPAAoAAsAAAD2/9r/zv/B/63/rP+z/7H/r/+v/8P/zf/P/+L/8P/4/wAA8/8AAPj////4//D/6P/g/9b/0v/R/8//0v/d/+//+f/3/woAEQAUACYAOwA/AEkAVgBbAEoAUQA/ADUANAAYAAYABwDx/+v/7//i/+n/6P/a/+P/5P/p/+3/+v8CAPv/BQASAAEAAQAFAPz/+P8EAP////8BAPT//P/4//b//v/3//3/AAABAP3/BAAEAAAABQAFAPL/7P/3//3/8P/x//L/7//w/+3/8v/x/+r/7v/0//3////q/+7/8v/w//j/AgAAAPv/+f/3//T/5//c/9n/2f/U/9b/0P/N/9D/2v/c/+//7v/9/xYADQAeAC4AKAAwADYAPQAuADAAKQAaABAA/v/6//H/3v/f/93/3f/0/+z/6//u/wEA/P8DABAADgAVAA8ADQAJAAQA+v/q/+D/5f/n/9b/4P/g/+D/9//w/+//+f8FAP///v8KABMACQAPAA4ABQAWAPX/+v8AAPD/9P/1////BQAPABAAHAAWABYAHwAYABkAGQAOAAEACAAFAPz/6f/h/9f/2P/R/9D/1//V/+D/1//c/+f/4P/n//P/+v/7//P/BgAHAAgACgAIAAgA+P/+/wAA/P8AAAkA/v8BAP//BAAMAPr/CwAWABIAEwATABAAGAASAP3/GwAKAP7/AADo//T/8f/u/+D/5P/e/9T/7v/l/9X/5P/g/+v/9P/m/+7/CQAQAAkAAgD//xAACgADAAQACQAWAAMA/v/7/xQANgBXABkA0P/D/9v/5f8GAPL/6f8AAAEACAAXAAEAHQAoAB8AGAAJAAYA9/8FAPH/3//o/9v/3P/g/+//+P/R/9n/yP8AAAgA7f/0/w4AEwDy/wAA+P8DAA0AAAD7/wAAAwDg//v/BgAAAPz/8v/5/w4AEwD6//D/5v8cAKgAqAD//+v/9//V//X/AwDq/8v/x//D/9j/3v/b//X/8P/t//r/BAALAAUABQD///v/AAD///r/9P/c//D/BADy//r/+f8SAPD/6/8AAAQAAgAXAAIA8//9/wYADgAGAO7/CAAHAPj/8/8JAAEAAQD8//f/8f/5/wAA+v8LAPz/8v8FAPj///8WAAkA6//3//X/8P/8//j//f/5/+7/+P/5//f//f/9//P/8v8HAAQA+f/n//P/8//5/+//+f/2//b/AAD2//v//f/6/wUA/f/u/wEADQDn////+v/0/wkA//8DAP3/CwD9/wEAFgD/////AgAGAPz/FwD7/xkA9f/2//L/8//+/wsADQD8//v/BwDY/wEA3P8JAPr/7P/g/+v/+v/7//v/+P///wMA9v////r/+v/4//7/AAD4////5v/9/wQAAgD6/wAAAQD4/xgA9P/u/wQA//8EAPf///////P/AAAGABAADAAAAAAA7//4//7/EwABABMA7P/1//j/9f8FAOf/AgDh/w8A4f/7/xEA7P/l//L/CAD7/xUA+/8dAMj/9//1/wsAGAAGABgA2f/4/+//CwDl/wIA+v/2/+P/8P8OAAgA9v/6//r/9P/7/yQACQACAMr/EwD4/w8ABAAYALz/7f/d/xAABQD//xYA4v/8//T/EAD6/wkAFgD5//D/EAD+//r/AQD8//3/FQAUAPj/9v/6//j/CQAPAO7/+P/6//j/9f/4//j/6v/2//X//v/1/+f/HAD8/wEA7P8CAOf/EQD3//b/AwDo//X/EQDt/xIAEgD4//7/9//7/+3///8RABAA9//y//D/9/8QAO//+//t//v/6//7////+f/u/wEA9//3/wUA8//6/9X/BADz////5P8GAPb/IQD8/wEAAQAhABMA9P8EAMX/6//n/wEA5v8KAPv/AADf/wQABAAJAAcAHgAAAOj///8NAB4AEQDd//H/DQD+/wAA6f8LAAUAAgDQ//3/2f8YAP//4/8CAPP/CgDu/w0A9P8JAA4A4P8BAOj/8v/u//v//f8EAAoA8P8DAPz/+v8QAA8A9v/2//T/AQAgAN//BwD1/zYA2v////j/DwDh//P/BQAVAPz/6//5//X/9f8bABUAAwDL/wAA4f8VAPH/CADb/xoA6P/3/wkA+//o/+3//f/q/woA9v8HAOL/CAD4/wAADQD8/+H//f/P/wgADAD5/zAA/P/5/+T/AgDz//D/FAD6//b//P8JAPr/JgD9/xEA9v8JAO7/IAD3/wYAHQAAAOD/8//8/wcA9f/2//T/8P/T//z/4v/w/+f/EADg//z/CQAcAPj//P/a/wAA+f8WABQA7v/7/+3/+//1/xEAAAABAPv/8//9/ysA+P8AAPD//P/5/wAA9/8XAPn/8P/5//f/7v8QAPL//v8XAPj//P/m//f/DwD2/wAA8P/s//P/BQAQAPn/DQDR//r/5/8sAM//BwANAO7/CAD0/xUA5P8CAPf/4/8CAPj/EQD3/wYA7//8/wgAEgDs//3/7v/5/yUA9P8GAAsAw/8CAPL/+//2/wQABgDr/wwAEgD2//b/9f/8/+3/KADu/yQAuP9FAK7/PgC3/yYA5f/w/wIA7P8KAPb//P8GAOf/CAAbAOT/9v/w/xUA9v8AAOT/EQD7//3/zv8WACAAyP8yAN7/FgDW/xcA7f/+/wMA9P/7/wgA7P/9//7/CwDm/wAACQDx//v/9/8KAPf/2v8YAPT/CAABAO7/AwAcAN7/CAD7/yUA3P8gAN7/AgATANr/7f8lAPv/6P/3//7/CQDd/xkA4f8EAO//7v8kAOH/BwDx/+r/BgDi/wQA6f/y/w8A+f8LAOf/CwAJAOn/8P8kAPL/+P/b//D/EgD0/x0A3f8TAP//3/8QAOP/7v8AABAA+f//////2f/r//r/BwAtAPD/7v8wABYA1v8FAMn/DADw//3/BAD5/xUA6//1/wUA9/8AAOz/3/8KAP3/EQDz/wsAHwDb/wgACQDo/wEA4f/g/wkA/P8KAP//5v8YABEA7/8oAMb/NAARAOn/3P/W/wwA8P/T/0MACADp/wgA1/8rAOf/+P8QAOP/CADj/w8A/v+//xYAyP8GACgA3f8bANr/0/8FAOH/MAA7AOH/CwDB////AgA=

Zalo

7 小时前
2359 is verification code of 37258483720

YUBO

7 小时前
Yubo code: 4902. Valid for 3 minutes.

Zalo

7 小时前
1218 is verification code of 37258483720

YUBO

7 小时前
Yubo code: 4902. Valid for 5 minutes.

FACEBOOK

7 小时前
Use 231 865 para verificar a conta do Instagram.

Facebook

7 小时前
Use 984 716 to verify your Instagram account.

Viber

7 小时前
Your Viber code: 862175 You can also tap this link to finish your activation: https://unv.viber.com/a/862175 6EQbNfKgO8O

+445091430079

7 小时前
INCOMING call from +445091430079 was ANSWERED duration 2/11/2020 22:10:52 - 22:10:54

TAOVIP

7 小时前
[Wan Ba]Your code is 3288.

Facebook

7 小时前
Код подтверждения аккаунта Instagram: 392 018.

Facebook

7 小时前
613 847 senin Instagram kodun SIYRxKrru1t

Phone Code

8 小时前
775511 is your verification code for Dott - ride your way.

ALIPAY

8 小时前
Sign-up verification code: 1624. Never tell the code to anyone!(Alipay)

ALIPAY

8 小时前
Sign-up verification code: 6590. Never tell the code to anyone!(Alipay)

QIWIWallet

8 小时前
Vhod cherez QIWI Android. Kod: 9061. Nikomu ego ne soobshchaite.

BIGO

8 小时前
BIGO LIVE code: 628191. Don't share it with others.HO9Fu1AtmTf

+447781470659

8 小时前
[Hago]Use 6419 to verify your Hago account. lcNjTSCBGPD

Facebook

8 小时前
Usa 092 156 per verificare il tuo account Instagram.

Phone Code

9 小时前
836737 is your verification code for Fruitz.

muzmatch

9 小时前
[muzmatch] 169148 est le code de vérification

PayPal

9 小时前
PayPal: Your security code is: 652755. It expires in 10 minutes. Don't share this code with anyone.

Chiktopia

9 小时前
Hey Jeff, Chiktopia is now open! Your half price meal voucher has been extended until end Dec. Unsubscribe: https://bit.ly/2yuZr9A

Facebook

9 小时前
Use 386 091 to verify your Instagram account.

PayPal

9 小时前
PayPal: Your security code is: 309356. It expires in 10 minutes. Don't share this code with anyone.

Huawei

9 小时前
654462 - Huawei-Bestätigungscode. Geben Sie den Code aus Sicherheitsgründen nicht an andere weiter.

+46790642359

9 小时前
Your OkCupid code is 746857

AUTHMSG

9 小时前
Dein Opinion Outpost Sicherheitscode lautet: 428296.

Telegram

9 小时前
Telegram code: 67996 You can also tap on this link to log in: https://t.me/login/67996

Facebook

9 小时前
Use 427 653 to verify your Instagram account.

Telegram

9 小时前
Telegram code 92524

Telegram

9 小时前
Telegram code: 81094 You can also tap on this link to log in: https://t.me/login/81094

Telegram

9 小时前
Telegram code 30054

Facebook

9 小时前
Код подтверждения аккаунта Instagram: 458 179.

Facebook

10 小时前
Use 452 176 to verify your Instagram account.

Facebook

10 小时前
Use 139 045 to verify your Instagram account.

Facebook

10 小时前
Сбросьте пароль в Instagram по ссылке: https://ig.me/2wRmCpkUnsctMeS

TAOVIP

10 小时前
[SoulAPP]Your code for SoulAPP is 1095. Welcome to the world of Soul!

Facebook

10 小时前
Код подтверждения аккаунта Instagram: 648 103.

Facebook

10 小时前
Код подтверждения аккаунта Instagram: 071 382.